ID: 1153316444

View in Genome Browser
Species Human (GRCh38)
Location 18:3727262-3727284
Sequence GGGCAGACCCCATGTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153316439_1153316444 7 Left 1153316439 18:3727232-3727254 CCTCCAGAGTATCTGAGAAGTGT 0: 1
1: 0
2: 0
3: 16
4: 195
Right 1153316444 18:3727262-3727284 GGGCAGACCCCATGTGTGTTTGG 0: 1
1: 0
2: 2
3: 15
4: 126
1153316440_1153316444 4 Left 1153316440 18:3727235-3727257 CCAGAGTATCTGAGAAGTGTCTT 0: 1
1: 0
2: 0
3: 16
4: 194
Right 1153316444 18:3727262-3727284 GGGCAGACCCCATGTGTGTTTGG 0: 1
1: 0
2: 2
3: 15
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153316444 Original CRISPR GGGCAGACCCCATGTGTGTT TGG Intronic
900212508 1:1463046-1463068 GGACAGGCCCCTTGTGAGTTTGG + Intronic
900217823 1:1491019-1491041 GGACAGGCCCCGTGTGAGTTGGG + Intronic
900225188 1:1529679-1529701 GGACAGGCCCCATGTGAGTTGGG + Intronic
900400036 1:2469272-2469294 CTGCAGACCCCAAGTGTGCTGGG - Intronic
900944173 1:5820367-5820389 GCGATGACCCCATGTGAGTTCGG - Intergenic
900962954 1:5937262-5937284 TGGCAAACCCCAGGTGTGGTAGG - Intronic
901192795 1:7422478-7422500 GGCCAGACCCCCTCTGTGCTGGG + Intronic
901441445 1:9280739-9280761 GCCCAGCACCCATGTGTGTTTGG - Intergenic
902712174 1:18247959-18247981 GGGCAGACTGCGTGTGTGTGGGG - Intronic
903071193 1:20727680-20727702 TGGCAGAGCAGATGTGTGTTTGG - Intronic
904245021 1:29181590-29181612 GGACAGACCCCATAGGTGGTGGG - Intronic
905013561 1:34762464-34762486 GGGCACACACTGTGTGTGTTGGG - Exonic
905277431 1:36827568-36827590 GGGCAGAAGTCATGTCTGTTTGG - Intronic
906566723 1:46806184-46806206 GGGCAGGCACCCTGTGTGCTGGG + Intronic
907421179 1:54348425-54348447 AGGCAGACCTCAGGTGTGTGAGG - Intronic
909864053 1:80644178-80644200 AGGCATACACCACGTGTGTTAGG + Intergenic
910504332 1:87932526-87932548 GGGCAGAGCTCATGTGAGTAAGG + Intergenic
911552348 1:99298462-99298484 GGGGAGCCCACGTGTGTGTTTGG - Intronic
915973728 1:160371422-160371444 GGGCAGACTCCAAGTGTGGCTGG - Exonic
916176028 1:162039427-162039449 GAGCAGAACCCCTGTGTGGTGGG + Intergenic
916265903 1:162889680-162889702 GGGAAGACCCCTTATGTCTTGGG + Intergenic
1068853254 10:61769166-61769188 GGGCAGATACCATGTCTATTTGG - Intergenic
1071111839 10:82167626-82167648 TGGCTGAGCCCATGTGTGCTAGG - Intronic
1071778058 10:88811135-88811157 AGGGAGACTGCATGTGTGTTTGG + Intronic
1072449757 10:95530674-95530696 GGGTGGACCACAGGTGTGTTGGG - Intronic
1075085892 10:119414061-119414083 GGGCAGCCCCCTTGTGTGGAAGG + Intronic
1076163093 10:128261128-128261150 CTGTAGACCCCATGTTTGTTAGG + Intergenic
1079010899 11:16827440-16827462 CTCCAGAGCCCATGTGTGTTAGG + Intronic
1081868282 11:46371631-46371653 TGGCAGACCCCAAGTGCGTACGG - Intronic
1084375926 11:68777531-68777553 GGTCAGTCCCCATCTGTGTATGG + Intronic
1088672010 11:112150967-112150989 GGGCTGATCCCATTTGTGCTCGG + Intronic
1090033752 11:123230378-123230400 GGGAATACACCAGGTGTGTTGGG - Intergenic
1097247656 12:57615407-57615429 GGGCTGACCCCATGGTTGGTTGG + Intronic
1100454698 12:94741120-94741142 GGGCAAAGCCCATGTGCCTTGGG - Intergenic
1100543318 12:95578535-95578557 GGGCAAAACCCAGGTCTGTTTGG + Intergenic
1100545953 12:95602600-95602622 AGGCAGACTCCATGTGGCTTAGG - Intergenic
1103040098 12:117687892-117687914 GGGCAGGACCCAGGTGTCTTTGG - Intronic
1103988129 12:124780718-124780740 GGGGAGACCCCAGTTTTGTTTGG + Intronic
1104246494 12:127047423-127047445 TGGCAGTTGCCATGTGTGTTTGG + Intergenic
1111762620 13:92484669-92484691 GGACAGACAACATGTGAGTTTGG + Intronic
1113922369 13:113920266-113920288 TGCCAGGCCCCATGTGTGCTGGG + Intergenic
1120163539 14:81170319-81170341 GGTCAGACCCCTGCTGTGTTGGG - Intergenic
1121589682 14:95094037-95094059 GGGCAGACCGCAGGTCTGTCAGG + Exonic
1123714201 15:23014424-23014446 GGGCAGACCACAGGGCTGTTTGG - Intronic
1124611991 15:31215486-31215508 GGGCAGACCGCATGAGCGTAGGG + Intergenic
1126975685 15:54176992-54177014 TGGCAGACCGCATATGTGATTGG + Intronic
1128314181 15:66649929-66649951 GGGCAGAGCCCAGGTGTGGCTGG - Intronic
1128875469 15:71197853-71197875 GTGCTGGCCCTATGTGTGTTTGG + Intronic
1129873333 15:78955868-78955890 GGGCAGACCCAAGTTCTGTTTGG - Intergenic
1132623210 16:878024-878046 AGCCAGACCCCATGTGTGTTTGG - Intronic
1133673924 16:8051724-8051746 GTGAAGACCCCATGTTTCTTGGG + Intergenic
1135625658 16:23992762-23992784 GAGCAGACACCCTGTGTGGTGGG - Intronic
1136548857 16:30971083-30971105 GTGCAGTCCCCATGTCTGTGTGG + Intronic
1138399096 16:56730829-56730851 GGGCCGACCCCATGGGTCCTTGG + Intronic
1141439980 16:84024024-84024046 TGGCAGCCGCCCTGTGTGTTTGG + Intronic
1142210536 16:88806417-88806439 GGGCAGACTGCATGTGAGGTAGG - Intronic
1142772309 17:2107308-2107330 TGACAGTCCCCATTTGTGTTTGG - Intronic
1143253416 17:5538650-5538672 GGGCAGGGCCCATGTCTGTTTGG + Intronic
1143382058 17:6502716-6502738 GAGAGGACTCCATGTGTGTTTGG - Intronic
1146829695 17:36057848-36057870 GAGCAGCCCCCATGGGTGTAAGG - Intergenic
1147995214 17:44356395-44356417 GGGGAGACCCCATCCGTGCTGGG + Intronic
1153316444 18:3727262-3727284 GGGCAGACCCCATGTGTGTTTGG + Intronic
1153530910 18:6044745-6044767 GGGCAGACCTCTTCTGTGCTAGG - Intronic
1153761703 18:8337999-8338021 GGGGAGGCCCCATGTGGGTTTGG + Intronic
1154162906 18:11993429-11993451 GCGCAGCCCCCATGTGTGCAAGG + Intronic
1156741038 18:40328079-40328101 GGGCAAAGCCCATGTGTGCTTGG + Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1158572625 18:58609839-58609861 GAGCAGAGCCCTCGTGTGTTTGG - Intronic
1159914999 18:74180780-74180802 GGACAGGCCCCAGGAGTGTTTGG + Intergenic
1160392879 18:78548136-78548158 GGAGAAACCCAATGTGTGTTTGG - Intergenic
1161566309 19:5004757-5004779 GGGCAGTACCCCTGGGTGTTGGG + Intronic
1161774222 19:6249657-6249679 GGGCAGACTGGATGTGTGATGGG - Intronic
1161827003 19:6574635-6574657 GGGAAGATGCTATGTGTGTTAGG - Intergenic
1163392006 19:17036769-17036791 GGACAGACCCCAGGTGAGGTGGG - Intergenic
1165399529 19:35589101-35589123 GGGCAGATCTCATGTGTTTGTGG + Intergenic
1168700272 19:58434561-58434583 GGAAATACCCCATGTGTGTAAGG - Exonic
925775589 2:7332380-7332402 TGGCAGATCCCATGTCTGGTGGG + Intergenic
929899329 2:45987580-45987602 GGGGGGAGGCCATGTGTGTTGGG - Intronic
936061970 2:109300747-109300769 GAGCAGACTTCATGTGGGTTGGG + Intronic
939507677 2:143069532-143069554 AGGCAAACTCCATGTGTTTTAGG + Intergenic
939798611 2:146679086-146679108 GGGCAGGCCACATGTGGTTTTGG + Intergenic
945040142 2:205737185-205737207 GGGCACTCCCCATGTGTTCTGGG + Intronic
1175924105 20:62463455-62463477 TGGGAGACCCCATGGGTGATGGG + Intergenic
1177062762 21:16395158-16395180 GAGAAGATCCTATGTGTGTTAGG + Intergenic
1177752925 21:25308454-25308476 GAGTAGACTCCATGTGTATTTGG - Intergenic
1179040929 21:37801669-37801691 AGGCTGAGCCTATGTGTGTTGGG + Intronic
1181028776 22:20140218-20140240 GTGCAGACCCCATGGGGGATGGG + Intronic
1182459708 22:30475111-30475133 GGTAAGGTCCCATGTGTGTTTGG + Intergenic
1182524497 22:30906955-30906977 GGGCAGCCCCCTTCTGTTTTGGG - Exonic
1183325435 22:37188778-37188800 GGGCTTAACCCATGTTTGTTGGG + Intronic
955351650 3:58197880-58197902 GGACTGACCCCAGGTTTGTTTGG - Exonic
955794092 3:62617698-62617720 GAACTGACACCATGTGTGTTAGG - Intronic
955969135 3:64419630-64419652 GGGCAGAGCCCATGTCTGTTTGG - Intronic
961448150 3:126990737-126990759 AGGCAGGGCCCATGTGTGCTTGG + Intronic
961677320 3:128575741-128575763 GTGCAGACCCCGTGCGTGGTAGG + Intronic
962314756 3:134352412-134352434 GGGCACATTCCAGGTGTGTTGGG - Intergenic
962750271 3:138429866-138429888 GGTCAGACACAATGTGTGTAAGG - Intergenic
962947021 3:140181101-140181123 TGGCAGAGCCTATGTGAGTTTGG - Intronic
968127406 3:196169939-196169961 GGGCAGACCCTGTGGGAGTTGGG + Intergenic
968609170 4:1549336-1549358 GGACAGCCCCCAGGTGTGGTCGG + Intergenic
968803454 4:2757409-2757431 GGAAAGACCCCATGTGTGCTTGG - Intergenic
970721838 4:18997355-18997377 TGGCAGCTTCCATGTGTGTTGGG - Intergenic
973189256 4:47368307-47368329 GGCCTGAGCCCATGGGTGTTGGG - Intronic
973733847 4:53850630-53850652 GAGAAGAGCACATGTGTGTTGGG + Intronic
974010777 4:56605314-56605336 GAGCAGAACCCATATCTGTTTGG - Intergenic
983209580 4:164945152-164945174 AGTCAGACCCCATCTGAGTTAGG - Intergenic
984943750 4:184955313-184955335 GGACAGAGCACATGTGTGTGTGG + Intergenic
990777009 5:59314267-59314289 GGGCACATCCCCTGTATGTTGGG - Intronic
999890957 5:155978166-155978188 TGGCATAGCCCATGTGTATTTGG + Intronic
1001600071 5:172922954-172922976 GGTCAGGCGCCAGGTGTGTTTGG + Intronic
1005618057 6:27594166-27594188 TGGCAGAGCCCAGGTGAGTTAGG + Intergenic
1006497783 6:34436357-34436379 GAGAAGCCCCCATATGTGTTGGG - Intergenic
1007818177 6:44539593-44539615 GGGCAGAGCCTGTGTATGTTTGG + Intergenic
1019434987 7:1017906-1017928 AGGAACACCCCATGTTTGTTCGG + Intronic
1022627233 7:32050212-32050234 GTGTAGACCTCATGTATGTTAGG - Intronic
1023866030 7:44238861-44238883 GGGCAGACCCCATGAGGGCTAGG - Intronic
1026603240 7:71794080-71794102 TGGCAGATACCATGTGTGATGGG + Intronic
1030193799 7:106833919-106833941 GGGAAGATGCCATGTATGTTAGG - Intergenic
1032877630 7:136054551-136054573 GAACAGATACCATGTGTGTTGGG - Intergenic
1036079714 8:5541990-5542012 GGGCAGACACCAGGGGTGCTCGG + Intergenic
1036692637 8:10953550-10953572 GGCAAGACCCCGTCTGTGTTAGG - Intronic
1038769477 8:30463788-30463810 CAGCAGACTCCATGTGTTTTTGG + Intronic
1042200850 8:66278464-66278486 TGGCAGATTCCATGTGTGTCTGG + Intergenic
1044607007 8:94056671-94056693 GGGCAGAAACCAGTTGTGTTGGG - Intergenic
1047250404 8:123177997-123178019 GGGCACGTCCCATGTGTGTGCGG - Intergenic
1048579717 8:135720780-135720802 GAGCAAACCCCAGGTGTGCTGGG + Intergenic
1049256183 8:141615169-141615191 CGGGAGACCCCGTGGGTGTTGGG - Intergenic
1052371389 9:27669159-27669181 GGGCAGTTCCCATTTGTGTGTGG + Intergenic
1053576455 9:39360191-39360213 GGGTAGACCCCACCTGTGTTTGG - Exonic
1053840965 9:42188116-42188138 GGGTAGACCCCACCTGTGTTTGG - Exonic
1054098025 9:60918882-60918904 GGGTAGACCCCACCTGTGTTTGG - Intergenic
1054119426 9:61194512-61194534 GGGTAGACCCCACCTGTGTTTGG - Exonic
1054588328 9:66988050-66988072 GGGTAGACCCCACCTGTGTTTGG + Intergenic
1055986359 9:82059244-82059266 GGGTAGACCCCACCTGTGTTTGG + Intergenic
1056584981 9:87921889-87921911 GGGTAGACCCCACCTGTGTTTGG - Intergenic
1056611899 9:88131051-88131073 GGGTAGACCCCACCTGTGTTTGG + Intergenic
1057160811 9:92886945-92886967 GGGTGGACCCCACCTGTGTTTGG - Intergenic
1057599167 9:96442205-96442227 GCGCAGGCCCCATGTGTTCTGGG - Intergenic
1062267175 9:135692516-135692538 GGGCAGACCCCAGGGGGCTTTGG - Intergenic
1186066914 X:5776223-5776245 GGGTATACCCCTTGTATGTTGGG - Intergenic
1187269532 X:17767243-17767265 GGACAGACCACATGTGGGTATGG - Intergenic
1195355878 X:104039766-104039788 GGGCAGACGCCCTCTGTGATTGG + Intergenic
1198841883 X:140865732-140865754 TGGCACACCCCATGAGTGTTGGG + Intergenic
1200216825 X:154371739-154371761 GGGCAGAGCCCAAGTGACTTAGG - Intronic