ID: 1153300937

View in Genome Browser
Species Human (GRCh38)
Location 18:3591555-3591577
Sequence GTGCCACCTACTTGGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4355
Summary {0: 1, 1: 1, 2: 80, 3: 1025, 4: 3248}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153300937_1153300949 11 Left 1153300937 18:3591555-3591577 CCAGCCTTCCAAGTAGGTGGCAC 0: 1
1: 1
2: 80
3: 1025
4: 3248
Right 1153300949 18:3591589-3591611 GCTACTTGGAAGGCTGGGGCGGG 0: 36
1: 3401
2: 84306
3: 186371
4: 222570
1153300937_1153300943 5 Left 1153300937 18:3591555-3591577 CCAGCCTTCCAAGTAGGTGGCAC 0: 1
1: 1
2: 80
3: 1025
4: 3248
Right 1153300943 18:3591583-3591605 GTCCCAGCTACTTGGAAGGCTGG 0: 40
1: 847
2: 2790
3: 4358
4: 4882
1153300937_1153300944 6 Left 1153300937 18:3591555-3591577 CCAGCCTTCCAAGTAGGTGGCAC 0: 1
1: 1
2: 80
3: 1025
4: 3248
Right 1153300944 18:3591584-3591606 TCCCAGCTACTTGGAAGGCTGGG 0: 71
1: 1569
2: 3278
3: 4481
4: 6463
1153300937_1153300948 10 Left 1153300937 18:3591555-3591577 CCAGCCTTCCAAGTAGGTGGCAC 0: 1
1: 1
2: 80
3: 1025
4: 3248
Right 1153300948 18:3591588-3591610 AGCTACTTGGAAGGCTGGGGCGG 0: 21
1: 1193
2: 15530
3: 31084
4: 48300
1153300937_1153300950 14 Left 1153300937 18:3591555-3591577 CCAGCCTTCCAAGTAGGTGGCAC 0: 1
1: 1
2: 80
3: 1025
4: 3248
Right 1153300950 18:3591592-3591614 ACTTGGAAGGCTGGGGCGGGAGG 0: 2
1: 103
2: 2261
3: 20694
4: 67728
1153300937_1153300940 -3 Left 1153300937 18:3591555-3591577 CCAGCCTTCCAAGTAGGTGGCAC 0: 1
1: 1
2: 80
3: 1025
4: 3248
Right 1153300940 18:3591575-3591597 CACCTGTAGTCCCAGCTACTTGG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
1153300937_1153300942 1 Left 1153300937 18:3591555-3591577 CCAGCCTTCCAAGTAGGTGGCAC 0: 1
1: 1
2: 80
3: 1025
4: 3248
Right 1153300942 18:3591579-3591601 TGTAGTCCCAGCTACTTGGAAGG 0: 1551
1: 47936
2: 163520
3: 225748
4: 234422
1153300937_1153300946 7 Left 1153300937 18:3591555-3591577 CCAGCCTTCCAAGTAGGTGGCAC 0: 1
1: 1
2: 80
3: 1025
4: 3248
Right 1153300946 18:3591585-3591607 CCCAGCTACTTGGAAGGCTGGGG 0: 3317
1: 97483
2: 208860
3: 248692
4: 260814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153300937 Original CRISPR GTGCCACCTACTTGGAAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr