ID: 1153324223

View in Genome Browser
Species Human (GRCh38)
Location 18:3801579-3801601
Sequence ATTATTAACTAGGTTATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 416}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153324223_1153324226 25 Left 1153324223 18:3801579-3801601 CCTTGTATAACCTAGTTAATAAT 0: 1
1: 0
2: 0
3: 27
4: 416
Right 1153324226 18:3801627-3801649 GTTATTATGTGAATTGTGTCTGG 0: 1
1: 0
2: 3
3: 11
4: 172
1153324223_1153324225 -6 Left 1153324223 18:3801579-3801601 CCTTGTATAACCTAGTTAATAAT 0: 1
1: 0
2: 0
3: 27
4: 416
Right 1153324225 18:3801596-3801618 AATAATGATTCTTGTCTTATAGG 0: 1
1: 0
2: 4
3: 46
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153324223 Original CRISPR ATTATTAACTAGGTTATACA AGG (reversed) Intronic
900839389 1:5035678-5035700 ATTATTAACCATGGTATTCAAGG + Intergenic
901953323 1:12766095-12766117 ATTAATAACTAGAATATGCAAGG - Intergenic
903801182 1:25969561-25969583 ATTATTAACTGCATTTTACAGGG - Intronic
908093540 1:60712710-60712732 ATTAATAACCAGAATATACAAGG + Intergenic
908329571 1:63057655-63057677 ATTAACAACCAGGTTATATAAGG + Intergenic
908798127 1:67851724-67851746 AGTATTAATTAGGTCAGACACGG - Intergenic
908888973 1:68821508-68821530 ATTATTAACTAGAGTGAACAGGG + Intergenic
909587367 1:77305207-77305229 ATTAATAACCAGAATATACAAGG - Intronic
909969785 1:81967870-81967892 ATTGTGGACTATGTTATACAAGG - Intronic
910424305 1:87103464-87103486 TTCATTAATTAGGTTATACTTGG - Exonic
910638219 1:89432297-89432319 ATTGTTTACTATGTTATACTTGG + Intergenic
910705049 1:90120169-90120191 ATTAATAACTAGAATATATAAGG - Intergenic
910902703 1:92139145-92139167 ATTTTTATATAAGTTATACAAGG - Intronic
910975908 1:92905501-92905523 ATTAATAACCAGGATATATAAGG - Intronic
911240924 1:95465275-95465297 ATTAATAACTAGAATATATAAGG - Intergenic
911782222 1:101895955-101895977 ATTATTACCTATGTTTTAAATGG - Intronic
912012446 1:104984565-104984587 ATTAATAACTAGAATATATAAGG - Intergenic
912606573 1:110996285-110996307 ATTAATAACCAGAATATACAGGG - Intergenic
912644656 1:111380760-111380782 TTTACTAACTAGGTCATTCAAGG + Intergenic
913471932 1:119196752-119196774 AATATTAACAAGGTTACCCAAGG - Intergenic
917320523 1:173776310-173776332 ATTAATAACTAGAATATATAAGG - Intronic
918020184 1:180679995-180680017 ATTAATATCTAGAATATACAAGG + Intronic
918665763 1:187148674-187148696 ATTAATAACCAGAATATACAAGG - Intergenic
919416780 1:197320395-197320417 ATAATTCACTAGGTATTACATGG + Intronic
919512588 1:198484457-198484479 ATTAATATCTAGAATATACAAGG + Intergenic
920492352 1:206426844-206426866 ATTAATAACTAGAATATATAAGG - Intronic
920592867 1:207238824-207238846 ATTAATAACTAGAATATATAAGG + Intergenic
920936041 1:210435845-210435867 ATTAATAACCAGAATATACAAGG - Intronic
920953122 1:210591911-210591933 ATTAATAACCAGGATATATAAGG - Intronic
920998889 1:211022586-211022608 ATTAATATCTAGAATATACAAGG + Intronic
922065916 1:222143009-222143031 ATTAATAACTAGAGTATATAAGG + Intergenic
922086909 1:222357956-222357978 ATTAATAACCAGACTATACAAGG + Intergenic
922524735 1:226292056-226292078 ATTTTTAAATAGGGTATATAGGG + Intronic
922642635 1:227249557-227249579 ATTAATAACCAGAATATACAAGG + Intronic
924679161 1:246213892-246213914 ATTATAAACTAGGAAATTCAAGG - Intronic
924737089 1:246768044-246768066 TATTTTAACTAGGTTTTACATGG + Exonic
1064454832 10:15477685-15477707 CTTATTTACTTGTTTATACATGG - Intergenic
1064696346 10:17969670-17969692 ATTAATAACCAGAATATACAAGG - Intronic
1065876974 10:30005919-30005941 ATTAATAACCAGATTATATAAGG - Intergenic
1066526789 10:36288979-36289001 ATTAATAACTGGAATATACAAGG - Intergenic
1066685132 10:37974383-37974405 ATTAATAACCAGAATATACAAGG + Intronic
1067132620 10:43578598-43578620 ATTAATAACCAGAATATACAAGG - Intergenic
1068051524 10:51955701-51955723 AATGTTAACTAGTTTATACATGG + Intronic
1069314077 10:67076135-67076157 ATTATTCACTTTGTAATACAGGG - Intronic
1070344010 10:75524116-75524138 ATTATTAATAAGATTATAGAGGG + Intronic
1071690485 10:87813725-87813747 ATAATTAAATAGGATATTCATGG - Intronic
1072551568 10:96481724-96481746 GTTATTAACTATGTTTGACAAGG + Intronic
1072771840 10:98147293-98147315 ATTAATAACAAGAATATACAAGG - Intronic
1072923275 10:99594700-99594722 ATTATGAAAGAGGATATACAGGG + Intergenic
1073520668 10:104126090-104126112 ATTATAAACTAAGTTCTAAAAGG + Exonic
1073731829 10:106297271-106297293 GTGATTAACTGAGTTATACACGG + Intergenic
1075423109 10:122319271-122319293 ATTATTAAGTAGGACACACAAGG - Intronic
1077741031 11:4845706-4845728 ATTAATAACTAGAATATATAAGG + Intronic
1078277764 11:9866845-9866867 ATTAATAACCAGAGTATACAAGG + Intronic
1079068614 11:17321972-17321994 ATTAATAACTAGAATATATAAGG - Intronic
1079220909 11:18560270-18560292 ATTAATAACTATGTTTTAGAGGG - Intronic
1079271878 11:18994891-18994913 ATTAATAACCAGAATATACAAGG - Intergenic
1079402407 11:20116393-20116415 ATTGCAAACTAGGTTGTACATGG - Intronic
1080908432 11:36570901-36570923 ATTAATAACCAGAATATACAAGG - Intronic
1081265215 11:41012958-41012980 ATTATTAACCAGAGTATATAAGG - Intronic
1081419436 11:42856068-42856090 ATTAATAACTAGAATACACAAGG + Intergenic
1083817647 11:65145482-65145504 TTTACTAACTAGGTCATTCAAGG - Intergenic
1085664698 11:78403849-78403871 ATTAATAACTAGAATATATAAGG + Intronic
1085977623 11:81678752-81678774 ATTAATAACTAGAATATATAAGG - Intergenic
1086421695 11:86643916-86643938 GTTATTACCTTCGTTATACAGGG - Intronic
1086599450 11:88614907-88614929 ATTTTTAAAAAGGTGATACAGGG - Intronic
1086737482 11:90323901-90323923 ATTAATAACTAGAATATATAAGG - Intergenic
1086904614 11:92404425-92404447 ATTAGCTACTAGGTTATCCAGGG - Intronic
1087491950 11:98838922-98838944 ATTAATAACCAGAATATACAAGG - Intergenic
1087532406 11:99400959-99400981 ATTAATAACTAGAGTATATAAGG - Intronic
1087546958 11:99596930-99596952 ATTATTAATCCTGTTATACATGG + Intronic
1088033808 11:105286752-105286774 ATTAATAACTAGAATATATAAGG + Intergenic
1088106461 11:106211945-106211967 ATTATTAACCAGGTAAAATATGG + Intergenic
1089905974 11:122039023-122039045 ATTATAAACTTGGTTATAAAAGG - Intergenic
1090544204 11:127745075-127745097 ATTATTAATTAGTTTTTTCATGG + Intergenic
1090906557 11:131080672-131080694 ATTATTAAGTATGTTAATCAGGG + Intergenic
1091290858 11:134438992-134439014 ATAATTAACTTGGTACTACATGG + Intergenic
1092833824 12:12469512-12469534 ATTACAAACTCGGTTTTACAAGG + Exonic
1093258058 12:16897100-16897122 TTTATTAGCTTTGTTATACATGG - Intergenic
1093413403 12:18893765-18893787 AAAATTAACAAGGTTATTCAGGG - Intergenic
1094033297 12:26038530-26038552 ATTAAAGAGTAGGTTATACAAGG - Intronic
1094086745 12:26601602-26601624 TTTATTCAATAGGTTATAAAGGG - Intronic
1095163751 12:38947329-38947351 ATTAATAACCAGAATATACAAGG + Intergenic
1096191099 12:49620114-49620136 TTTACTAACTAGGTCATTCAGGG + Intronic
1097303983 12:58048860-58048882 ATTAATAACCAGGATATATAAGG + Intergenic
1097556254 12:61141721-61141743 ATTATTATCCAAGATATACAAGG - Intergenic
1097658567 12:62400151-62400173 GTTATTGAGTAGTTTATACAAGG + Intronic
1097756540 12:63413302-63413324 ATTAATAACTAGAATATATAAGG - Intergenic
1097769443 12:63564975-63564997 AATATTATCAAGGTTAAACAAGG - Intronic
1098409141 12:70161083-70161105 ATTAATAACCAGAATATACAAGG + Intergenic
1098873010 12:75837376-75837398 ATTATTCACTATGTTAAAGATGG - Intergenic
1100060563 12:90570046-90570068 ATTAATAACTAGAATATACAAGG - Intergenic
1100571198 12:95844768-95844790 ATTATTAACAGGGTTAAACAAGG - Intergenic
1101117428 12:101545758-101545780 ATTAATAACCAGAATATACAAGG + Intergenic
1103772665 12:123340199-123340221 CATATTAACAATGTTATACATGG + Intronic
1105066635 12:133206372-133206394 ATTATTCTCCATGTTATACATGG - Intergenic
1106047620 13:26158930-26158952 ATTATTGACTTTGTTACACAAGG - Intronic
1108158124 13:47609401-47609423 ATTAATAACCAGGATATAGAAGG + Intergenic
1109013573 13:56980075-56980097 ATTATTGACTAAGTTAATCAAGG + Intergenic
1109575718 13:64254681-64254703 ATTAAGAACTAGGAAATACATGG + Intergenic
1109647788 13:65282530-65282552 ATTATCAACTTGGTTATTCAAGG + Intergenic
1110050536 13:70891941-70891963 GTAATTACCTAGGTAATACAGGG + Intergenic
1110625928 13:77655674-77655696 ATTAATAACTAGACTATATAAGG - Intergenic
1110931785 13:81227836-81227858 ACTCTTAACTAGGTTATCAAAGG - Intergenic
1111467467 13:88633973-88633995 ATTAATAACTAGCATATATAAGG - Intergenic
1111512915 13:89288872-89288894 ATTAATAACTAGAATATATAAGG - Intergenic
1112136979 13:96590569-96590591 ATTAATAACTAGAATATAAAAGG - Intronic
1112852289 13:103721101-103721123 ATTATCTAAGAGGTTATACATGG + Intergenic
1114507046 14:23224865-23224887 ATTAATAACTAGACTATATAAGG + Intronic
1114707817 14:24745157-24745179 ATTGGTAACTGGGGTATACAGGG - Intergenic
1114898847 14:27030538-27030560 ATTAATAACTAGAATATATAAGG - Intergenic
1115381106 14:32740255-32740277 ATTAATAACCAGAATATACAAGG - Intronic
1115673399 14:35642353-35642375 ATTAATAACCAGAATATACAAGG + Intronic
1115678419 14:35708365-35708387 ATTAATAACTAGAATACACAAGG + Intronic
1116099625 14:40417018-40417040 ATTATTAACTAGGTATAAGATGG - Intergenic
1116123143 14:40746957-40746979 ATTATTAAAAATGTAATACATGG - Intergenic
1116125755 14:40782604-40782626 ATTGTTAACTTGGTTATTCTTGG - Intergenic
1116546193 14:46167968-46167990 ATTAATAACTAGAATATATAAGG - Intergenic
1116703715 14:48268665-48268687 ATTAATAACTAGAATATATAAGG - Intergenic
1117501314 14:56354850-56354872 ATTATGAACATGGTAATACAAGG - Intergenic
1117606492 14:57434211-57434233 ATTAATAACTAGAATATATAAGG - Intergenic
1118510305 14:66464568-66464590 AGTCTCAGCTAGGTTATACAAGG + Intergenic
1120102129 14:80457166-80457188 ATTATTAACTTTATTACACAGGG - Intergenic
1120439284 14:84514995-84515017 ATTAATAACCAGAATATACAAGG - Intergenic
1124554713 15:30713850-30713872 ATTAATAACCAGATTATATAAGG - Intronic
1124676535 15:31691830-31691852 ATTAATAACCAGATTATATAAGG + Intronic
1124866621 15:33498565-33498587 ATTAATATCTAGAATATACAAGG - Intronic
1125273408 15:37965520-37965542 ATTAATAACCAGGGTATATAAGG + Intronic
1126270097 15:46805847-46805869 ATTAATAACCAGAATATACAGGG + Intergenic
1126503640 15:49377738-49377760 ATTAATAACCAGGGTATATAAGG - Intronic
1128503637 15:68248913-68248935 ATTAATAACCAGAATATACAAGG + Intronic
1130090955 15:80820906-80820928 ATTATTAACTAGTTTACAAGGGG + Intronic
1130962448 15:88671293-88671315 ATTATTAACCAGAATATATAAGG + Intergenic
1131634484 15:94216595-94216617 ATTAATAACCAGGATATATAAGG + Intergenic
1132943909 16:2521640-2521662 ATTTTTACTTAGGTTCTACAGGG + Intronic
1133584311 16:7177636-7177658 ATTATTAACTAGATTGAACCAGG + Intronic
1134511977 16:14855878-14855900 ATTAATAAGTAGGTAATGCATGG + Intronic
1134699617 16:16254378-16254400 ATTAATAAGTAGGTAATGCATGG + Intronic
1134972211 16:18540293-18540315 ATTAATAAGTAGGTAATGCATGG - Intronic
1139103450 16:63797901-63797923 ATTATTAACCAGAATATATAAGG + Intergenic
1141202116 16:81906146-81906168 ACTAATAACTAGTTTATAGATGG + Intronic
1150185448 17:63176447-63176469 GTAATTAAATAGGTTATATAAGG - Intronic
1153324223 18:3801579-3801601 ATTATTAACTAGGTTATACAAGG - Intronic
1153421688 18:4913983-4914005 ATTAATAACCAGAATATACAAGG + Intergenic
1153938071 18:9949344-9949366 ATTTTTAAATAGATTTTACATGG + Intronic
1154055677 18:11011484-11011506 ATTATTAGCTATGTTAGCCATGG - Intronic
1154939228 18:21094368-21094390 ATTAATAACTAGAATATATAAGG + Intronic
1155116317 18:22771736-22771758 ATTAATAACTAGAATATATAAGG + Intergenic
1155129653 18:22919840-22919862 ATAATTAATTAGGCTAGACATGG - Intronic
1155588524 18:27397536-27397558 ATAATTAACTAGGTGATGTATGG - Intergenic
1155881258 18:31151538-31151560 ATTTTTAGCTAGGTTATAAGTGG + Intronic
1156021224 18:32601475-32601497 ATTAATAACCAGGATATATAAGG - Intergenic
1157143807 18:45139866-45139888 ATTAATATCTAGAATATACAAGG - Intergenic
1159730947 18:72026935-72026957 ATTAATAACTAGAATATATAAGG - Intergenic
1162122094 19:8477152-8477174 ATTAATAACTAGATTCTTCAAGG + Intronic
1163228972 19:15986632-15986654 ATTAATAACTAGAATATATAAGG + Intergenic
1164491395 19:28718207-28718229 ATTAATAACCAGAATATACACGG + Intergenic
1164785760 19:30929157-30929179 AATATTAAGTAGCTTATAAAAGG - Intergenic
1165646094 19:37438862-37438884 ATTAATAACTAGAATATATAAGG + Intronic
926602274 2:14857934-14857956 ATTAATAACTAGAATATATAAGG + Intergenic
926966408 2:18418487-18418509 ATTAATAACCAGGATATATAAGG - Intergenic
927084662 2:19662533-19662555 ATTATTAATTATTTTAAACATGG + Intergenic
927524273 2:23722930-23722952 ATTAATATCTAGAATATACAAGG + Intergenic
928163530 2:28951742-28951764 ATTATTACCTAGGATATGCCAGG - Intergenic
928486041 2:31733151-31733173 ATTATTAACCAGAATATATAAGG + Intergenic
928498500 2:31861305-31861327 ATTGTTAACTATTTTATAAATGG - Intergenic
928783441 2:34853324-34853346 ATTAATATCTAGAATATACAAGG - Intergenic
931085490 2:58825517-58825539 ATTATTAACCAGAATATATAAGG - Intergenic
931574065 2:63701115-63701137 ATTAATAACCAGGATATATAAGG + Intronic
931765049 2:65447687-65447709 ATTAATAACCAGAATATACAAGG - Intergenic
931975436 2:67638947-67638969 ATTATTACTTAGCTTATACTTGG + Intergenic
932898017 2:75663087-75663109 ATTAGTAACAAAATTATACAAGG - Exonic
932920645 2:75910425-75910447 ATTAATAACTAGAATATATAAGG - Intergenic
932985105 2:76716504-76716526 ATTATTAAGTAAGTAATAGAGGG - Intergenic
933009314 2:77038010-77038032 ATAATTATATAGGTTATTCAAGG - Intronic
933091737 2:78127831-78127853 AGTAATAACTAGCTGATACAAGG + Intergenic
933111686 2:78408759-78408781 ATTAATACCTGGATTATACAAGG - Intergenic
933339173 2:80999874-80999896 ATTAATAACCAGAATATACAAGG - Intergenic
933564077 2:83928157-83928179 AATATTACCTAGCTTATACAAGG - Intergenic
934094444 2:88586322-88586344 ATTATTAATGAGGTTATGAATGG - Intronic
935749411 2:106217702-106217724 ATTAATAACTAGAATATATAAGG + Intergenic
936376185 2:111943211-111943233 AGAAATAAATAGGTTATACAGGG + Intronic
936417237 2:112327400-112327422 ATTAATAACTAGAATATATAAGG - Intronic
937303795 2:120858828-120858850 ATTATTTAATAGGTAATAAATGG - Intronic
939144935 2:138401961-138401983 ATTAATAACCAGGTGATATAAGG + Intergenic
939231773 2:139435955-139435977 AAAATTAACTAGGAGATACATGG + Intergenic
939256732 2:139753430-139753452 ATTAATAACCAGGATATATAAGG - Intergenic
939383013 2:141460451-141460473 ATAAGTAGCAAGGTTATACAGGG + Intronic
939710228 2:145508411-145508433 ATTAATAATTAGAATATACAAGG - Intergenic
939929980 2:148221639-148221661 GTTAATAACTAGAATATACAAGG - Intronic
940179621 2:150917883-150917905 ATGATTAAATAAATTATACATGG - Intergenic
940432395 2:153608465-153608487 TTTATTAACTAAACTATACACGG - Intergenic
940699743 2:157025932-157025954 ATTAATAACTAGAATATATAAGG + Intergenic
941629084 2:167864555-167864577 TTTATTAACAAGTTAATACAGGG - Intergenic
941913561 2:170791219-170791241 ATTCTTGTCTAGGTTAAACATGG - Intronic
943170423 2:184390558-184390580 ATTAATAACCAGAATATACAAGG + Intergenic
943813469 2:192220686-192220708 AATATTAAGTAGGTTAGACTAGG + Intergenic
944337156 2:198548829-198548851 ATTATTAACCTTGTTATAGATGG + Intronic
944730628 2:202513608-202513630 ATTACTAATTTGATTATACATGG + Intronic
944963818 2:204906494-204906516 ATTATTAACTAGAGAACACATGG + Intronic
945174613 2:207029898-207029920 ATTAATATCTAGAATATACAAGG + Intergenic
945217823 2:207453814-207453836 ATTGATAACTAGGATATATAAGG + Intergenic
945771423 2:214047801-214047823 ATTAGTAACTAGAATATATAAGG + Intronic
945962985 2:216155264-216155286 ACTAATAATTAGGATATACAAGG + Intronic
946766135 2:223042713-223042735 GTCATTAATTAGGTTAAACATGG + Intergenic
946936398 2:224725432-224725454 ATTAATAACCAGCATATACAGGG - Intergenic
1168853351 20:991456-991478 ATTGATATCTAGGTAATACAAGG + Intronic
1169381204 20:5108759-5108781 AGTATTGACTAGTTTATAAATGG + Intronic
1169665230 20:8026658-8026680 ATTATTAAATAGGTCACAAAAGG - Intergenic
1170256571 20:14350636-14350658 ATTAATAACCAGAATATACAAGG - Intronic
1170474381 20:16700598-16700620 ATTATTTTCTAGGTTCTAGATGG - Intergenic
1171485906 20:25485737-25485759 ATTATGAACTAGGCTTTAGAAGG + Intronic
1171879424 20:30606554-30606576 AATATTCACTAGGTTTTATATGG + Intergenic
1172559990 20:35878921-35878943 TTTACTAACTAGGTCATTCAAGG + Intronic
1173127370 20:40351572-40351594 ATTAATAACTAGAATATATAAGG + Intergenic
1174731393 20:52921512-52921534 CTTATTAACTATGTGATACCAGG - Intergenic
1175023443 20:55875872-55875894 GTTAGTAACTAGGTTAGGCATGG - Intergenic
1177432584 21:21009605-21009627 ATAATTAACTAGATTAGATATGG + Intronic
1177761353 21:25405871-25405893 ATTAATAACTAGAATATATAAGG + Intergenic
949089695 3:12376-12398 ATTATAAACTAAGTTAACCAAGG + Intergenic
950072389 3:10163228-10163250 ATTATTAAATAGGGTATAAGGGG - Intergenic
950339092 3:12225934-12225956 ATTAATAACCAGAATATACAAGG + Intergenic
951068786 3:18300837-18300859 ACTAATATCTAGATTATACAAGG + Intronic
951255499 3:20444881-20444903 ATTAATAACTAGAATATATAAGG + Intergenic
951410850 3:22364368-22364390 ATTAATATCTAGAATATACATGG + Intronic
951793518 3:26513140-26513162 ATTAATAACCAGGATATATAAGG - Intergenic
953424718 3:42785061-42785083 TTTACTAACTAGGTCATTCAAGG - Intronic
954487392 3:50866034-50866056 ATTAATGACTAGAATATACAAGG - Intronic
955574382 3:60343610-60343632 ATTATTAATTAGGTTTCAAAGGG - Intronic
957143499 3:76392067-76392089 ATTATTAATTATTTTCTACATGG + Intronic
957509681 3:81171168-81171190 AGTATGAACTAGGTAATCCAAGG - Intergenic
957552554 3:81726088-81726110 ATTAATAACTCAGTTTTACATGG + Intronic
957636679 3:82794754-82794776 AATATTCACTAGGTGATACAGGG + Intergenic
957699847 3:83694789-83694811 ATTAATAACTAGAATATATAAGG + Intergenic
957779199 3:84796749-84796771 ATTAATAACCAGAATATACAAGG + Intergenic
957836325 3:85595616-85595638 ATTATAATCTAGGATATAAAAGG - Intronic
958068076 3:88571204-88571226 ATTAATAACCAGGATATACAAGG + Intergenic
958575248 3:95941222-95941244 ATTAATAACTAGAATATATAAGG - Intergenic
959114037 3:102154932-102154954 ATTAATAACTAGAATATAGAAGG + Intronic
959247648 3:103895292-103895314 ATTAATAACTAGAATATACAAGG + Intergenic
961927702 3:130499219-130499241 ATTATTAAGTATATTAGACAGGG + Intergenic
962949875 3:140208207-140208229 GTTATTTCCAAGGTTATACATGG + Intronic
963393499 3:144701097-144701119 ATTATAAACTGGATTCTACAAGG + Intergenic
964853141 3:161116939-161116961 ATTAATAACCAGGATATATAAGG + Intronic
965042599 3:163529813-163529835 ATTAATAACTAGGATATATAAGG + Intergenic
965064035 3:163821732-163821754 ATTACTAACCAGAATATACAAGG + Intergenic
965221974 3:165937668-165937690 ATTTTAAATTAGGTCATACAGGG - Intergenic
965348912 3:167588816-167588838 ATTAATAACCAGAATATACAAGG - Intronic
965379458 3:167969901-167969923 ATTAATAACCAGAATATACAAGG + Intergenic
966082734 3:176024745-176024767 ATTATTAACTATGTTCCATAAGG - Intergenic
967928384 3:194671548-194671570 ATATTTTACTAGGTTATAGAAGG - Intronic
968004425 3:195230263-195230285 ATTAATAACCAGATTATATAAGG - Intronic
969943156 4:10755180-10755202 TTTATTAACTATATTAAACAGGG + Intergenic
970410565 4:15803392-15803414 ATTAATATCTAGAATATACAAGG + Intronic
970738938 4:19209927-19209949 ATTAATAACCAGATTATACAAGG + Intergenic
970851518 4:20609132-20609154 ATTAGTAAATATGTTTTACATGG - Intronic
971651759 4:29285218-29285240 ATTAATAACTGGAATATACAAGG + Intergenic
971670921 4:29556552-29556574 AATATTAAATAGTATATACACGG + Intergenic
972003607 4:34069972-34069994 ACTGTTAACTAGGTGATCCAAGG - Intergenic
972007587 4:34130502-34130524 ATTAATAACTAGAATATATAAGG + Intergenic
972014263 4:34224561-34224583 ACTAATAACCAGGTTATATAAGG - Intergenic
972043326 4:34632136-34632158 ATTAATAACTAGAATATATAAGG + Intergenic
972085846 4:35214405-35214427 ATTATCATTTAGGTTTTACAAGG - Intergenic
972112990 4:35589564-35589586 CTTAATAACTAGGTAATATAAGG - Intergenic
972699260 4:41478123-41478145 ATAATGAAATAGGTTTTACAGGG - Intronic
972907973 4:43774543-43774565 ATTCTTACCTAGATTATTCAGGG - Intergenic
973061053 4:45725333-45725355 ATTAATAACTAGAATATATAAGG + Intergenic
974826744 4:67140878-67140900 AATATAAACTAGCTAATACAAGG + Intergenic
974892832 4:67902287-67902309 ATTAATAACTAGAATATATAAGG - Intergenic
975185046 4:71392127-71392149 ATTATCAACCAGATTATACATGG - Intronic
975375611 4:73640795-73640817 ATTAGTAACCAGGATATATATGG - Intergenic
975501708 4:75093484-75093506 ATTAATAACTAGAATATATAAGG - Intergenic
976082413 4:81370258-81370280 ATTAATAACTAGAATATATAAGG - Intergenic
976369708 4:84273442-84273464 ATGATCAACTAGGCTATAGAAGG + Intergenic
976423202 4:84869740-84869762 ATTAATAACTAGGATATCCATGG + Intronic
976858845 4:89638135-89638157 ATTATTAACTATGTGATGTATGG + Intergenic
976991444 4:91371680-91371702 ATTATTAACTCTGTTACACAAGG - Intronic
977367579 4:96090472-96090494 ATTAATAATTAGATTATATAAGG + Intergenic
977716081 4:100185437-100185459 ATTAATAAATGGGTTATATAAGG - Intergenic
977855147 4:101881184-101881206 ATTAATAACCAGGATATATAAGG + Intronic
978262890 4:106783326-106783348 ATTAATAACTAGAATATATAAGG + Intergenic
978279231 4:106989609-106989631 AATATTAATTAGGTGATACTTGG - Intronic
978458937 4:108929059-108929081 TTTATTAAGTAGGATATAAAAGG - Intronic
978820990 4:112965384-112965406 ATTAATAACCAGAATATACAAGG - Intronic
979892365 4:126114713-126114735 ATTAGTAACCAGAATATACAAGG - Intergenic
980001612 4:127496258-127496280 ATTAATATCTAGAATATACAAGG - Intergenic
980065630 4:128185565-128185587 ACTAATAACTAGAATATACAAGG - Intronic
980279598 4:130702865-130702887 ACTATTAAGTAGGTTTCACAGGG - Intergenic
980339145 4:131519686-131519708 ATTAATAACCAGATTATATAAGG - Intergenic
980620229 4:135291656-135291678 ATTAATAACCAGGATATATAAGG - Intergenic
980662161 4:135875678-135875700 ATTTTTAAGTAAGTTAAACATGG + Intergenic
980850693 4:138377728-138377750 ATTAATAACTAGAATATATAAGG + Intergenic
980882805 4:138730489-138730511 ATTAATATCTAGAGTATACAAGG + Intergenic
981397041 4:144263804-144263826 ATTAATAACTAGAATATATAAGG + Intergenic
982635554 4:157892024-157892046 ATTATTCACAAATTTATACATGG + Intergenic
983008383 4:162514749-162514771 TTTTTTAACTAAGTTAAACATGG - Intergenic
983735986 4:171061131-171061153 ATAAATATTTAGGTTATACATGG + Intergenic
985287098 4:188347086-188347108 ATTAGTAACCAGAATATACAAGG + Intergenic
986630724 5:9769793-9769815 ATTAGTAACCAGAATATACAAGG - Intergenic
987267350 5:16270550-16270572 ATTAATAACTAGAATATATAAGG + Intergenic
987823568 5:22997806-22997828 ATTAATAACCAGAATATACAAGG + Intergenic
987952378 5:24692046-24692068 ATTAATAACTAGAATATATAAGG - Intergenic
989111551 5:37911519-37911541 ATTAGTAACCAGGATATATAAGG + Intergenic
989428305 5:41322191-41322213 ATTAATAACCAGGATATATAAGG + Intronic
989524410 5:42436910-42436932 ATGAATAACTAGGTTAACCAGGG + Intronic
990227336 5:53669387-53669409 AGTATTAACGAGGTTGTAGAGGG - Intronic
990771010 5:59245211-59245233 ATTATGAGCTAGGGTACACAAGG + Intronic
990963714 5:61421939-61421961 ATTAATAACCAGAATATACAAGG - Intronic
991488223 5:67159797-67159819 CTTTTTAACCAGGTCATACAGGG - Intronic
991922762 5:71673210-71673232 ATTAATAACTAGAATATATAAGG - Intergenic
992309997 5:75487585-75487607 ATTAATAACCAGAATATACAAGG + Intronic
992432735 5:76725273-76725295 ATTATTAAATAGTTTAAATACGG - Intronic
993077846 5:83256948-83256970 AGGATTAACAAGGTAATACATGG + Intronic
993358375 5:86942320-86942342 ATTAATAACCAGAATATACAAGG - Intergenic
993677328 5:90832481-90832503 ATTAATAACTAGAATATATAAGG - Intronic
995372247 5:111431622-111431644 ATTAATAACCAGATTATAAAAGG + Intronic
995565048 5:113425825-113425847 ATGGTGAACGAGGTTATACATGG - Intronic
996449586 5:123604638-123604660 CATATTAAATAGGTTATACAAGG - Intronic
996459911 5:123730215-123730237 ATTAATAACTAGAATATAAAAGG + Intergenic
997060408 5:130494639-130494661 ATTAATAACTAGAGTATATAAGG + Intergenic
997096342 5:130917520-130917542 ATTAATAACCAGGATATATAAGG + Intergenic
997221858 5:132174539-132174561 ATTTTTATGCAGGTTATACATGG - Intergenic
997901480 5:137769806-137769828 ATTAATAACTAGAATATATAAGG + Intergenic
998699281 5:144679315-144679337 ATTAATATCCAGGATATACAAGG + Intergenic
998762272 5:145445632-145445654 ATTAATATCCAGGTTATATAAGG + Intergenic
998918807 5:147044680-147044702 ATTATTAATTAAGGTAGACATGG + Intronic
999647456 5:153732555-153732577 ATTTTTAACTAGGTTATTTGGGG + Intronic
1001363925 5:171117887-171117909 ATTAATATCTAGAATATACAAGG - Intronic
1003927555 6:10890572-10890594 ATTAATATCTAGAATATACAGGG - Intronic
1005193061 6:23249627-23249649 AATATGAATTAGGTCATACAAGG - Intergenic
1006266107 6:32925483-32925505 ATTAATAACTAGAATATATAAGG + Intergenic
1009373099 6:62932774-62932796 ATTAATAACCAGAATATACAAGG - Intergenic
1009661869 6:66623080-66623102 ATTAATAACTAGAATATATAAGG - Intergenic
1009689931 6:67017042-67017064 ATTAATAACCAGATTATATAAGG + Intergenic
1010070440 6:71737970-71737992 ATTATGAGCTAGATTCTACAGGG + Intergenic
1010158836 6:72827608-72827630 ATTAATATCTAGAATATACAAGG - Intronic
1010461704 6:76121033-76121055 ATTGTTAATTAGGATATACCTGG + Intergenic
1010474606 6:76271233-76271255 ATTAATAACCAGATTATATAAGG - Intergenic
1010558476 6:77315934-77315956 AGTATTTACTGGGTTTTACATGG - Intergenic
1011334486 6:86245025-86245047 ATTAATAACCAGGATATATAAGG - Intergenic
1012089649 6:94875076-94875098 ATTTTTAATTTGGTAATACAGGG - Intergenic
1012303015 6:97613133-97613155 ATTAATAACCAGAATATACAAGG - Intergenic
1012953210 6:105540972-105540994 ATGAATAAATAGGTTATAAATGG + Intergenic
1013149830 6:107433884-107433906 ATTAATAACAAGAATATACAAGG + Intronic
1013838382 6:114360114-114360136 ATTATTAACTAAGATATAAATGG + Intergenic
1014402077 6:121002484-121002506 ATTAATAACCAGAATATACAAGG + Intergenic
1015415604 6:132944496-132944518 ATTATTAACCAGACTATATAAGG + Intergenic
1016365484 6:143312821-143312843 ATTAATAACTAGAATATACAAGG + Intronic
1017651198 6:156584038-156584060 ATTAATAACCAGAATATACAAGG + Intergenic
1018032853 6:159856808-159856830 ATTAATATCTAGAATATACAAGG - Intergenic
1020503821 7:8957918-8957940 AAAATATACTAGGTTATACAGGG - Intergenic
1020861608 7:13499486-13499508 ATTATATACTAGGATATACTAGG + Intergenic
1021093280 7:16507765-16507787 ATTAATAACCAGAATATACAAGG + Intronic
1021276390 7:18657156-18657178 ATTAATAACCAGGATATATATGG - Intronic
1021376240 7:19910675-19910697 ATTAATAACTAGAATATATAAGG + Intergenic
1021546851 7:21823001-21823023 ATTAATAACTAGAATATATAAGG - Intronic
1022367469 7:29737816-29737838 AATATTATCAAGGTTAAACAAGG + Intergenic
1022928717 7:35086064-35086086 AATATTATCAAGGTTAAACAAGG - Intergenic
1023195185 7:37629499-37629521 ATTAGTAACCAGAATATACAAGG - Intergenic
1023314770 7:38924271-38924293 ATTAATATCTAGAATATACAAGG + Intronic
1024746717 7:52415679-52415701 TTAATTAACTTGGTTTTACAAGG + Intergenic
1024855803 7:53777723-53777745 ATTAATATCTAGATTATAGATGG - Intergenic
1027524576 7:79251348-79251370 ATTATTAACCAGAATATATAAGG + Intronic
1027805603 7:82817750-82817772 ATTATTAAATAGGTCATGCAAGG - Intronic
1028009550 7:85623782-85623804 ATTAATAACTAGAATATATAAGG - Intergenic
1028332000 7:89606086-89606108 ATTATACAGTAGGTTAAACAAGG - Intergenic
1028385981 7:90253714-90253736 ATTAATAACAAGAATATACAAGG - Intronic
1029824832 7:103179747-103179769 AATATTATCAAGGTTAAACAAGG - Intergenic
1030494402 7:110279863-110279885 GTTAGTAACTAGATTATATATGG - Intergenic
1030709130 7:112729468-112729490 ATTAATATCTAGGATAAACAAGG + Intergenic
1031190564 7:118544428-118544450 ATTAATAACCAGGTTATATAAGG + Intergenic
1031290932 7:119932752-119932774 ATTTATTACTAAGTTATACAAGG + Intergenic
1032001601 7:128269145-128269167 ATTAATAACCAGGATATATAAGG + Intergenic
1032116256 7:129119967-129119989 ATTATTATCTAGAACATACAAGG - Intergenic
1032941210 7:136794672-136794694 ATTAATAACTAGAATATAAAAGG + Intergenic
1035991811 8:4499518-4499540 TTTATCAACTAGTTTAAACAAGG + Intronic
1037000309 8:13709109-13709131 ATTAATAACCAGGATATATAAGG - Intergenic
1037216442 8:16458062-16458084 ATTAATAACTAAGTTTTATATGG + Intronic
1037255915 8:16953435-16953457 ATTAATAACTAGAATATATAAGG + Intergenic
1039728210 8:40244987-40245009 ATTAATAACTAGAATATATAAGG + Intergenic
1041995433 8:64051234-64051256 ATTAGTAACCAGGATATACAAGG + Intergenic
1043245621 8:77996176-77996198 ATTATTAACTTACTTATACTTGG + Intergenic
1043412880 8:80017939-80017961 ATTAATAACCAGGATATATAAGG + Intronic
1043754561 8:83986560-83986582 ATTAATAACTAGAATATATAAGG + Intergenic
1044487875 8:92773710-92773732 ATTAATAACTAGAATATATAAGG - Intergenic
1045632248 8:104138648-104138670 ATTAATAACCAGAATATACAAGG - Intronic
1046118815 8:109819391-109819413 ATTATTAACCAGAATATATAAGG - Intergenic
1046215159 8:111135816-111135838 ATTAATAACCAGAATATACAAGG - Intergenic
1048071276 8:131023767-131023789 TTTATTAACTAGATTTTAAAAGG + Intronic
1048759530 8:137778267-137778289 ATTATTAAATTGTCTATACATGG + Intergenic
1050359137 9:4812075-4812097 ATTAATAACCAGAATATACAAGG - Intronic
1051313281 9:15800491-15800513 ATTAATAACTAGAATATACAAGG - Intronic
1052450421 9:28623070-28623092 ATTAATAACCAGAATATACAAGG - Intronic
1054983067 9:71229572-71229594 ATTAATAACCAGACTATACAAGG + Intronic
1056059396 9:82868678-82868700 ATTATTATCTAGAATATATAAGG + Intergenic
1056562776 9:87746985-87747007 ATTAATAACTAGAATATATAAGG - Intergenic
1058144348 9:101395038-101395060 ATTAATAACCAGAATATACAAGG + Intronic
1058144995 9:101400662-101400684 AGTATTAACTGGGTCATCCATGG - Intronic
1058168239 9:101645954-101645976 ATTAATAACCAGGTTATAAAAGG - Intronic
1058497351 9:105573707-105573729 TTTAAAAACTAGGTTATACAAGG - Intronic
1185657831 X:1700316-1700338 ATTATTAACTGGAATATTCATGG + Intergenic
1186722239 X:12317543-12317565 ATTAACAACTAGAATATACAAGG + Intronic
1186915797 X:14218992-14219014 ATTAATAACCAGGATATATAAGG - Intergenic
1187327886 X:18308437-18308459 ATTAATAACTAGAATATATAGGG + Intronic
1187588249 X:20687908-20687930 ATTAATAACCAGATTATATAAGG - Intergenic
1187598774 X:20803495-20803517 ATAATAAAGTAGGTTATACAGGG + Intergenic
1188263832 X:28045819-28045841 ATTAATAACTAGAATATATAAGG - Intergenic
1188650880 X:32631133-32631155 ATTATCTACCAGGTAATACAGGG - Intronic
1188739442 X:33760218-33760240 ATTAATAACCAGAATATACAAGG - Intergenic
1188998703 X:36918589-36918611 ATTAATAACCAGGATATATAAGG - Intergenic
1191733336 X:64362848-64362870 ATTATTATCTAGAATATACAAGG + Intronic
1191922258 X:66269649-66269671 ATTAATAACTAGAATATATAAGG + Intergenic
1192074172 X:67974003-67974025 ATTAATAACTAGAATATAGAGGG + Intergenic
1192494107 X:71602658-71602680 ATTAATAACTAGAGTATATACGG - Intronic
1193176006 X:78393930-78393952 ATTAATAACTAGAATATATAAGG + Intergenic
1193562911 X:83041743-83041765 ATTATTGTTTAGGTTATATATGG - Intergenic
1193786280 X:85763195-85763217 ATTATTAAGTATATTATACGTGG - Intergenic
1194080476 X:89456876-89456898 ATTATCAACTAGCTCATACTTGG + Intergenic
1194624073 X:96208050-96208072 ATTAATAACTAGAATATATAAGG + Intergenic
1194866935 X:99080632-99080654 ATTATTGACTACAATATACAAGG - Intergenic
1194883170 X:99279683-99279705 ATTAATAACCAGAATATACAAGG + Intergenic
1195171758 X:102275551-102275573 ATTAATAACTAGCATATACAAGG - Intergenic
1195187102 X:102411542-102411564 ATTAATAACTAGCATATACAAGG + Intronic
1195396736 X:104419110-104419132 ATTAATAACTAGAATATATAAGG + Intergenic
1195477336 X:105302243-105302265 ATTAATAACCAGGATATATAAGG - Intronic
1195873974 X:109518618-109518640 ATTAGTAACCAGAATATACAAGG + Intergenic
1195948855 X:110245716-110245738 ATAATTAACTAGATAATAAATGG + Intronic
1196154494 X:112412967-112412989 ATTAATAACTAGAATATATAAGG + Intergenic
1196264313 X:113624018-113624040 ATTAATAACTAGAATATATAAGG - Intergenic
1196741122 X:119027044-119027066 ATTATTACCCAGCTTTTACACGG + Intergenic
1196771235 X:119296194-119296216 ATTAATAACCAGAATATACAAGG - Intergenic
1197003028 X:121461538-121461560 ATTAATAACCAGAATATACAGGG - Intergenic
1197108742 X:122746752-122746774 ATTATTGACTGGGTTATAAGTGG + Intergenic
1197360687 X:125499212-125499234 ATTAATAACTAGAATATATAAGG - Intergenic
1197369283 X:125606318-125606340 ATTAATAACCAGAATATACAAGG - Intergenic
1198994889 X:142563190-142563212 ATTAGTAACCAGAATATACAAGG - Intergenic
1199189923 X:144959072-144959094 ATTAATAACTAGACTATATAAGG + Intergenic
1199197720 X:145051057-145051079 ATTAATAACTAGAATATATAAGG + Intergenic
1199380057 X:147160372-147160394 ATTAATAACTATGTTATATGAGG - Intergenic
1199921509 X:152409626-152409648 ATTAATAACCAGAATATACAAGG + Intronic
1199925245 X:152455928-152455950 ATTAGTAACTAGAATATATAAGG + Intergenic
1200433151 Y:3112938-3112960 ATTATCAACTAGCTCATACTTGG + Intergenic
1200627868 Y:5542864-5542886 ATTCTCAACAAGGTTATGCATGG - Intronic
1201192922 Y:11463643-11463665 ATTAATAACAAGAATATACAAGG + Intergenic