ID: 1153314301

View in Genome Browser
Species Human (GRCh38)
Location 18:3706925-3706947
Sequence CCGCCCATTCCCAAACTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153314301_1153314304 -4 Left 1153314301 18:3706925-3706947 CCACTGAGTTTGGGAATGGGCGG 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1153314304 18:3706944-3706966 GCGGAAAAGGAATTTTAATATGG 0: 1
1: 0
2: 0
3: 16
4: 204
1153314301_1153314305 26 Left 1153314301 18:3706925-3706947 CCACTGAGTTTGGGAATGGGCGG 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1153314305 18:3706974-3706996 GAGAAGAACTGAGTTCAGCAAGG 0: 1
1: 0
2: 4
3: 31
4: 341
1153314301_1153314306 27 Left 1153314301 18:3706925-3706947 CCACTGAGTTTGGGAATGGGCGG 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1153314306 18:3706975-3706997 AGAAGAACTGAGTTCAGCAAGGG 0: 1
1: 0
2: 3
3: 24
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153314301 Original CRISPR CCGCCCATTCCCAAACTCAG TGG (reversed) Intronic
900946680 1:5834756-5834778 CCACCCATTCTCAAACTCCCTGG + Intergenic
906817045 1:48889869-48889891 CGTCCCAGTCCCAAACTCGGAGG - Intronic
912559628 1:110540757-110540779 CAGACCACCCCCAAACTCAGTGG - Intergenic
913196780 1:116463485-116463507 CCGCACATTCTCTAAATCAGAGG - Intergenic
914450241 1:147785207-147785229 TAGCACAGTCCCAAACTCAGTGG - Intergenic
914937783 1:151995054-151995076 GAGCCCAATCCCAAACTCTGGGG + Intergenic
918412992 1:184279995-184280017 CCACCCATTCCCAAACTTAGGGG - Intergenic
919373555 1:196763293-196763315 CCTCCCCTTTCCAAAGTCAGAGG + Intergenic
919379995 1:196847970-196847992 CCTCCCCTTTCCAAAGTCAGAGG + Intronic
919522513 1:198606101-198606123 ACCCCCATTCCCAACCCCAGAGG - Intergenic
920087754 1:203430196-203430218 CCACCGAATCCCAAATTCAGTGG - Intergenic
920364175 1:205439445-205439467 CAGCTCATGCCCACACTCAGGGG - Intronic
922423573 1:225475040-225475062 CCCTCCAATCCCAAACTGAGAGG + Intergenic
923868524 1:237965576-237965598 CAGTCCATTCCAAAACTTAGTGG + Intergenic
1063241806 10:4177425-4177447 CCGCCCTGTCCCAGACTAAGTGG - Intergenic
1063437203 10:6044020-6044042 CCCCCTCTCCCCAAACTCAGTGG + Intronic
1066207037 10:33199585-33199607 CCACTGTTTCCCAAACTCAGTGG - Intronic
1066415062 10:35214141-35214163 GCCCCCCTTCCCAAACCCAGTGG + Intergenic
1069016790 10:63438691-63438713 AGGCTCATTCCCAATCTCAGGGG + Intronic
1070652447 10:78247494-78247516 CCGCCCTTTCCTAAAGTCACAGG - Intergenic
1072552074 10:96486827-96486849 CAGCCCCTTCCCAAAGTCACAGG + Intronic
1072862751 10:99023255-99023277 CCTCCCATTTCCAAAGACAGAGG - Intronic
1073135980 10:101220653-101220675 CCAACCCTTCCCAAATTCAGGGG - Intergenic
1074113023 10:110436192-110436214 ACTCCCATCCCCAAACCCAGTGG - Intergenic
1075308744 10:121392752-121392774 CACCCTTTTCCCAAACTCAGCGG - Intergenic
1075783765 10:125034091-125034113 CCGCCCATCACCAAACTGACCGG + Intronic
1077456612 11:2685236-2685258 CCTCCCATTACCAAACTCCAGGG + Intronic
1088610168 11:111569059-111569081 ACGCCCAGCCCGAAACTCAGTGG - Intergenic
1088896097 11:114079561-114079583 CCAAACATTCCCAAACTCTGTGG - Intronic
1090487446 11:127126769-127126791 CCACCCATTCCCAAACAGTGTGG + Intergenic
1090918837 11:131190726-131190748 CAGCCCACTCCCACCCTCAGTGG - Intergenic
1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG + Exonic
1093760558 12:22904433-22904455 CTGGCCCTGCCCAAACTCAGTGG + Intergenic
1098445310 12:70560532-70560554 CAGTCCCTTCCCAAATTCAGGGG + Intronic
1101334502 12:103784491-103784513 CTGCCCATTTCCAAAGCCAGAGG + Intronic
1101816248 12:108148258-108148280 CCACCCCTTCCCCACCTCAGGGG - Intronic
1103321329 12:120094195-120094217 CCACCCAGGCCCCAACTCAGAGG + Exonic
1106635380 13:31523563-31523585 CCCCCCATTTCTAAACTCAGTGG - Intergenic
1113304685 13:109064903-109064925 TGGACCATCCCCAAACTCAGTGG + Intronic
1115449675 14:33532098-33532120 AGGCCCATTCAGAAACTCAGTGG + Intronic
1116088349 14:40271015-40271037 CCTCCCCTTCCCAAACTGTGGGG - Intergenic
1118226731 14:63907704-63907726 CCACCCCTTCCCATACTCTGGGG - Intronic
1120763000 14:88302936-88302958 CGTCCCATTCACAGACTCAGGGG + Intronic
1127807507 15:62534658-62534680 AGGCCCACTCCCAACCTCAGAGG - Intronic
1127889257 15:63234301-63234323 TCACCCATTCACAAACGCAGGGG + Intronic
1128760405 15:70212813-70212835 CTGCCCATCCTCAACCTCAGTGG - Intergenic
1129319748 15:74767920-74767942 CAGCCCCTTCTCAAACTCATCGG - Intergenic
1130117911 15:81021604-81021626 TCTCCCATTTCCCAACTCAGGGG - Intronic
1131539349 15:93263152-93263174 CCACGCATTTCTAAACTCAGTGG + Intergenic
1135157463 16:20065119-20065141 CTGCCAATTCACAAACTCAGGGG - Intronic
1137619713 16:49868319-49868341 CCGCCCATTCCCACCCCAAGAGG + Intergenic
1140693565 16:77508850-77508872 GCCCCCATTCCCAAACCCAGGGG + Intergenic
1141610230 16:85177042-85177064 CAGGCCCTTCTCAAACTCAGAGG + Intronic
1142996119 17:3761591-3761613 ACCCCCATTCCAGAACTCAGTGG + Intronic
1148042741 17:44721806-44721828 CCTCCAATCCCTAAACTCAGCGG - Intronic
1151487772 17:74412275-74412297 CGGGCCATTCGCAAACTCATGGG + Intergenic
1152463332 17:80452501-80452523 CCACCCAGTTCCAAAGTCAGGGG - Intergenic
1153314301 18:3706925-3706947 CCGCCCATTCCCAAACTCAGTGG - Intronic
1160188422 18:76694572-76694594 CCCCCTATACCCAAACTCTGAGG + Intergenic
1162317532 19:9948989-9949011 ACAGCCATTCCCACACTCAGAGG + Intergenic
925245400 2:2378010-2378032 CTGCCCATTCTTTAACTCAGAGG + Intergenic
926296042 2:11569476-11569498 CCTCCCATTCCCATCCTCACTGG - Intronic
930492446 2:52092939-52092961 CCTCCCATTTCCAAAAGCAGAGG + Intergenic
931666911 2:64616225-64616247 GGGCCCATTTCCTAACTCAGAGG + Intergenic
931989859 2:67779194-67779216 CCTCCCTTTTCCAAAGTCAGAGG - Intergenic
933162915 2:79045430-79045452 CCTCCCATTTCCAAAAACAGAGG - Intergenic
933374035 2:81456051-81456073 CCCCCCATCCCCAAAATCAGAGG + Intergenic
935458457 2:103298722-103298744 CCACCCATGCCAAATCTCAGGGG - Intergenic
936271157 2:111050171-111050193 CCACCCATTTCTAAAGTCAGAGG - Intronic
937980032 2:127609355-127609377 CCACCCATCCCCACATTCAGTGG - Intronic
938708515 2:133955114-133955136 CTTCCCACTCACAAACTCAGTGG - Intergenic
939073165 2:137568098-137568120 CTCCCCATTGCCAAACTCAATGG - Intronic
946173105 2:217906997-217907019 CAGCCCATTTCCAAACACACAGG + Intronic
946354492 2:219176582-219176604 ACGCCCATTCCTATACTCCGCGG + Intronic
1170579438 20:17686801-17686823 CAAACCACTCCCAAACTCAGTGG + Intergenic
1172903959 20:38355301-38355323 CCGGCCATCCCCAAGTTCAGTGG + Intronic
1174124039 20:48289603-48289625 CTCCCCATTCCCAAGGTCAGTGG - Intergenic
1174391665 20:50221669-50221691 GTGCCCATTGCAAAACTCAGCGG + Intergenic
1175258010 20:57658457-57658479 CAGCCACTTCCCAAACGCAGGGG + Intronic
1177238371 21:18423242-18423264 CTGCCCACTCCCAAATGCAGAGG + Intronic
1177456372 21:21344535-21344557 CCTCCCATTTCCAAAGGCAGAGG - Intronic
1178627655 21:34231767-34231789 CAGCCCATGCCCTAAATCAGTGG + Intergenic
1181032004 22:20152800-20152822 CAGCACACTCCAAAACTCAGTGG - Intergenic
1183326323 22:37196670-37196692 CCGCCCATGCCCAAGCCCCGAGG - Intronic
949903357 3:8838162-8838184 CAGACCACTCCCAAACTCAGTGG - Intronic
953925152 3:46979062-46979084 CCCCCCATTCCCCAACTCCAGGG - Intronic
954109928 3:48428314-48428336 CTGCCCATTCCCAATATCTGAGG + Intronic
956485847 3:69721352-69721374 CAGCCCATCCCCAACCTCTGGGG + Intergenic
960124119 3:113979294-113979316 CTACCCACTCCAAAACTCAGGGG - Intronic
962344902 3:134611653-134611675 CTGCTCAGTCCCCAACTCAGTGG + Intronic
965748899 3:171956532-171956554 CCGCCCAAACCCAGATTCAGTGG + Intergenic
969988182 4:11233312-11233334 AAAGCCATTCCCAAACTCAGAGG - Intergenic
972001836 4:34046795-34046817 CAAACCATTCCCAATCTCAGTGG + Intergenic
973757544 4:54090755-54090777 AAACCCAATCCCAAACTCAGTGG + Intronic
976789219 4:88858977-88858999 CAGCACATTGCCAAATTCAGTGG - Intronic
980960502 4:139470287-139470309 CCTCCCATTTCCAAAGACAGAGG + Intronic
982449779 4:155540086-155540108 ATGCCCATTCCCAAACCCTGTGG + Intergenic
986091055 5:4507225-4507247 TGGGCCATTCCCACACTCAGGGG - Intergenic
986492778 5:8308832-8308854 CTTCCCATTTCCAAAGTCAGAGG - Intergenic
991663687 5:68974841-68974863 CCTCCCCTTTCCAAAGTCAGAGG - Intergenic
992316298 5:75559325-75559347 CCACCCTTTCCCAATCTCAGTGG + Intronic
998092698 5:139380476-139380498 CCTCAAATCCCCAAACTCAGCGG + Intronic
1008144941 6:47879757-47879779 CAGCCCATTCACAAACATAGAGG - Exonic
1009039296 6:58158059-58158081 CCTCCCTTTCCCAAAAGCAGAGG + Intergenic
1009215195 6:60912902-60912924 CCTCCCTTTCCCAAAAGCAGAGG + Intergenic
1009687750 6:66986230-66986252 CCTCCCCTTCCCAAAGGCAGAGG + Intergenic
1009823840 6:68840579-68840601 CCTCCCATTTCCAAAAGCAGAGG - Intronic
1012714332 6:102649278-102649300 CCTCCCCTTTCCAAAGTCAGAGG - Intergenic
1015100322 6:129470673-129470695 CTGCCTATACCCAAACTCAGTGG - Intronic
1018711245 6:166499368-166499390 TGGCCCATTCCCAGGCTCAGGGG - Intronic
1021589922 7:22249760-22249782 CAGCTCATTCCCTAACTCTGCGG + Intronic
1022109432 7:27219501-27219523 CCCCCCTTCCCCCAACTCAGAGG - Intergenic
1022553135 7:31261418-31261440 CCAACCACTCCAAAACTCAGGGG + Intergenic
1023987758 7:45107101-45107123 CTGCCCACTCCCAAATGCAGAGG + Intronic
1024170338 7:46778405-46778427 CCTCCCATTTCCAAAGGCAGAGG - Intergenic
1025029830 7:55548039-55548061 CCTCCCATTCCCAGAATCTGCGG - Intronic
1036389403 8:8311497-8311519 CTGTCAATTCCCTAACTCAGGGG + Intergenic
1038117478 8:24573623-24573645 CAAGCCATTCCCAAACTCACTGG - Intergenic
1039824219 8:41159213-41159235 CCACCCATACACAGACTCAGTGG + Intergenic
1045247110 8:100452194-100452216 CAGCCCATTCTGAAACTCTGTGG - Intergenic
1045777396 8:105821851-105821873 CCTCCCCTTTCCAAATTCAGAGG + Intergenic
1049616097 8:143576371-143576393 CTGCCCATTCCCAAACCCCGGGG + Intronic
1050485767 9:6133132-6133154 CAAACCATTCCCAAACTCAGTGG - Intergenic
1053411068 9:37916479-37916501 CTGCCCATTCCCAGAACCAGCGG - Intronic
1055666255 9:78555954-78555976 CAGCCCATTCACAATCGCAGGGG - Intergenic
1056242954 9:84668169-84668191 CTTCCCATCCCCAAACTCTGCGG + Intergenic
1058284975 9:103166413-103166435 CCTCCCATTTCCAAAGGCAGAGG + Intergenic
1060896103 9:127218628-127218650 CTGCTCATTCCCAGACTCACGGG + Intronic
1188560416 X:31462016-31462038 CCTCCCAATTCCATACTCAGTGG + Intronic
1189242680 X:39537640-39537662 GGGCCCATTCCCAACATCAGGGG - Intergenic
1192855915 X:75011729-75011751 CCTCCCATTTCCAAAGGCAGAGG + Intergenic
1193172984 X:78358137-78358159 CCTCCCATTTCCAAAGGCAGAGG + Intergenic
1193260833 X:79404410-79404432 CCTCCCCTTTCCAAAGTCAGAGG - Intergenic
1196984487 X:121253538-121253560 CCGCCCCTTTCCAAAGGCAGAGG + Intergenic
1197449492 X:126594288-126594310 CCTCCCCTTCCCAAAGGCAGAGG + Intergenic
1199443003 X:147889811-147889833 CCTCCCCTTTCCAAAGTCAGAGG + Intergenic