ID: 1153325337

View in Genome Browser
Species Human (GRCh38)
Location 18:3812961-3812983
Sequence TGGACCTGAAAAATATATTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153325337 Original CRISPR TGGACCTGAAAAATATATTA CGG (reversed) Intronic
902273155 1:15319644-15319666 TAGACTTGTAAAATATAATATGG + Intronic
904410324 1:30321087-30321109 TGGAGCTGAAATAGATATTGTGG - Intergenic
906099393 1:43248618-43248640 TGGACATGAAAATTTTTTTATGG - Intronic
907756238 1:57313481-57313503 GGGACCTCAAAAATACAGTAGGG + Intronic
908647981 1:66300368-66300390 GGGACCTGAAAACCACATTAAGG + Intronic
908925238 1:69246455-69246477 TGTTCCTGAAGAAGATATTAAGG + Intergenic
909963789 1:81881645-81881667 TGGAGCTGTAAAATACATTATGG - Intronic
912077642 1:105896040-105896062 TGTCCCTGAAAAAGAAATTATGG + Intergenic
913155750 1:116096362-116096384 TGGAGCTGAAGAGTAAATTATGG + Intergenic
915864541 1:159485073-159485095 TGGACTAGAAAAATATGATAAGG + Intergenic
916975220 1:170070021-170070043 TGGAGCTGAAAAATATGAAAAGG + Intronic
917373053 1:174316958-174316980 TGGACCTTAAAGGAATATTATGG - Intronic
917689814 1:177457267-177457289 TGGACTTGAAAGATAGATTGTGG - Intergenic
919064453 1:192675841-192675863 TGGTCCTGACAATTATTTTATGG + Intergenic
919113511 1:193250658-193250680 TGTACCTGAAAAAAATATTATGG - Exonic
922026805 1:221757335-221757357 TGGAGCTAAATAATAGATTATGG + Intergenic
923154667 1:231267962-231267984 TGGACCTGAAAAATCTATAGAGG + Intronic
1063466781 10:6251113-6251135 TTGAGCTGGAAAATATATTTTGG - Intergenic
1063728252 10:8664546-8664568 TTGGCTTGAAAAATATTTTAAGG + Intergenic
1063781742 10:9332705-9332727 TGCACCTGTAATATATACTACGG + Intergenic
1064221611 10:13445637-13445659 TGGAACTGAAAAAAATGTCAAGG - Intronic
1064369168 10:14736135-14736157 TGTACCTCCAGAATATATTATGG + Intronic
1064693265 10:17939684-17939706 TATTTCTGAAAAATATATTAAGG + Intergenic
1065153538 10:22847005-22847027 TGGACCTGAATCATACAATATGG + Intergenic
1065476293 10:26141226-26141248 TGTACATTAAAAATATATTTAGG - Intronic
1068341700 10:55712530-55712552 TGCACCTGAAAAGTAGAATATGG - Intergenic
1068383769 10:56296033-56296055 TGGACCCGAAGAAAATATAATGG + Intergenic
1068562319 10:58528753-58528775 TGGAACTGAAAGAGATTTTAAGG - Intronic
1068936460 10:62639924-62639946 TGGACCTGAAAATCATAATGGGG + Intronic
1069154348 10:65007408-65007430 TGGACATTAAAAGTATAATAAGG - Intergenic
1070121721 10:73583882-73583904 TGGTTCTGATAAATGTATTATGG + Intronic
1074951199 10:118338531-118338553 TGGGCATGTAAAATATTTTATGG - Intronic
1076343831 10:129767200-129767222 TGGACATGAAAAATAGAGCAAGG - Exonic
1078047064 11:7924440-7924462 TAGATCTGAAAAAGAAATTATGG - Intergenic
1078999846 11:16742500-16742522 TGGCCCATAAAAATATATGAGGG + Intronic
1079219276 11:18545370-18545392 TGTACATTAAAAATATGTTATGG - Intronic
1079529255 11:21429652-21429674 TTGAGGAGAAAAATATATTATGG + Intronic
1079548349 11:21663094-21663116 TGGAGCTAAAACACATATTAAGG - Intergenic
1079596425 11:22254169-22254191 TGCACTGGAAAAATATATTTTGG + Intronic
1079707270 11:23636908-23636930 TGGACTTGATGATTATATTATGG - Intergenic
1079715056 11:23733217-23733239 TGGAGCTGAAAAATACAGCATGG + Intergenic
1081135239 11:39432257-39432279 TGCACATTAAAATTATATTAAGG + Intergenic
1081345167 11:41976602-41976624 TTAACCTGAAAAAGAAATTAAGG + Intergenic
1081943797 11:46969634-46969656 TGGAACTGATAAATAAATTGTGG + Intronic
1082165787 11:48948894-48948916 TGGACCCCAAAATAATATTAGGG - Intergenic
1082229244 11:49743582-49743604 TGGAGCTGAAAAACTTTTTAAGG + Intergenic
1086620838 11:88885558-88885580 TGGAGCTGAAAAACTTTTTAAGG - Intronic
1087318121 11:96628656-96628678 TGGACCTTGAAAACATATAAAGG + Intergenic
1088112274 11:106276499-106276521 TGGAACTAAAAAATTTACTAAGG - Intergenic
1088649788 11:111947377-111947399 TTGATTTGAACAATATATTAGGG - Intronic
1089051759 11:115551555-115551577 AGGATATGAAATATATATTATGG - Intergenic
1089513297 11:119014976-119014998 GGCACCTGAAAAAAAAATTAAGG - Exonic
1089888339 11:121853684-121853706 TGTAGATGAATAATATATTATGG + Intergenic
1090694905 11:129230111-129230133 AGCAGCTTAAAAATATATTAAGG - Intronic
1091482115 12:843895-843917 TGGAACTGAAAAAGACCTTAAGG - Intronic
1091872363 12:3904907-3904929 TTGAACTTAAAAATATATTCTGG - Intergenic
1092952223 12:13517039-13517061 TGTCCCTGAAAAATATCTGATGG - Intergenic
1093893456 12:24550957-24550979 TTGATCTGAAAAATATATTCAGG - Intergenic
1093925530 12:24904655-24904677 TGGACTGAAAAAATATATTTGGG - Intronic
1096237745 12:49941188-49941210 TGAACCTGAAAAACATTTTATGG - Intergenic
1097077878 12:56408642-56408664 TGGCCCTGAAAAATATAAAAAGG - Intergenic
1098650133 12:72954601-72954623 TACACCTGAGCAATATATTAAGG + Intergenic
1099011570 12:77297382-77297404 TGGAGCTGAAAAATATACTTGGG + Intergenic
1099115742 12:78621796-78621818 TGGACCTGAAATATTTCTTTTGG + Intergenic
1099194679 12:79601500-79601522 TGGCCCTGAAAGCTATTTTATGG + Intronic
1099327566 12:81238671-81238693 TGGACATTAAAAAGATAATAAGG - Intronic
1099807655 12:87540777-87540799 TTGCCATAAAAAATATATTATGG - Intergenic
1106316961 13:28602826-28602848 GGGACCTGAACAATATATCATGG - Intergenic
1106971734 13:35148662-35148684 TGGACAAGAAAACTATATTTAGG - Intronic
1107044216 13:35978023-35978045 TGTCCCTGAAAGAAATATTAAGG + Intronic
1107617703 13:42188255-42188277 TGGAGATGAAAAGTATATTGGGG + Intronic
1107729032 13:43329535-43329557 TGGAGCTGAAATATGGATTAGGG + Intronic
1107751644 13:43573737-43573759 TGGAGGTGAACAATATACTATGG - Intronic
1108039457 13:46325721-46325743 AGGCCCTAAAAAATAAATTATGG + Intergenic
1108976436 13:56449877-56449899 TGGAACAGAAAAAGATGTTAGGG - Intergenic
1109495399 13:63164300-63164322 TGGATTTGATATATATATTATGG + Intergenic
1110306110 13:73988336-73988358 TGGCTCTAATAAATATATTATGG + Intronic
1111525518 13:89463242-89463264 AGGTGCTGAAAAATATTTTAAGG + Intergenic
1111634598 13:90887803-90887825 GTGAACTGAAAAATATATTCTGG + Intergenic
1114154853 14:20089614-20089636 TGGACCAGAAAAAGAAAATATGG + Intergenic
1114701909 14:24687206-24687228 TGGACCTTAAAAACATTTTCGGG - Intergenic
1115339894 14:32282397-32282419 TGGACCTTGAAAATATGTTAGGG + Intergenic
1115483910 14:33890313-33890335 TTGACATCAAAAATATATTTGGG + Intergenic
1116124582 14:40766714-40766736 TGTAGATGAAAAATAAATTAAGG - Intergenic
1118737483 14:68712314-68712336 AGGCCCTGAAAAACATAATACGG - Intronic
1119733165 14:76964068-76964090 TGGACATGAGAGATATATTTAGG + Intergenic
1120074638 14:80141635-80141657 TGCACCTGAAAAATATATCCAGG + Intergenic
1120359142 14:83474603-83474625 TGTTCCTGAAAAATAATTTATGG + Intergenic
1120603448 14:86541621-86541643 AGGAACTGAAAAAAATATTAAGG - Intergenic
1120670980 14:87362310-87362332 TTGACCTGTTAAAAATATTATGG - Intergenic
1124057537 15:26255844-26255866 TGGAACAGAAAAAGATGTTAAGG - Intergenic
1125078487 15:35649313-35649335 TGGCCCTGAATGAGATATTAGGG - Intergenic
1127623223 15:60754489-60754511 TGGACATCAAAAAATTATTAGGG + Intronic
1128927123 15:71667730-71667752 TGAACATGCAAAAAATATTAGGG - Intronic
1128999639 15:72321247-72321269 GAGGCATGAAAAATATATTATGG - Intronic
1130086905 15:80785300-80785322 TGAACCTGAAAATGAAATTAAGG + Intronic
1130780943 15:87040391-87040413 TGGAATAGAAAAATATATTCAGG + Intergenic
1134131279 16:11651870-11651892 TGAACCATAAAAATATATTTAGG + Intergenic
1134584820 16:15400823-15400845 TGGACCTGAAACAGAAATTCTGG + Exonic
1136191710 16:28620075-28620097 TGGACCTGAAACAGAAATTCTGG - Exonic
1137957330 16:52845185-52845207 TGGTGCTGAAAAATAGAGTATGG - Intergenic
1137997522 16:53234853-53234875 TGGAACTTAACAATATATAAGGG - Intronic
1140080484 16:71742518-71742540 TGGGCCTCACAAATATCTTATGG + Intronic
1143277721 17:5724553-5724575 TGGGGCAGAAAAATATTTTAAGG + Intergenic
1143672759 17:8407843-8407865 TGTACCTTAAAAATATAATTAGG + Intergenic
1144430625 17:15188143-15188165 TGGACATTAAAAATGTATTGTGG - Intergenic
1147351597 17:39851519-39851541 TGGATCTCAAAAATCTATTGAGG + Intronic
1149625416 17:58076834-58076856 TGAACCTTGAAAATATACTAAGG + Intergenic
1150464341 17:65379286-65379308 TGGAGCTGAAAAGTGGATTAAGG - Intergenic
1150971027 17:70028799-70028821 TGGACTTAAACAATTTATTATGG - Intergenic
1151005118 17:70426683-70426705 AGGATCTGAAAAATATTTTCAGG - Intergenic
1151137370 17:71959802-71959824 AAGACCAGAAAAATATTTTAGGG + Intergenic
1152548461 17:81015955-81015977 TAGACATGAAAAAGATATTAAGG + Intergenic
1152934915 17:83130974-83130996 TGGCCATGAAAAAAATATTTCGG + Intergenic
1153325337 18:3812961-3812983 TGGACCTGAAAAATATATTACGG - Intronic
1153347620 18:4045061-4045083 TTGACCTGGAAAATAAATTTGGG - Intronic
1153351086 18:4081816-4081838 TGGACTTGAAGAATATACAATGG - Intronic
1153993279 18:10418780-10418802 TGGCCATGAACAATATATTCTGG + Intergenic
1155575078 18:27236092-27236114 TGAAATTGAAAAATATCTTAAGG - Intergenic
1155576035 18:27248023-27248045 TGGATCTGGAAAATATTTTGGGG - Intergenic
1156831470 18:41497271-41497293 TGGACTTTAAAAAAATATTCAGG + Intergenic
1157795086 18:50566319-50566341 TAGACCTGAAAGAGATTTTAGGG + Intronic
1158239841 18:55364858-55364880 TGCACATTAAAAATATATAAGGG + Intronic
1159908537 18:74121003-74121025 TAGACATGAAAAAGATAATAAGG + Intronic
1165082780 19:33319212-33319234 TGGAATTCAAAAATATATTCAGG + Intergenic
925035738 2:684149-684171 TGGACCTGACATATAAATTTGGG + Intergenic
926306135 2:11638495-11638517 TGTATCTGAAAAATAAATTCTGG - Intronic
928818618 2:35331406-35331428 TACACATAAAAAATATATTATGG + Intergenic
929089432 2:38200320-38200342 TTGAACTGAAAAATATCTCACGG + Intergenic
931169962 2:59792489-59792511 TGGAAATGAAGAATATTTTATGG - Intergenic
931427274 2:62182693-62182715 TGAAGCTGAATAATTTATTAAGG - Intergenic
932166366 2:69511308-69511330 AGGACTTGGAAAATTTATTAAGG + Intronic
932904939 2:75739131-75739153 TGGTCCTGAGAAATATCCTAGGG + Intergenic
933445289 2:82372139-82372161 TGGAACTGAAAGAAAGATTATGG - Intergenic
933855969 2:86414915-86414937 TGCACATGAAAAATATTTAAGGG + Intergenic
934100135 2:88644720-88644742 TGGACCTGATAAATATCTACAGG + Intergenic
934684301 2:96309346-96309368 TGAATCTCAAAAACATATTAAGG + Intergenic
936105401 2:109619624-109619646 TGATCCTGAAAAATATTTTATGG - Intergenic
936816307 2:116465092-116465114 TGTATCTGAAAAATATATCCTGG + Intergenic
937607065 2:123813548-123813570 TGGACTTGAAAAAGATAATGTGG + Intergenic
938608785 2:132924838-132924860 TTGACGTGAAAAAAATACTAAGG + Intronic
939298237 2:140297694-140297716 TGAACCTGAAAAATAGAGGATGG + Intronic
939625310 2:144469648-144469670 TGTACCTGAAAAAGTTATTTTGG + Intronic
940690320 2:156909777-156909799 TGGCACTGAAAAATAAATGATGG - Intergenic
941132348 2:161668618-161668640 TGAACCAGTAAAATATATTTTGG - Intronic
941143527 2:161815140-161815162 TGTACATTAAAAATATATTTAGG + Intronic
942577235 2:177376872-177376894 TGGACATGAAAATTACAGTAAGG + Intronic
942961071 2:181830167-181830189 TGGATCATAAAAATATTTTATGG - Intergenic
943748702 2:191488754-191488776 AGGAACTGTAAAATATATTAAGG - Intergenic
944006174 2:194909547-194909569 TGGATCTGAGAAAATTATTAGGG + Intergenic
944953363 2:204778479-204778501 TGTACCTGAAAAATAATTTCAGG + Intronic
945315652 2:208368285-208368307 TTGACATGAGAAATATGTTATGG - Intronic
945336264 2:208596138-208596160 TGCATCTCAAAAATGTATTAAGG + Intronic
945540179 2:211075710-211075732 TGGACTTGAAAAAGAATTTATGG + Intergenic
946959268 2:224966491-224966513 TTGACCTGAAAATTATATTCTGG - Intronic
947381001 2:229545262-229545284 TCCACCTGCAAAATATTTTAAGG + Intronic
1168859827 20:1038047-1038069 TGGAAGTGAACAAGATATTAAGG + Intergenic
1169930788 20:10830728-10830750 GGGACTGGATAAATATATTATGG + Intergenic
1170536997 20:17350222-17350244 CTGTCCTGAAAGATATATTAAGG - Intronic
1172475964 20:35237875-35237897 AGACCCTGAAAAATAGATTAGGG + Intronic
1174197161 20:48781610-48781632 TGGCCATGAAAAACAAATTAGGG - Intronic
1174770571 20:53296161-53296183 TAGATCTGAAAAATTTATGAAGG - Intronic
1177579456 21:23001157-23001179 TGGATTTGAAAAATAATTTAGGG - Intergenic
1177646994 21:23911807-23911829 TGCAACTGATAAATATATTTGGG + Intergenic
1177788600 21:25697594-25697616 TGGGCCTGAAAAAAATACTCAGG + Intronic
1180736317 22:18020301-18020323 TTAACCTGAAAGATATATTTTGG + Intronic
1180910284 22:19445187-19445209 TGGACCAAAAAAAGATATCAGGG - Intronic
1182399313 22:30062387-30062409 TGGACTTGAAGAACATATAATGG + Intergenic
1182479632 22:30598847-30598869 TAAACTTGAAAAATATATTTGGG - Intronic
1182934993 22:34212426-34212448 TGGACATTAAAAATATATAATGG - Intergenic
1183761877 22:39828073-39828095 TTGAACTGAACAATATATCATGG - Intronic
949708878 3:6851520-6851542 TAGAGCTGAAAAATACAATATGG - Intronic
951466143 3:23002430-23002452 TGGACTTGACACATATATTGTGG - Intergenic
952070426 3:29627865-29627887 GGGACCTGAAAGATACATAATGG - Intronic
957404813 3:79763825-79763847 TGGACATGAAAAAGATATCAAGG + Intronic
961241019 3:125411690-125411712 TAGACTAGAAAAATATATTTAGG + Intergenic
963166755 3:142212084-142212106 TGAATCTGAAAAATATAATTAGG - Intronic
964635764 3:158857326-158857348 TGGAAATGAAAAACATATTTAGG - Intergenic
964837906 3:160960018-160960040 TTAACCTCAACAATATATTATGG + Intronic
965931488 3:174048895-174048917 TGGCTCTCAAAACTATATTATGG + Intronic
971906570 4:32733330-32733352 TGGAACTGAAAAATGCATCATGG + Intergenic
973304802 4:48634184-48634206 TATACTTGAAAAAAATATTAAGG - Intronic
974618822 4:64328191-64328213 TTAACCTTAAGAATATATTATGG + Intronic
975035700 4:69677651-69677673 TGGATCTCTAAAATATACTATGG - Intergenic
975401820 4:73946838-73946860 TGGGGCTGAAAAATAAATTAAGG - Intergenic
975809193 4:78148224-78148246 TGGACCTGGAAAGTAGCTTAAGG + Intronic
976048251 4:80979002-80979024 TGGTACTGAATATTATATTATGG + Intergenic
976048412 4:80981269-80981291 TGGACCTGAAATATATCATTTGG + Intergenic
976900329 4:90167249-90167271 TGTAAATGAAAAATATATTTAGG - Intronic
977101752 4:92824954-92824976 TGGATATGAAAAATAAATTGTGG - Intronic
979583120 4:122383329-122383351 TGGAGCTTAAAAGTATATTAGGG + Intronic
980666445 4:135943350-135943372 TGGAACTGTAAAATTTATTTGGG + Intergenic
980672658 4:136029603-136029625 TGGACCTGAAAACTGAAGTAAGG - Intergenic
982336913 4:154250292-154250314 AGGAACTGCAAAATATATTTAGG - Intronic
982598921 4:157420960-157420982 GAGACCTGAAAAAAATATTCTGG + Intergenic
983617910 4:169728277-169728299 AGTACCTGAAATATATTTTAAGG + Intergenic
984003891 4:174284771-174284793 TGAAACTGCAAAAGATATTAGGG - Intronic
984055035 4:174917653-174917675 TGGAAATGAAAAAAAAATTAGGG + Intronic
985119129 4:186622317-186622339 TTGACCTGAAAAAGATAAGAAGG - Intronic
985286993 4:188345671-188345693 TCGATCTGAAAAAAAAATTAAGG + Intergenic
987256928 5:16164531-16164553 TGGATTTTAAAAATATAATATGG + Intronic
988838343 5:35056722-35056744 TGCACCTTAAAAATATAAGAGGG + Exonic
991203928 5:64027553-64027575 TGGACCTAAAAAATTTACCAAGG + Intergenic
992542272 5:77776623-77776645 GTGACCTAAAAAATGTATTAAGG + Intronic
992676924 5:79114317-79114339 TTGATCTGAAAGGTATATTAGGG + Intronic
993513888 5:88805481-88805503 TGAACCTGAGAAATATTTTGAGG - Intronic
993576360 5:89606401-89606423 TATACGTGAAATATATATTAGGG - Intergenic
993699219 5:91098482-91098504 TGGGCCTGAAGCTTATATTAGGG - Intronic
993783313 5:92097211-92097233 AGGAACAGAAAAATATATTTTGG + Intergenic
994101710 5:95900648-95900670 TAGACCTGACATAGATATTAGGG - Intronic
994306346 5:98209902-98209924 ATGTCCTGAAAAATATAATAGGG - Intergenic
995386484 5:111595422-111595444 TGGGCAAGAAAAATATGTTAAGG + Intergenic
996411958 5:123168114-123168136 TACACTTAAAAAATATATTATGG - Intronic
996783543 5:127214462-127214484 TGGCCTTGAAAAATAATTTATGG - Intergenic
996981215 5:129497557-129497579 TGGAGCTGAAACAGATTTTAGGG - Intronic
999764174 5:154725817-154725839 AAGACCTGAAATATTTATTAGGG - Intronic
1000388437 5:160698317-160698339 TGGATTTGAAAAATATTTAAAGG - Intronic
1000854003 5:166377732-166377754 TGGACCATAAAAATATAATTAGG + Intergenic
1000932520 5:167269178-167269200 CAGACCTGAAAGATATATTCAGG + Intergenic
1002369950 5:178743610-178743632 TGGCCTTGAAAAATAATTTATGG + Intergenic
1002994673 6:2271611-2271633 TGGACATGAAAAATATTATAAGG - Intergenic
1004739155 6:18440362-18440384 TTTACCTCAAAAATAGATTAGGG - Intronic
1004822424 6:19382007-19382029 TGGACATAAAAAATATATGTTGG - Intergenic
1005017584 6:21388894-21388916 GGCACCTGATAAATATATTTTGG - Intergenic
1005092110 6:22068385-22068407 TGGAACAGAAAAGGATATTAGGG - Intergenic
1006882975 6:37355077-37355099 TGCAAATGAAAAATATTTTAAGG + Intronic
1008022452 6:46595906-46595928 TCAACCTGAAAAATATATGTGGG + Intronic
1008026252 6:46639493-46639515 TGGACCTGAACAACTTAGTAAGG - Exonic
1008788541 6:55199821-55199843 AGGAAATGAAAAATATATAAGGG + Intronic
1008806287 6:55432917-55432939 TAAACCTTAAAAATCTATTAAGG + Intergenic
1009646018 6:66402810-66402832 GGAAACTGAACAATATATTAGGG - Intergenic
1010293281 6:74165137-74165159 TGAATCTGAAGAATACATTAAGG - Intergenic
1010839067 6:80626023-80626045 TGGACCTAATAAATATTTTATGG + Intergenic
1011586294 6:88929226-88929248 TGGACCTGACAAATACTTCAAGG - Exonic
1013833446 6:114302185-114302207 TGAGCCTAACAAATATATTAAGG - Intronic
1013872312 6:114780018-114780040 TGGATCAGAAAACTATATTCGGG - Intergenic
1013908796 6:115249611-115249633 TGGACCTGAAAAATATTTACAGG + Intergenic
1015110233 6:129584668-129584690 TGGATGTGAAAAACATTTTATGG + Intronic
1016225760 6:141734483-141734505 TGGAGCAGCAAAAGATATTAGGG + Intergenic
1017604211 6:156116181-156116203 TGGATTTGAAAAATAGTTTAAGG + Intergenic
1017952179 6:159144556-159144578 AAGACATGAAAAATATATAAAGG - Intergenic
1018113459 6:160559312-160559334 TGGAGCTCAAAAATATACTCAGG - Intronic
1018115544 6:160580161-160580183 CAAACCTCAAAAATATATTAAGG - Intronic
1018130640 6:160729589-160729611 TGGAACTCAAAAATATATTAAGG + Intronic
1018863362 6:167729334-167729356 TAGTGCTGAAAAATATTTTATGG - Intergenic
1018863372 6:167729465-167729487 TAGTGCTGAAAAATATTTTATGG - Intergenic
1021131231 7:16915138-16915160 TGTACCTCAAAAATATCTTCTGG - Intergenic
1021745100 7:23732306-23732328 TGCACTTAAAAAATATATTTAGG - Intronic
1022273790 7:28836615-28836637 TGGAAATGAACAATACATTAAGG + Intergenic
1023635601 7:42206777-42206799 AGAACCTAAAATATATATTAAGG + Intronic
1023893438 7:44411684-44411706 TGGATCTGTAAAATATAAAATGG + Intronic
1024268598 7:47625419-47625441 TGGACCTTAAAAATACATAAGGG - Intergenic
1024272522 7:47653496-47653518 TGGAAATAAAAAATAAATTATGG - Intergenic
1024379568 7:48680597-48680619 TAGACCTTGAAAATATATTTTGG - Intergenic
1025030757 7:55554789-55554811 TGGACCAGAAATATAGATTTTGG + Intronic
1025820135 7:64955270-64955292 TGGTCCTGGAAAATACATTTGGG - Intergenic
1028345282 7:89773014-89773036 TGCACCTGCAAAATACATAATGG + Intergenic
1028592213 7:92509623-92509645 TATACCTGTAAAATGTATTAAGG - Intronic
1031733061 7:125321803-125321825 TGGAATTGATAAAAATATTATGG + Intergenic
1033139444 7:138812234-138812256 TGGACTTGATAAATAAATTTAGG - Intronic
1033259127 7:139827053-139827075 TGGACTTGAAATATATTTTGGGG - Intronic
1033870757 7:145751381-145751403 TGACCCTGAAAAATATATAGAGG - Intergenic
1033885541 7:145940570-145940592 TAGAACTGAAAAATAAATTCAGG + Intergenic
1034029189 7:147741226-147741248 TGGACCTGAAGAATAGCTCAAGG - Intronic
1034763862 7:153699119-153699141 TGAATCTCAAAAATATTTTACGG - Intergenic
1034992312 7:155555530-155555552 TAGACCTGGAAAATATAATTTGG - Intergenic
1035916257 8:3627805-3627827 TTTAGCTGATAAATATATTAAGG + Intronic
1036597030 8:10222868-10222890 TGGACCTGAAGAATAAGTTCTGG + Intronic
1036960167 8:13236676-13236698 TGGTCCAAAAAAATAAATTAGGG + Intronic
1037192287 8:16141041-16141063 TGGTCCTGACACATATATAAAGG + Intronic
1037405540 8:18538737-18538759 TCCACCTGAAAAATACATGAAGG + Intronic
1038633746 8:29269074-29269096 TACACCTGAAAAATATGTAAGGG - Intergenic
1038736237 8:30172213-30172235 GGGACCTGTGAAATAAATTATGG + Intronic
1039257532 8:35735273-35735295 TGGACCAGAAAATTATTATATGG + Intronic
1039480346 8:37868468-37868490 TGGGACTGTAAAATATATGATGG + Intronic
1040568043 8:48583932-48583954 TGGAGCTGAAAAATGTGTTTAGG - Intergenic
1040903991 8:52446059-52446081 TGGAGCTGAAACATGTATTAAGG - Intronic
1040930059 8:52724761-52724783 TGAACTTTAAAAATATTTTATGG - Intronic
1041365451 8:57098393-57098415 TGGAAATGAGAAATAAATTAAGG - Intergenic
1042193503 8:66212046-66212068 TGACCCTGAAAAATGTTTTATGG + Intergenic
1042369092 8:67970448-67970470 AGGACCATAAAAATAGATTAGGG - Intronic
1043459571 8:80445968-80445990 TGGACTTAAAAATAATATTAGGG + Intergenic
1043571627 8:81610150-81610172 GGGACCTTAAAAATATAGTTTGG - Intergenic
1043622313 8:82210178-82210200 TGGATTAGAAAAATAAATTATGG + Intergenic
1043849676 8:85201919-85201941 TGGAACAGAAAAAGAAATTAAGG - Intronic
1046069057 8:109228357-109228379 TGGCCCTGAAAAGTAGATGAGGG + Intergenic
1046142409 8:110111216-110111238 GCCACCTGAAAAATATCTTATGG + Intergenic
1046172603 8:110530485-110530507 TGGAACTGAAAAATATGTTAAGG - Intergenic
1046666923 8:117014517-117014539 TAGATCTGAAAAATATAGGATGG + Intronic
1047098773 8:121653523-121653545 TGGATTTGAAAAATATTTAAAGG - Intergenic
1048554571 8:135461953-135461975 TGGAGGATAAAAATATATTAAGG + Intronic
1050833127 9:10039291-10039313 TTTACCTGACAAATAAATTATGG - Intronic
1050899005 9:10921023-10921045 TGGACCTAAAAAATTTAAGAGGG + Intergenic
1052040571 9:23734236-23734258 TGGATGTTTAAAATATATTAAGG + Intronic
1052890137 9:33691463-33691485 TTAACCTCAAAAATATATTTAGG - Intergenic
1052994608 9:34544922-34544944 TGGAACTTAAAATGATATTAAGG - Intergenic
1054998229 9:71417990-71418012 AGGACATGAAAAATATAAAAAGG + Intronic
1056062231 9:82895656-82895678 TGGACCTGAACAATCTATATAGG - Intergenic
1057404401 9:94755881-94755903 TGGAGCTGAAAAATTCCTTAGGG - Intronic
1058263588 9:102870115-102870137 TGTACCTGAAACATGTATTTAGG + Intergenic
1059871283 9:118580858-118580880 TTGATCTAAAAAATACATTAAGG + Intergenic
1060539065 9:124417084-124417106 TGGACCTTAAAAATATACTGAGG + Intergenic
1061110586 9:128567079-128567101 TGGACAAGAAGAATATAATAAGG + Intronic
1061526331 9:131166987-131167009 TGAACCTGCAAACTGTATTATGG - Intronic
1186824522 X:13326039-13326061 TGGATCTGAAAAACACATTGTGG - Intergenic
1187570798 X:20499195-20499217 TGGATCTGAAAGCTATATCAAGG + Intergenic
1187653783 X:21445150-21445172 GTGACCTGAAAATTATATTGGGG + Intronic
1188220445 X:27534800-27534822 TGGACTTGAAATATAAATTTGGG - Intergenic
1188469586 X:30523096-30523118 TGAACCTATATAATATATTATGG + Intergenic
1189142926 X:38625561-38625583 TGAACAAGAAAAATATGTTAAGG + Intronic
1189292904 X:39898277-39898299 TGAAGGTGAAAAGTATATTAGGG - Intergenic
1189352339 X:40285262-40285284 TGGCCCAGAGAAATATATTTTGG + Intergenic
1189784143 X:44543988-44544010 TGGGCCTGACAAAAAAATTATGG - Intergenic
1189865758 X:45325373-45325395 TGGCCCTGTGAAGTATATTATGG + Intergenic
1190994427 X:55592605-55592627 TAGAACTGAAAAGTATAGTAAGG + Intergenic
1192030082 X:67501241-67501263 GAAACCTGATAAATATATTAAGG + Intergenic
1192845339 X:74901522-74901544 TGGAACTGAAAGATGTATAATGG - Intronic
1194103788 X:89742237-89742259 TTGACATGAAAGATATATTATGG + Intergenic
1194651011 X:96514431-96514453 TAGACCTGTGAAATAGATTAGGG + Intergenic
1195814737 X:108872656-108872678 TGAACATGAAAAATATGTAAAGG + Intergenic
1197043978 X:121974221-121974243 TGGCCCTGAAAAATGTGTTTGGG - Intergenic
1197099812 X:122639047-122639069 TGGACATGATAAATTAATTATGG - Intergenic
1198124691 X:133630884-133630906 GGGACTAGCAAAATATATTAAGG - Intronic
1198448359 X:136740847-136740869 TGAACCTGGAAAATCTTTTAGGG + Intronic
1198982848 X:142419004-142419026 TTAACCTGAAAAATTTATTCAGG + Intergenic
1199167052 X:144689369-144689391 TGCTCCTGAAGAATATTTTATGG - Intergenic
1199480362 X:148291777-148291799 TTGACCTGATAAATGAATTATGG + Intergenic