ID: 1153320377

View in Genome Browser
Species Human (GRCh38)
Location 18:3767875-3767897
Sequence TTGAATAAGCATGATAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2082
Summary {0: 1, 1: 0, 2: 15, 3: 209, 4: 1857}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153320377_1153320381 19 Left 1153320377 18:3767875-3767897 CCACTCTTATCATGCTTATTCAA 0: 1
1: 0
2: 15
3: 209
4: 1857
Right 1153320381 18:3767917-3767939 TAGTATGGCAAGGAAATAAAAGG 0: 1
1: 0
2: 2
3: 49
4: 496
1153320377_1153320379 4 Left 1153320377 18:3767875-3767897 CCACTCTTATCATGCTTATTCAA 0: 1
1: 0
2: 15
3: 209
4: 1857
Right 1153320379 18:3767902-3767924 TCTGGAAATTCTAGCTAGTATGG 0: 1
1: 0
2: 1
3: 8
4: 167
1153320377_1153320380 9 Left 1153320377 18:3767875-3767897 CCACTCTTATCATGCTTATTCAA 0: 1
1: 0
2: 15
3: 209
4: 1857
Right 1153320380 18:3767907-3767929 AAATTCTAGCTAGTATGGCAAGG 0: 1
1: 0
2: 2
3: 14
4: 100
1153320377_1153320382 30 Left 1153320377 18:3767875-3767897 CCACTCTTATCATGCTTATTCAA 0: 1
1: 0
2: 15
3: 209
4: 1857
Right 1153320382 18:3767928-3767950 GGAAATAAAAGGCATAGAGTTGG 0: 1
1: 1
2: 5
3: 76
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153320377 Original CRISPR TTGAATAAGCATGATAAGAG TGG (reversed) Intronic
Too many off-targets to display for this crispr