ID: 1153298889

View in Genome Browser
Species Human (GRCh38)
Location 18:3575522-3575544
Sequence CAATGTAACCAACTGTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153298889 Original CRISPR CAATGTAACCAACTGTTGCC AGG Intronic
906838033 1:49105156-49105178 TAATGTAAGCAAGTGCTGCCAGG + Intronic
909628048 1:77741078-77741100 AAATTTAACCAAATGTTTCCAGG + Intronic
913061121 1:115209084-115209106 CAATGTAAGCAACTTATACCTGG + Intergenic
915477674 1:156162601-156162623 CAGTGTAACCAGCTCTAGCCTGG - Intronic
917490972 1:175498214-175498236 CATAGTAAGAAACTGTTGCCAGG + Intronic
920268853 1:204747673-204747695 CAATGGTACCAACTGGTGGCAGG + Intergenic
920695478 1:208178667-208178689 CAATGTAAACACCTGTATCCAGG + Intronic
923802523 1:237224355-237224377 AAAAATAACCTACTGTTGCCTGG - Intronic
924845269 1:247762282-247762304 GAATGTAAGCAACTATTACCTGG - Intergenic
1065677941 10:28197939-28197961 CAATGTAACCAGATGTTACAGGG + Intronic
1067922545 10:50475165-50475187 CAATGTAAATAAATGTTGTCCGG + Intronic
1068384121 10:56301555-56301577 CAAGGTATCAAACTGTTGCTTGG - Intergenic
1070331294 10:75419196-75419218 CAATGTGGCGAAGTGTTGCCAGG - Intergenic
1070507898 10:77131667-77131689 AAATTTATCCAGCTGTTGCCAGG + Intronic
1080538966 11:33248399-33248421 TAATGTAAGGAACTGTTCCCAGG - Intergenic
1081727815 11:45343966-45343988 CTATGTACCCGACTTTTGCCTGG - Intergenic
1084390560 11:68873569-68873591 CAGTCTAACTAATTGTTGCCTGG + Intergenic
1085572933 11:77575047-77575069 CAATCTAACTAATTGTTGCCTGG + Intronic
1085585179 11:77696074-77696096 CAATGTAATCAACTGTATACCGG - Intronic
1086305073 11:85470958-85470980 CAATGTAAATAAGTGTTGCAAGG - Intronic
1089424976 11:118365430-118365452 CTATGGAACCACCTGTTACCTGG - Intronic
1090367862 11:126222986-126223008 AAATGTTACCATCTGTAGCCTGG - Intronic
1096942661 12:55364621-55364643 CAATGAAACTAACTGTAGGCTGG - Intergenic
1098806962 12:75032895-75032917 CAATGGAAGCAACTGATTCCAGG + Intergenic
1102209870 12:111118618-111118640 CAATGGATCCAACTGGTCCCAGG + Intronic
1109265494 13:60194264-60194286 CCATGTTACCAACTGTTACTTGG - Intergenic
1109905639 13:68836762-68836784 AAATGTAATCAACTGTTTCAGGG - Intergenic
1111242271 13:85490656-85490678 AACTGGAACCAACTGTCGCCTGG + Intergenic
1111311355 13:86490540-86490562 AAATGTAACCAAGTTTTGCAGGG - Intergenic
1112791743 13:103010321-103010343 GATTGTAATCAAATGTTGCCTGG - Intergenic
1113459416 13:110471555-110471577 CAATGTTACAAACTGTACCCAGG - Intronic
1114574250 14:23697987-23698009 CAATTTAACAAATTGCTGCCTGG + Intergenic
1114994091 14:28325774-28325796 CAATGTCTCCAAATGTTCCCAGG - Intergenic
1115766183 14:36625710-36625732 CAGTGTGGCCAATTGTTGCCAGG + Intergenic
1118242268 14:64071719-64071741 AAATGTAACTAGCTGTGGCCGGG + Intronic
1126338077 15:47608484-47608506 CAAAGTTACCAACTGTTATCTGG + Intronic
1126850178 15:52791654-52791676 CATTGTAACCACCGCTTGCCTGG - Intergenic
1127882641 15:63171800-63171822 CAAAGTAACCAACAGTGCCCAGG + Intergenic
1128739061 15:70071266-70071288 TACTGTAACCAAGTCTTGCCAGG + Intronic
1130448934 15:84031207-84031229 GACTGTAACCAACTGTCCCCAGG - Intronic
1130683010 15:86012859-86012881 CAAATTATCCAACTGTTGCTTGG - Intergenic
1137061602 16:35795542-35795564 CAATGAAAGCCACTGTTGCCTGG - Intergenic
1140331364 16:74060429-74060451 CAATGTATCTTACTGTTGCAAGG + Intergenic
1141596053 16:85097598-85097620 CAATGTCACCAAGTCGTGCCAGG + Intergenic
1142340581 16:89519675-89519697 AAATGTTAGCAACTGCTGCCGGG - Intronic
1143111147 17:4553762-4553784 CTCTGTAACAAAGTGTTGCCTGG + Intronic
1145789173 17:27614410-27614432 AAAGGAAACAAACTGTTGCCAGG - Intronic
1146267757 17:31464263-31464285 GAATGCCACCAACTGTTGGCCGG - Intronic
1149018571 17:51936837-51936859 CTATGTCCCCAACTGTTGCTTGG - Intronic
1153298889 18:3575522-3575544 CAATGTAACCAACTGTTGCCAGG + Intronic
1153660846 18:7324961-7324983 CAATTTAACCAACAGTAGCTTGG - Intergenic
1153752531 18:8247916-8247938 CAATGGAAAAAACTGTTACCTGG - Exonic
1156575518 18:38311007-38311029 GAATGGAACCAACTGTTGGAGGG - Intergenic
1157868396 18:51206466-51206488 CTATGTATACAACTGTTGCATGG - Intronic
1158704457 18:59779301-59779323 CACAGTCAGCAACTGTTGCCAGG + Intergenic
1163618934 19:18346343-18346365 TAATGCAGGCAACTGTTGCCAGG + Intronic
1163953991 19:20617146-20617168 CAATCTAACTAATTGTTGCCTGG + Intronic
1167139364 19:47638949-47638971 TAATGTAACCTGCTGTTGGCAGG - Intronic
926212535 2:10881576-10881598 AAATCTAAGCCACTGTTGCCAGG - Intergenic
929411618 2:41703279-41703301 CATTGTAACCAATTGTGACCAGG + Intergenic
932002048 2:67894001-67894023 CAATCTATCCTTCTGTTGCCTGG + Intergenic
932875131 2:75443450-75443472 CAATGAAGCCAAATTTTGCCAGG + Intergenic
937577218 2:123438094-123438116 CAATTTCACCAATTGTTGCCAGG + Intergenic
939335002 2:140815072-140815094 CAATGCAACCAACTGTTCCTGGG + Intronic
946648119 2:221861493-221861515 CAATGAAACCATCTGGTTCCTGG + Intergenic
1173515909 20:43665682-43665704 CAATGCAACAAACCTTTGCCTGG + Intergenic
1173722895 20:45275352-45275374 CAATGTAATCATCCGTTGTCAGG + Intergenic
1177139705 21:17344803-17344825 CTATGCAGCAAACTGTTGCCTGG - Intergenic
1178986573 21:37309797-37309819 CAAAATAACCAACAGTTTCCAGG + Intergenic
1180094428 21:45549556-45549578 CCTTGTAACCAACTGAGGCCTGG - Intergenic
1183295628 22:37027742-37027764 CGAGGGAACCACCTGTTGCCCGG - Intronic
1185130137 22:49034298-49034320 CAATGAAAACAACTATGGCCTGG + Intergenic
950037471 3:9897441-9897463 TAATGTAAGAAACTGTTGGCTGG - Intergenic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
952131576 3:30370293-30370315 CCATGGTCCCAACTGTTGCCAGG - Intergenic
955556912 3:60148050-60148072 CAAAGCAAACAAATGTTGCCTGG + Intronic
956483694 3:69698903-69698925 TGATCTAACCAACTGTGGCCAGG + Intergenic
963134218 3:141886021-141886043 CAATGTAGCCCACTGCTGTCGGG + Intronic
970097553 4:12480859-12480881 CACTGTTCCCAACTGTTGCTGGG - Intergenic
970614050 4:17751373-17751395 CAATGTTTCCATGTGTTGCCTGG + Intronic
972212187 4:36852174-36852196 AAATGTAACCAACTCTGGACTGG - Intergenic
973650575 4:52993676-52993698 CAATATTGCCAACTTTTGCCTGG - Intronic
973786690 4:54339100-54339122 CAATGTCTCCCTCTGTTGCCTGG - Intergenic
975074914 4:70194032-70194054 TAATGTAACCAATTGTTGCCTGG - Intergenic
975416526 4:74111696-74111718 CAATGTGACCAGCTATTTCCAGG - Intergenic
977702504 4:100036109-100036131 CCATGTAGCAAACTTTTGCCTGG + Intergenic
980944475 4:139305503-139305525 CTATGTAATCAAGTGTTGCTAGG + Intronic
982663924 4:158237830-158237852 AAATGCAACCAACTTTAGCCAGG + Intronic
992823837 5:80527522-80527544 CAATGTAACCATTTGTTTCTAGG + Intronic
998874655 5:146587086-146587108 GAATCGAACCAACTGTTGCAAGG + Intronic
1000121057 5:158198265-158198287 AAATGTACCCAAATGTTACCTGG - Intergenic
1004804777 6:19190932-19190954 CAACCCAACCAACTGTTGCTAGG - Intergenic
1004884382 6:20037463-20037485 CAATGGAACCACCTGATGTCTGG + Intergenic
1008150090 6:47939632-47939654 AAAGGTAACCAACTGGTGCAAGG - Intronic
1009451742 6:63809319-63809341 CAAATTAACCAAATGTTACCTGG - Intronic
1011037049 6:82989354-82989376 CCATGTAGCCAACTGTCCCCAGG - Intronic
1011299133 6:85855575-85855597 CAATCTAACTAATTGTTGTCTGG - Intergenic
1012848593 6:104420657-104420679 CAATGTAACAGACAGTTGCAAGG + Intergenic
1014834330 6:126143765-126143787 TTATGTAACCAAGTGTTGCTTGG + Intergenic
1020971972 7:14954800-14954822 CTATGTAACCAACTATTTACTGG - Intronic
1028821102 7:95212986-95213008 CAATGTAACCAAGAGTGGCTAGG - Intronic
1028932775 7:96431659-96431681 CAATATAGGCAACTGTTGCAAGG + Intergenic
1032247799 7:130227960-130227982 CAAGCTAACCAACTGTTGCCTGG + Intergenic
1033777137 7:144624634-144624656 CTATGCAACAAACTGGTGCCTGG - Intronic
1041134284 8:54740005-54740027 TAATGTAAGCAACTGTTACTGGG + Intergenic
1042160045 8:65883852-65883874 CAATGTAATAATCTGTAGCCTGG - Intergenic
1050746185 9:8878947-8878969 AAATGCAACCAACTGTAGCTTGG - Intronic
1057131502 9:92657445-92657467 AAATGTAGCCAACTGCTGCCTGG + Intronic
1186028504 X:5340873-5340895 CAATGTATCAAAGTGGTGCCAGG + Intergenic
1186647942 X:11527316-11527338 CGAATTAACCAATTGTTGCCAGG + Intronic
1193416982 X:81237602-81237624 CAATGTAACCCTCTGTGGCAAGG - Intronic
1195366747 X:104134003-104134025 CAATCGAATCAACTGTGGCCAGG + Intronic
1199547950 X:149027827-149027849 CAATGTCTCCAACTATTTCCTGG - Intergenic
1201607021 Y:15798147-15798169 AAAGGTAACCAACAGTTTCCTGG - Intergenic