ID: 1153308312

View in Genome Browser
Species Human (GRCh38)
Location 18:3652828-3652850
Sequence GAACACATGCTGCTTATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 499}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153308311_1153308312 0 Left 1153308311 18:3652805-3652827 CCTTGCAGACAAGTCTCAACACA 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1153308312 18:3652828-3652850 GAACACATGCTGCTTATCACTGG 0: 1
1: 0
2: 0
3: 12
4: 499
1153308310_1153308312 22 Left 1153308310 18:3652783-3652805 CCTATGAGGTATAAACAAATCGC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1153308312 18:3652828-3652850 GAACACATGCTGCTTATCACTGG 0: 1
1: 0
2: 0
3: 12
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153308312 Original CRISPR GAACACATGCTGCTTATCAC TGG Intronic
900655256 1:3753772-3753794 CCACACATGCTGCTGGTCACAGG - Intronic
900849870 1:5134135-5134157 GAACACATGCTGCCTAAGTCTGG + Intergenic
900855846 1:5182673-5182695 GAACAAATGCTCATCATCACTGG - Intergenic
901326893 1:8372064-8372086 GAAGACATGTGGCTTATCACAGG - Intronic
901930448 1:12593655-12593677 GAACACTAGGTGCTCATCACAGG - Intronic
904249999 1:29216475-29216497 GAACAGCTGCTGCTAATCACAGG + Intronic
907648893 1:56274069-56274091 GAAAAAATGCTCATTATCACTGG + Intergenic
907979406 1:59466749-59466771 GAAAACATGCTCATCATCACTGG + Intronic
908177919 1:61574129-61574151 GAAAAAATGCTCATTATCACTGG - Intergenic
908942110 1:69447687-69447709 GAAAAAATGCTCATTATCACTGG + Intergenic
909380450 1:74991858-74991880 GAAAAAATGCTCATTATCACTGG + Intergenic
909678586 1:78265612-78265634 GAAAAAATGCTCATTATCACTGG - Intergenic
911714360 1:101113883-101113905 GAACAAATGCTCATCATCACTGG + Intergenic
911946407 1:104114921-104114943 GAAAAAATGCTGATCATCACTGG + Intergenic
912025638 1:105167790-105167812 GAATAAATGCTGATCATCACTGG + Intergenic
912224623 1:107719455-107719477 GAAAAAATGCTCCTCATCACTGG + Intronic
914219556 1:145667333-145667355 GAAAAAATGCTGATCATCACTGG - Intronic
914459184 1:147866992-147867014 GAAAAAATGCTCATTATCACTGG + Intergenic
915187590 1:154120141-154120163 GAAAAAATGCTCCTCATCACTGG - Intronic
915862331 1:159458206-159458228 GAAAAAATGCTCATTATCACTGG + Intergenic
916077401 1:161209891-161209913 GAATGCATGCTGCTTATATCCGG + Exonic
916250982 1:162737906-162737928 GAAAAAATGCTCATTATCACTGG - Intronic
916846897 1:168660311-168660333 GAAAAAATGCTCATTATCACTGG - Intergenic
916856488 1:168755737-168755759 GAGCACAAGCTGCATAGCACAGG - Intergenic
917403170 1:174674835-174674857 GAAAACATGCTCATCATCACTGG - Intronic
917417262 1:174823520-174823542 GAACCCTTGTTGCTTCTCACTGG + Intronic
917901381 1:179546493-179546515 GAACTTCTGCTGCTCATCACTGG + Intronic
918171572 1:182003091-182003113 GAACACAAGCTGCTGAGCATCGG - Intergenic
918505778 1:185252529-185252551 GAAAAAATGCTCATTATCACTGG - Intronic
918824115 1:189299883-189299905 GAAAAAATGCTCATTATCACTGG + Intergenic
919099323 1:193074484-193074506 GAAAACATGCTCATCATCACTGG - Intronic
919249995 1:195042711-195042733 GAAAAAATGCTGATCATCACTGG + Intergenic
919391123 1:196987116-196987138 GAAAAAATGCTGATCATCACTGG - Intronic
920429166 1:205904855-205904877 GAAAAAATGCTGCTCATCAGTGG + Intergenic
920597106 1:207283092-207283114 GACCACATCCTGCTTTTCTCAGG + Intergenic
920662776 1:207931789-207931811 GAGCACATGCTGCTCAACAATGG + Intergenic
922129711 1:222765379-222765401 GAAAAAATGCTGATCATCACTGG + Intergenic
924469997 1:244334623-244334645 GAAAACATGCTCATCATCACTGG + Intergenic
924639640 1:245821790-245821812 GAAAACATGCTCATCATCACTGG + Intronic
924912260 1:248526746-248526768 GAAAAAATGCTCATTATCACTGG - Intergenic
1062918516 10:1261543-1261565 GAAAAAATGCTCATTATCACTGG + Intronic
1065848862 10:29769849-29769871 GAACAAATGCTCATCATCACTGG - Intergenic
1066032371 10:31441801-31441823 GAAAAAATGCTCATTATCACTGG + Intronic
1066172757 10:32869316-32869338 GAAAAAATGCTCATTATCACTGG - Intronic
1066447510 10:35497439-35497461 TAAAATATTCTGCTTATCACTGG + Intronic
1068104262 10:52593668-52593690 GAACAGATGCTGCTTAGCATAGG - Intergenic
1068586744 10:58808668-58808690 CAACACATCATGCTAATCACTGG - Intronic
1069091081 10:64199448-64199470 GAGACCTTGCTGCTTATCACAGG + Intergenic
1071273417 10:84029912-84029934 AAGCACATGCTTCCTATCACTGG + Intergenic
1071351319 10:84748796-84748818 GAAAACATGCTCATCATCACTGG + Intergenic
1071362017 10:84857477-84857499 GACCAAATGAGGCTTATCACAGG - Intergenic
1071740325 10:88350979-88351001 GAAAAAATGCTCCTTATCACTGG - Intronic
1072306808 10:94115514-94115536 GAAAAAATGCTGATCATCACTGG - Intronic
1072393871 10:95018208-95018230 GAAAAAATGCTCATTATCACTGG - Intergenic
1072400226 10:95090793-95090815 GAAAAAATGCTCATTATCACTGG + Intergenic
1072736815 10:97884798-97884820 AAAGACAACCTGCTTATCACAGG - Intronic
1074017766 10:109551682-109551704 GAAAAAATGCTCATTATCACTGG + Intergenic
1074337777 10:112595555-112595577 GAAAAAATGCTCATTATCACTGG + Intronic
1075235955 10:120728914-120728936 GAAAAAATGCTCCTCATCACTGG - Intergenic
1075936220 10:126343776-126343798 GAAAAAATGCTCCTCATCACTGG - Intronic
1076458585 10:130622601-130622623 GAACACGTGCAGCTTAGCAGAGG - Intergenic
1078580300 11:12534379-12534401 GAACACAGGCTGCTCAGCCCAGG - Intergenic
1078753257 11:14185175-14185197 TTATACATTCTGCTTATCACAGG + Intronic
1078978196 11:16501705-16501727 GAACAAATGCTCATCATCACTGG + Intronic
1079070383 11:17340100-17340122 GAACAAATGCTCATCATCACTGG - Intronic
1079578301 11:22030330-22030352 GAAAAAATGCTCATTATCACCGG + Intergenic
1080200491 11:29663940-29663962 GAAAAAATGCTCTTTATCACTGG + Intergenic
1080211225 11:29787831-29787853 GAACAAATGCTCATCATCACTGG - Intergenic
1080797474 11:35578633-35578655 GAAAAAATGCTCATTATCACTGG + Intergenic
1082744055 11:56943128-56943150 GAAAAAATGCTCATTATCACTGG - Intergenic
1082967712 11:58984695-58984717 GAAAAAATGCTCATTATCACTGG - Intronic
1083038678 11:59665856-59665878 GAACACATGTTACTTAGAACAGG - Intronic
1084456193 11:69269428-69269450 GACCACATGCTGCCTCTGACTGG - Intergenic
1084734785 11:71097630-71097652 AAGCACATCCTGCTTATCCCTGG - Intronic
1084908169 11:72364982-72365004 GAACAGATGCTCAATATCACTGG + Intronic
1085292959 11:75413087-75413109 GAACACATGTTAATTTTCACAGG - Intronic
1086130406 11:83395425-83395447 GAAAAAATGCTCATTATCACTGG - Intergenic
1086304182 11:85462044-85462066 GAAAACATGCTCATCATCACTGG + Intronic
1086304607 11:85466053-85466075 GAAAACATGCTCATCATCACTGG - Intronic
1086640903 11:89154873-89154895 GAAAACATGCTCATCATCACTGG + Intergenic
1087103683 11:94389563-94389585 GAAAAAATGCTCATTATCACTGG + Intronic
1087224321 11:95580885-95580907 GAAAAAATGCTCCTCATCACTGG - Intergenic
1090115550 11:123968306-123968328 GAAAACATGCTCATCATCACTGG + Intergenic
1090410120 11:126502233-126502255 GATCTCATGCTGCCTAGCACAGG + Intronic
1091837822 12:3598114-3598136 CAACACATGCTGCTTTTCCTGGG + Intergenic
1092664555 12:10781617-10781639 GAAAACATGCTCATCATCACTGG + Intergenic
1093660410 12:21750265-21750287 GAAAACATGCTCATCATCACTGG + Intronic
1093792281 12:23266378-23266400 GAAAAAATGCTCATTATCACTGG + Intergenic
1093979995 12:25465568-25465590 GAAAACATGCTCATCATCACTGG - Intronic
1094313180 12:29108434-29108456 GAAAAAATGCTCCTCATCACTGG - Intergenic
1094760434 12:33526102-33526124 GAACAAATGCTCATCATCACTGG + Intergenic
1095083759 12:38036808-38036830 GAAGAAATGCTCATTATCACTGG + Intergenic
1095348338 12:41179690-41179712 GAACAAATGCTCATCATCACTGG - Intergenic
1095798962 12:46251730-46251752 GAAAAAATGCTCATTATCACTGG + Intronic
1096482940 12:51954259-51954281 AAACTCATTCTCCTTATCACTGG - Intronic
1096895080 12:54813319-54813341 GAAAAAATGCTCATTATCACTGG - Intergenic
1096931570 12:55215567-55215589 GAAAAAATGCTCATTATCACTGG - Intergenic
1098684369 12:73400062-73400084 GAAAAAATGCTCATTATCACTGG + Intergenic
1098991584 12:77069570-77069592 GAAAAAATGCTCCTCATCACTGG - Intergenic
1099434759 12:82629894-82629916 GAAAAAATGCTGATCATCACTGG - Intergenic
1099755847 12:86847058-86847080 GAAAAAATGCTGATCATCACTGG + Intergenic
1100035053 12:90240391-90240413 GAAAAAATGCTGATCATCACTGG + Intergenic
1100751721 12:97705496-97705518 GAAAAAATGCTCATTATCACTGG - Intergenic
1100753924 12:97729103-97729125 GAAAAAATGCTCATTATCACTGG + Intergenic
1103841672 12:123870184-123870206 GAACTAATGCTACTCATCACTGG - Intronic
1105319736 13:19307379-19307401 GAAAAAATGCTCATTATCACTGG + Intergenic
1106091947 13:26603922-26603944 CAACACATGCTACTTTCCACTGG - Intronic
1106325863 13:28688844-28688866 GAAAAAATGCTCATTATCACTGG - Intergenic
1108403108 13:50068479-50068501 CACTACATCCTGCTTATCACTGG + Intergenic
1108510871 13:51154621-51154643 CAATACATGCTGCTTCTGACTGG - Intergenic
1108762744 13:53589424-53589446 GAAAACATGCTCATCATCACTGG + Intergenic
1109565861 13:64115639-64115661 GAAAAAATGCTCATTATCACTGG - Intergenic
1109964362 13:69672203-69672225 CAACAGATGCTCATTATCACTGG + Intergenic
1110156516 13:72323217-72323239 GAACAAATGCTCATCATCACTGG + Intergenic
1110199218 13:72829029-72829051 GAACAAATGCTCATCATCACTGG - Intronic
1110819020 13:79892475-79892497 GAAAAAATGCTCATTATCACTGG + Intergenic
1111214266 13:85122798-85122820 GAAAACATGCTCATCATCACTGG + Intergenic
1111600656 13:90469918-90469940 GAAGACATGCTCATGATCACCGG - Intergenic
1111662615 13:91230439-91230461 GAAAAAATGCTCATTATCACTGG - Intergenic
1112834981 13:103503794-103503816 GAAAAAATGCTCATTATCACTGG - Intergenic
1112961658 13:105134599-105134621 GAAAAAATGCTCATTATCACTGG + Intergenic
1113009174 13:105743903-105743925 GAAAACATGCTCATCATCACTGG + Intergenic
1113276446 13:108735890-108735912 GAACAAATGCTCATCATCACTGG - Intronic
1113288518 13:108880109-108880131 GAACAAATGCTCATCATCACTGG - Intronic
1114304169 14:21405842-21405864 GAACACAAGGTGCTACTCACAGG - Exonic
1114560442 14:23585946-23585968 GAAAAAATGCTCATTATCACTGG - Intergenic
1114676977 14:24448308-24448330 GAAAAAATGCTCATTATCACTGG - Intergenic
1114944662 14:27664639-27664661 GAAAAAATGCTCATTATCACTGG - Intergenic
1115048154 14:29023559-29023581 GAAAAAATGCTCATTATCACTGG - Intergenic
1115726651 14:36224486-36224508 GGACACATCTTGTTTATCACTGG - Intergenic
1115978460 14:39022561-39022583 GAAAACATGCTCATCATCACTGG + Intergenic
1116181877 14:41544808-41544830 GAACAGGTGCTGCTTATTTCAGG - Intergenic
1116285619 14:42968253-42968275 GAAAACATGCTCATCATCACTGG - Intergenic
1117347865 14:54851616-54851638 GAAAAAATGCTCCTCATCACTGG + Intronic
1117856293 14:60037513-60037535 GAAAAAATGCTCATTATCACTGG - Intronic
1118074714 14:62285244-62285266 GAACAAATGCTCATCATCACTGG - Intergenic
1118078393 14:62328441-62328463 GAACAAATGCTCATCATCACTGG + Intergenic
1118578958 14:67273869-67273891 GAAAAAATGCTCATTATCACTGG - Intronic
1119863789 14:77956397-77956419 AAACAAGTGCTGCTTTTCACGGG + Intergenic
1120502359 14:85312027-85312049 GAACATATGTTGCTTTTCATAGG - Intergenic
1120743347 14:88131743-88131765 GAAAAAATGCTCATTATCACTGG - Intergenic
1121164996 14:91786193-91786215 CAACAGATGCTGTTTATGACGGG - Intronic
1123206995 14:106723517-106723539 GAACCCAGGCTGCTTCTCAGTGG - Intergenic
1123212014 14:106770520-106770542 GAACCCAGGCTGCTTCTCAGTGG - Intergenic
1123510673 15:20996072-20996094 GAAAACATGCTCATCATCACTGG - Intergenic
1123567891 15:21569821-21569843 GAAAACATGCTCATCATCACTGG - Intergenic
1123603999 15:22005144-22005166 GAAAACATGCTCATCATCACTGG - Intergenic
1126863187 15:52907433-52907455 GAAAAAATGCTCATTATCACTGG + Intergenic
1129340252 15:74881212-74881234 GAATCCATGCTCCTGATCACAGG + Intergenic
1130383114 15:83388846-83388868 GAAAACATGCTCATCATCACTGG + Intergenic
1131284646 15:91047265-91047287 GAAAACATGCTCATCATCACTGG + Intergenic
1131719769 15:95155133-95155155 GAAAAAATGCTGATCATCACTGG - Intergenic
1131858815 15:96629312-96629334 TAGCAGAGGCTGCTTATCACGGG - Intergenic
1132225822 15:100140714-100140736 GAACACAGGCTCCTTCCCACTGG + Intronic
1202976250 15_KI270727v1_random:296910-296932 GAAAACATGCTCATCATCACTGG - Intergenic
1133605858 16:7386975-7386997 GAATAAATGCTCTTTATCACTGG - Intronic
1133818660 16:9217032-9217054 GAAAAAATGCTCATTATCACTGG - Intergenic
1134796972 16:17049265-17049287 GAAAAAATGCTCCTCATCACTGG - Intergenic
1134895354 16:17881466-17881488 GAAGACAAGCTTCCTATCACAGG - Intergenic
1135645058 16:24154613-24154635 GAACACCAGCTGCTCATAACTGG + Intronic
1135956312 16:26959311-26959333 AACCACATTCTGCTTATCTCTGG + Intergenic
1136730294 16:32405095-32405117 GATGACATTCTGGTTATCACTGG + Intergenic
1137998346 16:53245336-53245358 GAACACAAGGTGCTTTTGACTGG + Exonic
1138365766 16:56475413-56475435 GATCCCATGCTGCTTAACAGTGG - Intronic
1140169269 16:72586175-72586197 GAAAACATGCTCGTCATCACTGG + Intergenic
1140338485 16:74134497-74134519 GAAAACATGCTCATCATCACTGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1147343005 17:39766292-39766314 GGATACATGCTGCTGATAACTGG + Exonic
1149940030 17:60854588-60854610 GAAAAAATGCTCATTATCACTGG + Intronic
1150221205 17:63496835-63496857 GAAGCCATGCAGCTGATCACGGG + Exonic
1153099049 18:1444202-1444224 GAAAAAATGCTCATTATCACTGG - Intergenic
1153114777 18:1641928-1641950 GAAAAAATGCTCATTATCACTGG - Intergenic
1153308312 18:3652828-3652850 GAACACATGCTGCTTATCACTGG + Intronic
1153441740 18:5127383-5127405 GAAAAAATGCTCATTATCACTGG + Intergenic
1156298479 18:35814783-35814805 GAAAAAATGCTCATTATCACTGG + Intergenic
1156925446 18:42572563-42572585 GAAAAAATGCTGATCATCACTGG + Intergenic
1157122944 18:44928677-44928699 GAAAACATGCTGATCATCACTGG - Intronic
1157204499 18:45687184-45687206 GCACAGCTGCTGCTTCTCACTGG - Intergenic
1157511061 18:48274955-48274977 GGTCACAGGCTGCTAATCACCGG + Intronic
1157854618 18:51093576-51093598 GAAAAAAAGCTGATTATCACTGG - Intergenic
1157910836 18:51616030-51616052 AAACAAATGCTGCTTATCTTCGG + Intergenic
1158731608 18:60030425-60030447 GAAAAAATGCTCATTATCACTGG - Intergenic
1160593034 18:79954629-79954651 TAACACATGGTGCTTATAAAAGG + Intergenic
1160617445 18:80142488-80142510 GAAGACATGTTGCTTCTCAGTGG + Intronic
1164096731 19:22017135-22017157 GAAAATATGCTCATTATCACTGG + Intergenic
1164471439 19:28538883-28538905 GAACAAATGCTCATCATCACTGG + Intergenic
1164496476 19:28768520-28768542 GAACAAATGCTCATCATCACTGG - Intergenic
1165688384 19:37842763-37842785 GAAAAAATGCTCATTATCACTGG + Intergenic
1165981119 19:39725083-39725105 GAAAAAATGCTTATTATCACTGG + Intergenic
925173237 2:1765309-1765331 GAAAAAATGCTCCTCATCACTGG + Intergenic
926517545 2:13867677-13867699 GAAAAAATGCTGATCATCACTGG + Intergenic
927044090 2:19259746-19259768 GAAAACATGCTCATCATCACTGG + Intergenic
929260086 2:39856866-39856888 TAACCCATTCTGGTTATCACTGG - Intergenic
929339836 2:40801794-40801816 GAAAAAATGCTCCTCATCACTGG - Intergenic
929825140 2:45304182-45304204 GAACTCCTGAAGCTTATCACTGG - Intergenic
930415206 2:51082081-51082103 GATCACATGGTGCTTATGAAAGG - Intergenic
931468752 2:62516268-62516290 GAAAAAATGCTCATTATCACTGG - Intergenic
932006210 2:67929645-67929667 GACCACAGCCTGCTCATCACTGG - Intergenic
932483925 2:72069224-72069246 GAAAAAATGCTCATTATCACTGG + Intergenic
932825184 2:74932685-74932707 AAACACATGCTGCTGGTCACCGG - Intergenic
932937906 2:76127673-76127695 GAAAAAATGCTCATTATCACTGG - Intergenic
932963318 2:76441439-76441461 GAAAACATGCTCATCATCACTGG - Intergenic
933137127 2:78752209-78752231 GAAAAAATGCTCCTCATCACTGG + Intergenic
933622701 2:84561785-84561807 GAAAAAATGCTGATCATCACTGG + Intronic
933653446 2:84867828-84867850 GAACAAATGCTCATCATCACTGG + Intronic
934469031 2:94498409-94498431 GAAAAAATGCTCCTCATCACTGG + Intergenic
934585906 2:95494813-95494835 GAAAAAATGCTGATCATCACTGG - Intergenic
938370855 2:130767566-130767588 GGACACAGGCTGCACATCACAGG + Exonic
938485465 2:131702676-131702698 GAAAAAATGCTCATTATCACTGG + Intergenic
939942562 2:148367721-148367743 GAACAAAAGCTCTTTATCACTGG + Intronic
940156943 2:150667158-150667180 GAACAAATGCTGGTAACCACAGG + Intergenic
940437770 2:153674939-153674961 GAAAAAATGCTCATTATCACTGG + Intergenic
940956952 2:159738733-159738755 GAACTTATGGTGCTTATCCCAGG - Intronic
941237026 2:162987662-162987684 GAAAACATGCTCATCATCACTGG + Intergenic
941896548 2:170634859-170634881 GAAAAAATGCTGATCATCACTGG + Intronic
943010134 2:182437841-182437863 ATACACTTGATGCTTATCACTGG - Intronic
943465790 2:188227660-188227682 TAACCCATTCTGTTTATCACTGG - Intergenic
943506647 2:188768872-188768894 GAAAAAATGCTCATTATCACTGG - Intronic
943660847 2:190557716-190557738 GAAAAAATGCTCATTATCACTGG + Intergenic
943866074 2:192925915-192925937 GAAAAAATGCTCATTATCACTGG - Intergenic
943929490 2:193831617-193831639 GAAAAAATGCTCATTATCACTGG - Intergenic
944393109 2:199240354-199240376 GAAAAAATGCTCATTATCACTGG - Intergenic
944984023 2:205154290-205154312 GAAAACATGCTCATCATCACTGG + Intronic
946205408 2:218103330-218103352 GAAAAAATGCTCATTATCACTGG - Intergenic
947244932 2:228036276-228036298 GAAAAAATGCTCCTCATCACTGG + Intronic
947307208 2:228760954-228760976 GAAAAAATGCTCCTCATCACTGG + Intergenic
948240058 2:236423444-236423466 GAAAACATGCTCATCATCACTGG + Intronic
1169392311 20:5200150-5200172 GAAAAAATGCTCATTATCACTGG - Intergenic
1170979632 20:21199485-21199507 TAACACACACTGATTATCACTGG + Intronic
1171075653 20:22120318-22120340 GAAAAAATGCTCCTCATCACTGG + Intergenic
1171267894 20:23787568-23787590 GAAAAAATGCTCATTATCACTGG - Intergenic
1171418714 20:25001941-25001963 GAACAAATGCTTATCATCACTGG - Intergenic
1171842422 20:30230754-30230776 GAAAACATGCTCATCATCACTGG - Intergenic
1173712095 20:45167733-45167755 GAAAAAATGCTGATCATCACTGG + Intergenic
1177251650 21:18599216-18599238 GAAAAAATGCTCATTATCACTGG - Intergenic
1177290602 21:19106454-19106476 GAAAAAATGCTCCTCATCACTGG - Intergenic
1180656766 22:17428074-17428096 GAAAACATGCTCTTCATCACTGG - Intronic
1181663663 22:24374015-24374037 GAAAAAATGCTCATTATCACTGG + Intronic
1181778032 22:25173942-25173964 GGACGGAAGCTGCTTATCACAGG - Intronic
1182705513 22:32275964-32275986 GAAAAAATGCTCATTATCACTGG - Intergenic
949308219 3:2667338-2667360 GAAAAAATGCTCATTATCACTGG - Intronic
949689658 3:6621182-6621204 GAATACAGGCTGCTGAACACTGG + Intergenic
950231832 3:11282898-11282920 GAACATATGCTGTTTGTCAGCGG + Intronic
951175203 3:19591004-19591026 GAAAAAATGCTCATTATCACTGG - Intergenic
952067724 3:29592401-29592423 GAAAAAATGCTCATTATCACTGG + Intronic
952724396 3:36568088-36568110 GAAAAAATGCTCATTATCACCGG - Intergenic
952813516 3:37426104-37426126 GAAAAAATGCTTCTCATCACTGG - Intronic
953158270 3:40394723-40394745 GAACACTTCCTGCTTTGCACAGG + Intronic
955482149 3:59400845-59400867 GAAAAAATGCTCATTATCACTGG + Intergenic
955627158 3:60930608-60930630 GAAAAAATGCTGATCATCACTGG + Intronic
955629819 3:60961180-60961202 GAAAACATGCTCATCATCACTGG - Intronic
956038921 3:65125444-65125466 GAAAAAATGCTCATTATCACTGG + Intergenic
956363681 3:68475907-68475929 GAAAAAATGCTCCTCATCACTGG - Intronic
957584650 3:82118302-82118324 GAAAAAATGCTCCTCATCACTGG + Intergenic
958585409 3:96081000-96081022 GAAAAAATGCTGATCATCACTGG + Intergenic
958783397 3:98569904-98569926 GAAAACATGCTCATCATCACTGG - Intronic
959187871 3:103069652-103069674 GAAAAAATGCTCATTATCACTGG + Intergenic
959257882 3:104037527-104037549 GAAAAAATGCTTATTATCACTGG - Intergenic
959736951 3:109670180-109670202 GAAAAAATGCTCATTATCACTGG + Intergenic
959741599 3:109726702-109726724 GAAAAAATGCTCATTATCACTGG - Intergenic
960252229 3:115468906-115468928 GAAAAAATGCTCATTATCACTGG - Intergenic
961527806 3:127518241-127518263 GAACATATGCTGCTTTTGATAGG - Intergenic
963333886 3:143949106-143949128 AAACAAATGCAGCTTATGACTGG + Intergenic
963666872 3:148199031-148199053 GAAAACATGCTCATCATCACTGG - Intergenic
964270507 3:154950543-154950565 GAAAAAATGCTCCTTATCACTGG + Intergenic
965038337 3:163471586-163471608 GAAAAAATGCTCATTATCACTGG - Intergenic
968165398 3:196460660-196460682 GAGCTCATGCTGGTTATGACTGG - Intergenic
969899070 4:10331798-10331820 GAACAAATGCTCATCATCACTGG - Intergenic
970002601 4:11379489-11379511 GAAAACATGCTCATCATCACTGG - Intergenic
970259348 4:14207845-14207867 GAAAAAATGCTGGTCATCACTGG - Intergenic
971586644 4:28412650-28412672 GAAAAAATGCTCCTCATCACTGG + Intergenic
971714096 4:30153465-30153487 GAACTCATGGTGCTTTTCTCTGG - Intergenic
971862606 4:32127198-32127220 GAAAAAATGCTCCTCATCACTGG - Intergenic
973137071 4:46722254-46722276 GAAAAAATGCTCCTCATCACTGG - Intergenic
973564057 4:52165962-52165984 GAACAAATGCTCATCATCACTGG - Intergenic
973568580 4:52213898-52213920 GAACAAATGCTCATCATCACTGG - Intergenic
973660138 4:53096465-53096487 GAACAAATGCTCATCATCACTGG - Intronic
973678806 4:53294391-53294413 GAAAAAATGCTCATTATCACTGG - Intronic
973682394 4:53333994-53334016 GAAAAAATGCTCATTATCACTGG + Intronic
973742767 4:53934401-53934423 GAACAAATGCTTATCATCACTGG + Intronic
973745131 4:53956652-53956674 AAACACTTCCTGCTTATCATGGG - Intronic
975203730 4:71621172-71621194 GAAAAAATGCTCCTCATCACTGG + Intergenic
975232633 4:71952946-71952968 GAAAAAATGCTGATCATCACTGG + Intergenic
975291648 4:72684673-72684695 GAAAAAATGCTCATTATCACTGG + Intergenic
976435980 4:85018707-85018729 TATCACATGCTGCATACCACAGG - Intergenic
976552124 4:86408648-86408670 GAAAAAATGCTCATTATCACTGG - Intronic
976848268 4:89514901-89514923 GAACAGATGACGCTCATCACTGG + Intergenic
976862060 4:89677333-89677355 GAAAAAATGCTCATTATCACTGG + Intergenic
976940876 4:90700736-90700758 GAACAAATGCTCATCATCACTGG - Intronic
976974430 4:91149229-91149251 GAACAAATGCTCATCATCACTGG - Intronic
976975401 4:91160643-91160665 GAAAACATGCTCATCATCACTGG - Intronic
976998716 4:91467745-91467767 GAAAACATGCTCATCATCACTGG + Intronic
977112109 4:92970875-92970897 TACTACATGTTGCTTATCACTGG + Intronic
977128771 4:93205905-93205927 GAACAAATGCTCATCATCACTGG - Intronic
977881019 4:102205675-102205697 GAAAACATGCTCATCATCACTGG - Intergenic
977882463 4:102220949-102220971 GAAAACATGCTCATCATCACTGG + Intergenic
977919036 4:102623937-102623959 GCACACATGATGCTTGGCACCGG + Intergenic
978024175 4:103851091-103851113 GAACAAAAGCTCATTATCACTGG + Intergenic
978418879 4:108508473-108508495 GAAAACATGCTCATCATCACTGG + Intergenic
979514516 4:121592004-121592026 GAAAAAATGCTCCTCATCACTGG + Intergenic
980385017 4:132077828-132077850 GAACACATGCTCCTTCTGAAAGG - Intergenic
980900654 4:138902084-138902106 GTACACATGCTGATGATAACTGG - Intergenic
981293906 4:143107954-143107976 GAAAAAATGCTTATTATCACTGG + Intergenic
981394970 4:144236514-144236536 GAAAAAATGCTCATTATCACTGG - Intergenic
981418966 4:144527157-144527179 GAAAACATGCTCATCATCACTGG + Intergenic
982204532 4:152987871-152987893 GAACTCTTTCTACTTATCACAGG + Intergenic
983083206 4:163413153-163413175 GAAAAAATGCTCATTATCACTGG - Intergenic
983108290 4:163717744-163717766 GAAAAAATGCTCATTATCACTGG - Intronic
986183567 5:5416627-5416649 GAACTCATGCTGCTTATATGTGG + Intergenic
987698166 5:21358868-21358890 GAAAACATGCTCATCATCACTGG + Intergenic
988232827 5:28502801-28502823 GAAAAAATGCTCATTATCACTGG - Intergenic
989748158 5:44857281-44857303 GAAAAAATGCTCCTTATCACTGG + Intergenic
989803954 5:45581285-45581307 GAACAAATGCTCATCATCACTGG - Intronic
989805504 5:45598807-45598829 GAACAAATGCTCATCATCACTGG + Intronic
989839632 5:46046615-46046637 GAAAAAATGCTCATTATCACTGG + Intergenic
989843176 5:46107026-46107048 GAAAAAATGCTCCTCATCACTGG - Intergenic
989846981 5:46157046-46157068 GAAAAAATGCTCATTATCACTGG - Intergenic
990929189 5:61067907-61067929 GAAAACATGCTTATCATCACTGG - Intronic
993298615 5:86178206-86178228 GAAAAAATGCTCATTATCACTGG + Intergenic
994235831 5:97361094-97361116 GAAAAAATGCTCATTATCACTGG + Intergenic
994508434 5:100672261-100672283 GAAAAAATGCTCATTATCACTGG + Intergenic
994602473 5:101924050-101924072 GAAAAAATGCTCATTATCACTGG + Intergenic
995178679 5:109209252-109209274 GAAAAAATGCTCCTCATCACTGG - Intergenic
995327475 5:110907480-110907502 GAAAAAATGCTCATTATCACTGG + Intergenic
996130428 5:119775191-119775213 GAAAACATGCTCATCATCACTGG - Intergenic
996157446 5:120119363-120119385 GAATAAATGCTGATCATCACTGG + Intergenic
996189565 5:120522419-120522441 GAAAAAATGCTGATCATCACTGG - Intronic
996257922 5:121427772-121427794 GAAAACATGCTCATCATCACTGG - Intergenic
996990583 5:129625590-129625612 GAAAAAATGCTCATTATCACTGG - Intronic
997808378 5:136942400-136942422 GAAAAAATGCTCCTCATCACTGG - Intergenic
997943268 5:138177646-138177668 GAACACAAGCTGCTAAGCACTGG - Exonic
998242210 5:140457097-140457119 GAAAAAATGCTCCTCATCACTGG + Intronic
998247434 5:140520172-140520194 GAAAAAATGCTCCTCATCACTGG + Intronic
998719957 5:144933638-144933660 GAAAAAATGCTCCTCATCACTGG + Intergenic
998912766 5:146978123-146978145 GAAAAAATGCTCATTATCACTGG - Intronic
999548187 5:152654712-152654734 GAACAAATGCTCATCATCACTGG - Intergenic
1000043656 5:157503862-157503884 AAACGCATGCTCTTTATCACAGG + Intronic
1000400216 5:160818393-160818415 GAAAAAATGCTCATTATCACTGG + Intronic
1000509364 5:162163390-162163412 CACAACATGCTGCTCATCACTGG + Intergenic
1003218883 6:4139009-4139031 AAACCCAAGCTGCTTAGCACTGG + Intergenic
1003663936 6:8091807-8091829 GAATAAATGCTGTTCATCACTGG - Intronic
1004103765 6:12643838-12643860 GAAAACATGCTCATCATCACTGG + Intergenic
1004517391 6:16332015-16332037 GAAAAGATGCTGTTTATCAATGG - Intronic
1004896965 6:20157598-20157620 GAACTCATAATGCTTATGACTGG + Intronic
1005240262 6:23817230-23817252 GAAAAAATGCTCCTCATCACTGG - Intergenic
1005291069 6:24379434-24379456 GAAAAAATGCTGATCATCACTGG + Intergenic
1005552682 6:26939505-26939527 GAACAAATGCTCATCATCACTGG - Intergenic
1005904773 6:30252611-30252633 GAAAACATGCTCATCATCACTGG + Intergenic
1006247691 6:32754625-32754647 GAACACATCCTGGTTATGAGAGG - Intergenic
1007296245 6:40823656-40823678 GAAAAAATGCTCATTATCACTGG + Intergenic
1007438371 6:41835120-41835142 GAACACAGCTTGCTTACCACTGG + Intronic
1008237030 6:49063031-49063053 GAAAAAATGCTCCTCATCACTGG + Intergenic
1008493901 6:52113528-52113550 GAAAAAATGCTCATTATCACTGG + Intergenic
1009042956 6:58203029-58203051 GAAAACATGCTCCTAACCACTGG - Intergenic
1009218792 6:60957272-60957294 GAAAACATGCTCCTAACCACTGG - Intergenic
1009243646 6:61207108-61207130 GAAAAAATGCTCATTATCACTGG - Intergenic
1009709147 6:67295333-67295355 GAAAAAATGCTCATTATCACTGG - Intergenic
1009947856 6:70360677-70360699 GAAAAAATGCTCATTATCACTGG + Intergenic
1009982743 6:70744920-70744942 GAAAAAATGCTCATTATCACTGG - Intronic
1009983735 6:70757763-70757785 GAAAAAATGCTCATTATCACTGG + Intronic
1010170632 6:72971239-72971261 GAAAAAATGCTCATTATCACTGG + Intronic
1010301223 6:74262486-74262508 GAAAACATGCTCATCATCACTGG + Intergenic
1010321261 6:74513136-74513158 GAAAAAATGCTCATTATCACTGG + Intergenic
1010468486 6:76197342-76197364 GAAAACATGCTCACTATCACTGG - Intergenic
1010730929 6:79390575-79390597 GAAAAAATGCTCATTATCACTGG + Intergenic
1010755202 6:79658889-79658911 GAAAAAATGCTCCTCATCACTGG - Intronic
1010838372 6:80617441-80617463 GAAAAAATGCTCCTCATCACTGG + Intergenic
1010892873 6:81335937-81335959 GAAAAAATGCTCATTATCACTGG - Intergenic
1010972654 6:82279149-82279171 GAAAAAATGCTCATTATCACTGG - Intergenic
1010992642 6:82497190-82497212 GAAAAAATGCTGATCATCACTGG - Intergenic
1011885084 6:92083677-92083699 GAAAAAATGCTCATTATCACTGG + Intergenic
1012544862 6:100406927-100406949 GAACACATCCATCTTATAACTGG + Intronic
1013302046 6:108812847-108812869 GAACAAATGCTCATCATCACTGG - Intergenic
1013968113 6:115980817-115980839 AAACACATTGTGCTTCTCACTGG - Intronic
1014128006 6:117799426-117799448 GAAAAAATGCTCATTATCACTGG - Intergenic
1014387916 6:120824111-120824133 GAAAAAATGCTCATTATCACTGG + Intergenic
1014427457 6:121326014-121326036 GAAAAAATGCTCATTATCACTGG + Intronic
1014837975 6:126182281-126182303 GAGGATATGCTGATTATCACAGG - Intergenic
1014870838 6:126594574-126594596 GAAAACATGCTCATCATCACTGG - Intergenic
1014892709 6:126862266-126862288 GAAAAAATGCTCCTCATCACTGG - Intergenic
1015108013 6:129559560-129559582 GAAAAAATGCTCATTATCACTGG + Intergenic
1015133497 6:129840817-129840839 GAACAAATGCTCATCATCACTGG + Intronic
1017411993 6:154177532-154177554 GAAAAAATGCTGATCATCACTGG + Intronic
1018672041 6:166187205-166187227 GAAAAAATGCTCATTATCACTGG + Intergenic
1019855491 7:3602425-3602447 GAAAAAATGCTCCTCATCACTGG - Intronic
1020497738 7:8877246-8877268 GAAAAAATGCTCATTATCACTGG - Intergenic
1021069758 7:16221689-16221711 GAAAAAATGCTCATTATCACTGG + Intronic
1021072327 7:16256184-16256206 GAAAACATGCTCATCATCACTGG + Intronic
1021358525 7:19684116-19684138 GAAAAAATGCTCATTATCACTGG - Intergenic
1021430666 7:20555353-20555375 GAAAAAATGCTCATTATCACTGG + Intergenic
1021824704 7:24538063-24538085 GAAAAAATGCTCATTATCACTGG + Intergenic
1024718953 7:52113214-52113236 AATCACATGCTGCTTAACAAAGG + Intergenic
1024856759 7:53791435-53791457 GAAAACATGCTCATCATCACTGG - Intergenic
1025139780 7:56452628-56452650 GAACAAATGCTCATCATCACTGG - Intergenic
1026038931 7:66849873-66849895 TAACACATGATGTTTTTCACTGG - Intergenic
1028080778 7:86572565-86572587 GAAAACATGCTCATCATCACTGG + Intergenic
1028117950 7:87022826-87022848 GAAAAAATGCTCATTATCACTGG - Intronic
1028692936 7:93674412-93674434 GAAAAAATGCTTATTATCACTGG + Intronic
1028698399 7:93745414-93745436 GAACAAATGCTCATCATCACTGG + Intronic
1029880269 7:103800974-103800996 GAAAAAATGCTCATTATCACTGG + Intronic
1030103553 7:105967702-105967724 GAAAAAATGCTCATTATCACTGG - Intronic
1031032108 7:116746173-116746195 GAAAAAATGCTCATTATCACTGG + Intronic
1031699517 7:124905881-124905903 GAAGAAATGCTCATTATCACTGG + Intronic
1035008307 7:155687227-155687249 GAAAAAATGCTCATTATCACTGG - Intronic
1035885452 8:3286574-3286596 GAAAAAATGCTCATTATCACCGG - Intronic
1036797265 8:11765318-11765340 GAAGACAAGCTGCTAATGACTGG + Intergenic
1037557181 8:20036075-20036097 GAAAACATGCTTATCATCACCGG - Intergenic
1037591768 8:20318419-20318441 GGACACATGATTCTTAACACAGG - Intergenic
1039177768 8:34828552-34828574 TAACACATCCTCCTTATAACTGG - Intergenic
1040451242 8:47549517-47549539 GAAAACATGCTCATCATCACTGG - Intronic
1040702169 8:50079306-50079328 GAAAAAAAGCTGATTATCACTGG - Intronic
1040961970 8:53043916-53043938 GAAAAAATGCTCATTATCACTGG - Intergenic
1041120543 8:54581753-54581775 GAAAAAATGCTCATTATCACTGG - Intergenic
1041130364 8:54692564-54692586 GAAAAAATGCTCATTATCACTGG - Intergenic
1041323800 8:56643131-56643153 GAACACATGAGGCTTATTACAGG - Intergenic
1041600065 8:59706413-59706435 GAAAACATGCTCCTCATCACTGG + Intergenic
1042777789 8:72453359-72453381 GTACACATGCAGGTTATTACAGG + Intergenic
1043275002 8:78381830-78381852 GAAAACATGCTCATCATCACTGG - Intergenic
1043333325 8:79143476-79143498 GAAAAAATGCTCCTCATCACTGG + Intergenic
1043339874 8:79224973-79224995 GAAAAAATGCTCGTTATCACCGG + Intergenic
1043827972 8:84952175-84952197 GAAAAAATGCTCGTTATCACCGG - Intergenic
1044060550 8:87630072-87630094 GAACAAATGCTCATCATCACTGG + Intergenic
1044454895 8:92382169-92382191 GAAAAAATGCTCATTATCACTGG - Intergenic
1044774948 8:95678184-95678206 GAACATATGGTGCTTTTCCCAGG - Intergenic
1045145296 8:99336756-99336778 GAAAAAATGCTGACTATCACTGG + Intronic
1045155072 8:99458666-99458688 GAAAACATGCTCATCATCACTGG - Intronic
1046153763 8:110261173-110261195 GAAAAAATGCTCCTCATCACTGG + Intergenic
1046173490 8:110544222-110544244 GAACACATGACTCTTAACACTGG - Intergenic
1046180332 8:110637178-110637200 GTAAACATACTGCTTTTCACTGG - Intergenic
1046200774 8:110925029-110925051 GAAAAAATGCTCCTCATCACTGG + Intergenic
1046383304 8:113477400-113477422 GAAAACATGCTCATCATCACTGG - Intergenic
1048021768 8:130546194-130546216 GCACACATGCTGCCTCTCAAAGG - Intergenic
1048149327 8:131878445-131878467 GAAAAAATGCTCATTATCACTGG - Intergenic
1048971824 8:139649466-139649488 GCACACATGCTGCCCCTCACTGG + Intronic
1050330024 9:4536436-4536458 GAAAAAATGCTGATCATCACTGG + Intronic
1050446000 9:5723304-5723326 GAAAAAATGCTCATTATCACTGG - Intronic
1050979345 9:11989545-11989567 GAAAACATGCTCATCATCACTGG - Intergenic
1051987741 9:23110470-23110492 GAAAAAATGCTCCTCATCACTGG + Intergenic
1054828457 9:69597263-69597285 GAAAACATGCTTATCATCACTGG - Intronic
1055318654 9:75059801-75059823 GAAAAAATGCTCATTATCACTGG + Intergenic
1055374238 9:75631891-75631913 GAAAACATGCTCATCATCACTGG + Intergenic
1055784191 9:79854699-79854721 GAAAAAATGCTGATCATCACTGG + Intergenic
1056347972 9:85718416-85718438 GAAAAAATGCTCGTTATCACTGG - Intronic
1057464350 9:95298628-95298650 GAACTCATGCTACTTCTCCCTGG - Intronic
1058122247 9:101152145-101152167 GAAAAAATGCTCATTATCACTGG - Intronic
1058880696 9:109283739-109283761 GTACAGATGCTCCTTATGACGGG + Intronic
1059832056 9:118107260-118107282 GAAAACATGCTGGATATCAAAGG + Intergenic
1060866046 9:126998410-126998432 GAAAAAATGCTCATTATCACTGG + Intronic
1185994176 X:4925783-4925805 TAACAGATGCTGCTTACCAGAGG - Intergenic
1187467016 X:19536859-19536881 GGACCCATGCTGCTTAACAAAGG - Intronic
1187594859 X:20759767-20759789 GAAAAAATGCTCATTATCACTGG + Intergenic
1187813677 X:23208186-23208208 GAACACCTCCTGGTTATTACAGG - Intergenic
1188037334 X:25333433-25333455 GAAAAAATGCTCATTATCACTGG + Intergenic
1188471491 X:30545189-30545211 GAAAACATGCTCATCATCACTGG - Intergenic
1188714386 X:33443248-33443270 GAAAACATGCTAATCATCACTGG + Intergenic
1188770109 X:34143316-34143338 GAAAACAAGCTCATTATCACTGG - Intergenic
1190357704 X:49620808-49620830 GAAAAAATGCTCATTATCACTGG - Intergenic
1190423032 X:50304898-50304920 GAAAAAATGCTCATTATCACTGG + Intronic
1190467416 X:50739575-50739597 GAAAACATGCTCATCATCACTGG + Intronic
1191061008 X:56296329-56296351 GAAAAAATGCTCCTCATCACTGG + Intergenic
1191173485 X:57474945-57474967 GAAAAAATGCTCCTTATCACTGG - Intronic
1191610630 X:63108298-63108320 GAAAAAATGCTCATTATCACTGG + Intergenic
1191649176 X:63518373-63518395 GAAAAAATGCTGGTCATCACTGG - Intergenic
1192065909 X:67884695-67884717 GAAAAAATGCTCATTATCACTGG - Intergenic
1192285660 X:69732847-69732869 GAAGAAATGCTCATTATCACTGG - Intronic
1192334985 X:70211150-70211172 GAAAAAATGCTGATCATCACTGG - Intergenic
1192394121 X:70761003-70761025 GAAAACATGCTCATCATCACTGG + Intronic
1192640580 X:72858499-72858521 GAAAACATGCTCATCATCACTGG + Intergenic
1192641131 X:72862277-72862299 GAAAACATGCTCATCATCACTGG - Intergenic
1192999435 X:76548609-76548631 GAAAAAATGCTCATTATCACTGG - Intergenic
1193059476 X:77189844-77189866 GAAAAAATGCTCCTCATCACTGG + Intergenic
1193159087 X:78207767-78207789 GAAAAAATGCTCATTATCACTGG + Intergenic
1193181791 X:78466971-78466993 GAAAAAATGCTCATTATCACTGG - Intergenic
1193627983 X:83843312-83843334 GAAAAAATGCTCATTATCACTGG + Intergenic
1193920008 X:87413498-87413520 GAAAAAATGCTCATTATCACTGG - Intergenic
1193973275 X:88084572-88084594 GAACAAATGCTCATCATCACTGG - Intergenic
1193973654 X:88090034-88090056 GAACAAATGCTCATCATCACTGG + Intergenic
1194009000 X:88535098-88535120 GAAAACATGCTCATCATCACTGG - Intergenic
1194208956 X:91045699-91045721 GAAAAAATGCTCCTCATCACTGG - Intergenic
1194508585 X:94764330-94764352 GAAAAAATGCTCATTATCACTGG - Intergenic
1195147963 X:102036820-102036842 GAAAAGATGCTCATTATCACTGG + Intergenic
1195440241 X:104890545-104890567 GAAAACATGCTCATCATCACTGG - Intronic
1195445420 X:104947163-104947185 GAAAACATGCTCATCATCACTGG - Intronic
1196511293 X:116515355-116515377 GAAAAAATGCTGATCATCACTGG - Intergenic
1196536533 X:116851714-116851736 GAAAAAATGCTGATCATCACTGG - Intergenic
1197021712 X:121697906-121697928 GAAAAAATGCTGATCATCACTGG + Intergenic
1198165966 X:134057385-134057407 GAAAACATGCTCATCATCACTGG - Intergenic
1198168860 X:134084836-134084858 GAAAACATGCTCATCATCACTGG + Intergenic
1198342438 X:135728144-135728166 GAAAAAATGCTCCTCATCACTGG + Intergenic
1198345552 X:135755151-135755173 GAAAAAATGCTCCTCATCACTGG - Intergenic
1198347744 X:135775565-135775587 GAAAACATGCTCATCATCACTGG + Intergenic
1198349649 X:135792827-135792849 GAAAACATGCTCATCATCACTGG + Intergenic
1198351553 X:135810102-135810124 GAAAACATGCTCATCATCACTGG + Intergenic
1198353463 X:135827365-135827387 GAAAACATGCTCATCATCACTGG + Intergenic
1198355369 X:135844620-135844642 GAAAACATGCTCATCATCACTGG + Intergenic
1198357279 X:135861905-135861927 GAAAACATGCTCATCATCACTGG + Intergenic
1198359193 X:135879185-135879207 GAAAACATGCTCATCATCACTGG + Intergenic
1198450796 X:136765751-136765773 GAAGTCATACAGCTTATCACTGG - Intronic
1199684066 X:150250471-150250493 GAAAAAATGCTGATCATCACTGG + Intergenic
1199788124 X:151124019-151124041 GAAAAAATGCTGGTCATCACTGG + Intergenic
1199968034 X:152836049-152836071 GAAAAAATGCTGATCATCACTGG - Intronic
1200290843 X:154871941-154871963 GAAAAAATGCTGATCATCACTGG + Intronic
1200382387 X:155852390-155852412 GAAAAAATGCTGATCATCACTGG - Intergenic
1200825032 Y:7628528-7628550 GAAAAAATGCTCATTATCACTGG - Intergenic
1200883374 Y:8243928-8243950 GAAAACATGCTCATCATCACTGG + Intergenic
1201435781 Y:13957205-13957227 GAAAAAATGCTGATCATCACTGG + Intergenic
1201598595 Y:15701079-15701101 GAAAAAATGCTCATTATCACTGG + Intergenic
1201626381 Y:16019178-16019200 GAAAAAATGCTCCTCATCACTGG - Intergenic
1201681826 Y:16654507-16654529 TAACAGATGCTGCTTACCAGAGG + Intergenic
1202235023 Y:22702559-22702581 GAAAAAATGCTCATTATCACTGG + Intergenic
1202308136 Y:23493609-23493631 GAAAAAATGCTCATTATCACTGG - Intergenic
1202562665 Y:26176977-26176999 GAAAAAATGCTCATTATCACTGG + Intergenic