ID: 1153325525

View in Genome Browser
Species Human (GRCh38)
Location 18:3815400-3815422
Sequence GTGTGTGCACGGGTGTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 762
Summary {0: 1, 1: 3, 2: 17, 3: 101, 4: 640}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153325525_1153325529 20 Left 1153325525 18:3815400-3815422 CCTCTGCACACCCGTGCACACAC 0: 1
1: 3
2: 17
3: 101
4: 640
Right 1153325529 18:3815443-3815465 TTTGCAAGTTTCTCCCCTTTTGG 0: 1
1: 0
2: 1
3: 35
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153325525 Original CRISPR GTGTGTGCACGGGTGTGCAG AGG (reversed) Intronic
900137372 1:1123535-1123557 GTGTGTGCAGGAGTGTGCGCAGG - Intergenic
900137385 1:1123691-1123713 GTGTGTGTAGGTGTGTGCACAGG - Intergenic
900137404 1:1123861-1123883 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137409 1:1123918-1123940 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900137411 1:1123940-1123962 GTGTGTGCAGGTGTGTGCGCAGG - Intergenic
900137421 1:1124052-1124074 GTGTGCGCAGGTGTGTGCACAGG - Intergenic
900137425 1:1124102-1124124 GTGTGCGCAGGTGTGTGCACAGG - Intergenic
900137428 1:1124138-1124160 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137437 1:1124188-1124210 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900187884 1:1341044-1341066 AGGTGTGCATGTGTGTGCAGGGG - Intronic
900215478 1:1479381-1479403 GTGTGTGCCCATGTGTGCAGGGG - Intronic
900215483 1:1479407-1479429 GTGTGGGCCCGTGTGTGCAGGGG - Intronic
900222743 1:1518080-1518102 GTGTGGGCCCGTGTGTGCAGGGG - Intronic
900222916 1:1518829-1518851 GACTGTGCCCGAGTGTGCAGGGG - Intronic
900295253 1:1945861-1945883 GTGTGTGCACGTGTGTGTGTGGG + Intronic
900295258 1:1945927-1945949 ATGTGTGCACGTGTGTGTGGGGG + Intronic
900353221 1:2247255-2247277 GTGTGTGCACAGGTGTGCATGGG + Intronic
900358736 1:2277689-2277711 GTGTGTGCACGTGTGCCCATGGG - Intronic
900358745 1:2277760-2277782 GTGTGTGCACGTGTGCCCATGGG - Intronic
900358952 1:2278806-2278828 CTGTGTGCACGTGTGCGCATGGG - Intronic
900380734 1:2382553-2382575 GGGTGTGCTCGGGTGGGAAGGGG + Intronic
900384115 1:2401519-2401541 GTGTCTGCACGGGTAGGCAGAGG + Intronic
900392021 1:2437834-2437856 GTGTGTGCACGTGTGTGGTTTGG - Intronic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
900480622 1:2896898-2896920 ATGTGTGCATGGGTGTGCATGGG - Intergenic
900489176 1:2937957-2937979 GTGTGTGTACATGTGTGCATGGG - Intergenic
900544629 1:3221704-3221726 GTGTGTGCATGCGTGTACATGGG - Intronic
900593542 1:3470234-3470256 GTGTATGCATGGGTGTGTGGGGG + Intronic
900818955 1:4871568-4871590 GTGTGTGCATGTGTGTGTACAGG - Intergenic
900850243 1:5137002-5137024 GTGAGTGCAAGAGTGTGCATGGG - Intergenic
900953658 1:5873791-5873813 AGGTGTGCACTTGTGTGCAGGGG - Intronic
901041825 1:6368642-6368664 CTGTGGGGAGGGGTGTGCAGAGG - Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
902489584 1:16771477-16771499 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
902538310 1:17134643-17134665 GTGTGTGGGCGTGTGTGCACAGG - Intergenic
902538333 1:17134762-17134784 GTGTGTGCACAGGTGTTGTGTGG - Intergenic
903283929 1:22265614-22265636 AAGTGTGCATGTGTGTGCAGGGG - Intergenic
903733899 1:25517751-25517773 CTGTGTGCACGGATTGGCAGTGG + Intergenic
903986803 1:27234729-27234751 GTGTGAGCGCGGGTGTGAGGCGG + Exonic
904172415 1:28600576-28600598 GTGTGTGTGTGTGTGTGCAGTGG + Intronic
904470390 1:30732260-30732282 GTGTGTGGAGGGGTGTGGGGAGG + Intergenic
905347270 1:37319536-37319558 GTGTGTGCGCGTGTGTGCCTGGG + Intergenic
905789591 1:40783208-40783230 GTGTGTGGCTGGGTGGGCAGCGG - Intergenic
905938168 1:41841172-41841194 GTGTGTGGGCAGGTGTGCTGGGG - Intronic
907298618 1:53471256-53471278 GTGTGGACAAGGGTGTGCAGAGG + Intergenic
907387867 1:54137699-54137721 GTGTGTGCATGCGGGGGCAGGGG + Intronic
908042464 1:60129302-60129324 TTGTGTGCAGTGGTGAGCAGGGG + Intergenic
909318311 1:74251665-74251687 GTGTGTGCACGTGTGGGAGGAGG + Intronic
910063445 1:83122096-83122118 GTGCGCGCATGCGTGTGCAGTGG + Intergenic
910437325 1:87218539-87218561 GTGTGTACACGTGTGTGCACGGG - Intergenic
913360631 1:117976519-117976541 GTGTGTGCCAGGCTGAGCAGAGG + Intronic
913591779 1:120336007-120336029 GTGTGTGCAGGGGTGAGGAGGGG - Intergenic
913651577 1:120919139-120919161 GTGTGTGCAGGGGTGAGGAGGGG + Intergenic
914169532 1:145209931-145209953 GTGTGTGCAGGGGTGAGGAGGGG - Intergenic
914240989 1:145852976-145852998 GTATGTGCATGTGTGTGGAGGGG - Intronic
914524644 1:148453893-148453915 GTGTGTGCAGGGGTGAGGAGGGG - Intergenic
914599026 1:149181940-149181962 GTGTGTGCAGGGGTGAGGAGGGG + Intergenic
914641756 1:149613242-149613264 GTGTGTGCAGGGGTGAGGAGGGG + Intergenic
915319403 1:155047955-155047977 GTGTGTGTGCAGGTGTGTAGGGG - Intronic
916352810 1:163871066-163871088 GTGTGTGAATGTGTGTGCATAGG + Intergenic
916443348 1:164848832-164848854 GTGTGTGCTCAGGGGAGCAGGGG + Exonic
916693329 1:167212146-167212168 GTGTGTGTACCTGTGTGTAGAGG + Intergenic
917930152 1:179817343-179817365 GTGTGTGCAGGGTTGGGAAGAGG - Intergenic
919685418 1:200479533-200479555 GTGTGTGTCAGTGTGTGCAGAGG - Intergenic
919770031 1:201152211-201152233 GTGTGTGCACCTCTGTCCAGTGG + Intronic
920047608 1:203143551-203143573 GTGTGTGTTTGTGTGTGCAGGGG + Intronic
920668118 1:207981525-207981547 GTGTGTGCATGTGTGTGTAGAGG + Intergenic
920692271 1:208155797-208155819 GGGTGTGGTGGGGTGTGCAGGGG + Intronic
920710201 1:208287602-208287624 GTGTGTGCACATGTCTGCACAGG - Intergenic
921644211 1:217594789-217594811 GTGTGTGCACATGTGTGTAAAGG + Intronic
921922724 1:220686929-220686951 GGGTGTGTACCTGTGTGCAGTGG - Intergenic
922648720 1:227318511-227318533 GTGTGCGCGCGCGTGTGCCGGGG - Intergenic
922765839 1:228156371-228156393 GTGTATGCATGTGTGTGCATGGG + Intronic
922852405 1:228744746-228744768 CTGTGTGCATGAGTGTGCATGGG - Exonic
923480357 1:234377795-234377817 GTGCGTGCATGGGTCTGCAGAGG + Intronic
923530853 1:234811048-234811070 GTGTGTGTGTGTGTGTGCAGGGG + Intergenic
1062794875 10:337204-337226 GTGTGTGCAAGTGTGTGTGGTGG + Intronic
1062934519 10:1375885-1375907 GTATGTGCACGTGTGTGGTGTGG - Intronic
1063159630 10:3409825-3409847 GTGTGTGCACAGGTGTGCACAGG - Intergenic
1063541645 10:6940017-6940039 GTGTGTGCGCGTGTGTGTAAGGG - Intergenic
1064283424 10:13971061-13971083 GTGTGTGCACCTGTGTGTTGGGG - Intronic
1065196918 10:23275574-23275596 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1069304075 10:66946760-66946782 GTGTGTGCCTGGGTGTGGTGGGG - Intronic
1069653691 10:70071087-70071109 GTGTGTGTGCGCGTGTGCACAGG + Intronic
1069653693 10:70071089-70071111 GTGTGTGCGCGTGTGCACAGGGG + Intronic
1069867723 10:71514041-71514063 GTGTGTGCATGGGTGTGTGTGGG - Intronic
1070610657 10:77930104-77930126 GTGTGAGTGCGTGTGTGCAGGGG - Intergenic
1070647486 10:78211810-78211832 GTGTGTGTACGTGTGTGATGAGG + Intergenic
1070968677 10:80545698-80545720 GGGTGTGCATGGGTGAGTAGCGG + Intronic
1071213093 10:83367025-83367047 GTGTGTGAAACGGTGTGCATTGG + Intergenic
1071513789 10:86283548-86283570 GTGTGTGCATGTGTGTGTAAGGG - Intronic
1071526874 10:86364294-86364316 CTGTGTGCACGTGTGCGCTGAGG - Intronic
1072758457 10:98036582-98036604 GTGTGTGCATGTGTGAGGAGGGG + Intergenic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1073073199 10:100807679-100807701 GTGTGGGAGCGGGTGTGCTGGGG - Intronic
1073486222 10:103820632-103820654 GTGTGAGCAAGGGTGTGGGGAGG - Intronic
1073488413 10:103836639-103836661 GTGTGTGCACTCGTGTGTTGGGG - Intronic
1074267587 10:111920225-111920247 GTGTGTGCATGTGTGTGGATGGG - Intergenic
1074707501 10:116148112-116148134 GTGTGTGCATGTGTGTGGGGTGG + Intronic
1075371128 10:121936014-121936036 GTATGTGCAAGGGAGTGAAGGGG - Intergenic
1075508102 10:123043931-123043953 GTGTGTGCATGTGTGTACACAGG - Intronic
1075551957 10:123399610-123399632 GTGTGTGGTCGGGTCAGCAGTGG - Intergenic
1075831530 10:125416069-125416091 GTGTGTGCACACGTGTGTATGGG - Intergenic
1076042450 10:127262278-127262300 GTGTGTGTACCTGTGTGCTGAGG + Intronic
1076238912 10:128887443-128887465 GTGTGGGCACAGGTGTGGATTGG - Intergenic
1076759752 10:132597097-132597119 GTGTTTGCATGTGTGTGCATGGG + Intronic
1076858835 10:133130128-133130150 GAGTGGGCAGAGGTGTGCAGGGG - Exonic
1077091289 11:779501-779523 GTGTGTGCACCTGTGTCCACAGG + Intronic
1077135706 11:997268-997290 GCGTGTCCCCGGGTGTGCTGGGG + Intronic
1077144588 11:1039249-1039271 GTGTGTGCATGTGTGTGTATAGG + Intergenic
1077219421 11:1408980-1409002 GTGTGTGTATGTCTGTGCAGGGG + Intronic
1077223777 11:1429016-1429038 GTGTGTACACGGGTGTGTCCTGG + Intronic
1077281025 11:1745821-1745843 GTGTGTGCACGGGTGTGTGAGGG - Intronic
1077340392 11:2023844-2023866 GTGTGTGTACAGGTGTGGGGAGG + Intergenic
1077529236 11:3087517-3087539 GTGGGTGCAGGTGTGTGCAGGGG - Exonic
1077630643 11:3808846-3808868 GCGTGGGGCCGGGTGTGCAGGGG + Intronic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1078738057 11:14039422-14039444 GTGTGTGTATGTGTGTGTAGGGG + Intronic
1080170718 11:29298935-29298957 GTGTGTGCACAGGTATGTGGGGG + Intergenic
1080333766 11:31173723-31173745 GTGTGTGTAAGTGTGTGAAGAGG - Intronic
1080884201 11:36350335-36350357 GTGTATGCATGTGTGTGCCGGGG + Intronic
1081644442 11:44779830-44779852 ATGTGTGCATGTGTGTGCATAGG - Intronic
1081644459 11:44779974-44779996 GTGTGTGCAGGTATGTGCAAAGG - Intronic
1081707259 11:45190118-45190140 GTGTGTGCACGTGTGTGTGTAGG - Intronic
1081804140 11:45881027-45881049 GTGTGTGTGCGCGTGTGCAGAGG + Exonic
1081994980 11:47358558-47358580 GTGTGTGAGCAAGTGTGCAGAGG - Intronic
1082969793 11:59007794-59007816 GTGTGTGCACGTGTGTCCCCAGG + Intronic
1083344732 11:61981395-61981417 GTGTTTGCCCTGATGTGCAGTGG - Intergenic
1083898988 11:65634642-65634664 GTGAGTGCTCGGGTGTCCCGCGG + Intronic
1083932139 11:65851865-65851887 GTGTGTGTTGGGGGGTGCAGGGG + Intronic
1084477935 11:69399388-69399410 ATGTGTGCATGTGTGTGTAGGGG + Intergenic
1084484160 11:69438364-69438386 GTGAGGGCACGGGATTGCAGTGG + Intergenic
1084925860 11:72510810-72510832 GTGTGTGGACTGATGTGCATTGG + Intergenic
1085738149 11:79057247-79057269 GTGTGTGCAGGCCAGTGCAGGGG - Intronic
1085781226 11:79410942-79410964 GTGTGTGTATGTGTGTGTAGAGG - Intronic
1086146595 11:83559246-83559268 GGGTTTGCTTGGGTGTGCAGGGG + Intronic
1086911357 11:92476091-92476113 GTGTATACAAGTGTGTGCAGGGG + Intronic
1086917534 11:92547884-92547906 ATGTGTGGAGGGCTGTGCAGAGG + Intronic
1086924731 11:92627887-92627909 GAGTGAGCAAGGCTGTGCAGAGG + Intronic
1086924818 11:92628858-92628880 GTGCATGCACGTGTGTGCACAGG + Intronic
1087161471 11:94951849-94951871 GTATGTGCATGTATGTGCAGGGG + Intergenic
1088214553 11:107493341-107493363 GTGTGTGTATGTGTGTGCAGAGG - Intergenic
1088566672 11:111179952-111179974 GTGTGTGTACATGCGTGCAGTGG + Intergenic
1088901257 11:114119378-114119400 GTGTGTGCACATGTGTGTACAGG + Intronic
1088911919 11:114198643-114198665 GTGTGAGGACGGGGGTACAGTGG - Intronic
1088990586 11:114950142-114950164 GTGTGTGTGTGTGTGTGCAGGGG + Intergenic
1089281940 11:117380877-117380899 GTGTGTGCACGTGTGTGTACTGG + Intronic
1089398477 11:118151107-118151129 GTGTGTGCACGTGTGTAAGGGGG - Intronic
1089560906 11:119342669-119342691 GAGGGTGTAAGGGTGTGCAGTGG - Exonic
1089610030 11:119663958-119663980 GTGTGTGCACGTGTCAGCAGAGG + Exonic
1089611696 11:119672869-119672891 GAGTCTGCGCAGGTGTGCAGTGG + Intronic
1089632253 11:119791196-119791218 GTGTGTGCACATGTGGGCAGGGG + Intergenic
1090482588 11:127081278-127081300 GTGTGTGTGCGTGTGTGCACAGG + Intergenic
1091119397 11:133044193-133044215 GGGTGTGGATGGGTGTGCATGGG + Intronic
1091225154 11:133952522-133952544 TTGTGTGCACGTGCGTGGAGTGG - Intronic
1202823377 11_KI270721v1_random:79033-79055 GTGTGTGTACAGGTGTGGGGAGG + Intergenic
1091625547 12:2118252-2118274 GTGTGTGCACGGGTCTGGTTTGG + Intronic
1091670332 12:2447800-2447822 GTGTGTGCATGTGGGAGCAGTGG - Intronic
1091681212 12:2528492-2528514 GGGTGTGCACAAGTGTGCAGAGG - Intronic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1092009398 12:5097081-5097103 CTCTGTGGATGGGTGTGCAGTGG - Intergenic
1092239359 12:6827885-6827907 GTGTGTGTGGGGGAGTGCAGGGG + Intronic
1092312563 12:7374394-7374416 GTGTGTGCACGTGTGTGTAGAGG + Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1094738664 12:33263630-33263652 GTGTGTGCATGTGTTTTCAGTGG + Intergenic
1096039661 12:48502458-48502480 CTTTATGCATGGGTGTGCAGTGG + Intergenic
1096242677 12:49967674-49967696 GTGTGTGCGCGCGTGTGCACGGG - Intronic
1097661517 12:62435956-62435978 GTGCCTGCAGCGGTGTGCAGAGG - Intergenic
1098614830 12:72509265-72509287 GTGTGTGCGGGGGGGTGCGGTGG - Intronic
1098636252 12:72787434-72787456 GTGTGTGTGCACGTGTGCAGAGG + Intergenic
1098919180 12:76287244-76287266 GTGTGTGCGTGTGTGTGCAGAGG + Intergenic
1099145286 12:79035753-79035775 GAGTCTGCAGGGGTGAGCAGGGG - Intronic
1101672424 12:106888518-106888540 GTGTGGGCCCAGGTGTGCTGTGG - Intronic
1101724952 12:107381317-107381339 GTGTGTTCACCTGTCTGCAGAGG - Intronic
1102258295 12:111428701-111428723 GGGTGTGCCTGGGTCTGCAGGGG + Intronic
1102281835 12:111624622-111624644 GTGTCTTCTCGGGGGTGCAGGGG + Intergenic
1102419412 12:112792064-112792086 GTGTGTCTACGTGTGTGCACTGG + Intronic
1102422365 12:112814078-112814100 GAGTGTGCACGAGTGTGTAGGGG + Intronic
1102695847 12:114798799-114798821 GTGTGTGCACGTGTGTGTAAGGG + Intergenic
1102743610 12:115230520-115230542 GTGTCTGCGCGTGTGTGCAAGGG - Intergenic
1102749484 12:115279936-115279958 GTGTGTGCATGGGTCTTGAGGGG - Intergenic
1103910771 12:124350835-124350857 GTGTGGACACGCGTGTGCATCGG - Intronic
1104112955 12:125721228-125721250 CTGTGTGTACGTGTGTGCATAGG + Intergenic
1104124096 12:125828794-125828816 GTGTGTGTATGTGTGTGCATGGG + Intergenic
1104807630 12:131599628-131599650 GTGTGTGTATGTGTGTGCACAGG - Intergenic
1104894630 12:132156749-132156771 GTGTATGCAGTGGTGTGTAGTGG - Intergenic
1104894665 12:132157459-132157481 GTGTGTGTAGTGGTGTGTAGTGG - Intergenic
1104894668 12:132157506-132157528 GTGTGTGTAGTGGTGTGTAGTGG - Intergenic
1104903857 12:132203371-132203393 GTGTGTTGACAGGTGTGCACAGG - Intronic
1104916545 12:132268264-132268286 GTGTGTGCGTGCGTGTGTAGGGG - Intronic
1104929610 12:132331265-132331287 GTGTATGCACATGTGTGTAGGGG + Intergenic
1105014763 12:132779726-132779748 GTGTGCGCACGTGTGTGCCTGGG - Intronic
1105014807 12:132779996-132780018 GTGTGCGCACGTGTGTGCCTGGG - Intronic
1105024613 12:132839715-132839737 GAGTTTGCACGTTTGTGCAGGGG - Intronic
1106076888 13:26468129-26468151 CTCTGTGCAGGGCTGTGCAGGGG - Intergenic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1106333601 13:28763052-28763074 GCATGTGCACGTGTGTGTAGGGG + Intergenic
1106430851 13:29679069-29679091 GTGTGTGTATGTGTGTGGAGAGG + Intergenic
1106486070 13:30173881-30173903 GTGTGTGCACATGTGTGTGGGGG - Intergenic
1106897195 13:34316454-34316476 GTGTGTGCACGTGTGGCAAGGGG + Intergenic
1107625572 13:42279242-42279264 GGGTGTGCACGTGCGTGCACTGG - Intronic
1107842032 13:44467987-44468009 GTGTGTGCGCGTGTGTGTATAGG - Intronic
1108104687 13:46996484-46996506 GTGTGTGCACCCATGTGCAGAGG + Intergenic
1108537457 13:51399724-51399746 GTGTGTGTGCGTGTGTGTAGTGG + Intronic
1109521194 13:63512271-63512293 GTGTGAGCAAGTGAGTGCAGGGG - Intergenic
1111739819 13:92189574-92189596 GTGTGTGCACGTGTATGGAAAGG - Intronic
1112439329 13:99414440-99414462 GTGTGTGCACGTGTGTGAGTGGG - Intergenic
1113459941 13:110474939-110474961 GTGTGTGATCGTGTGTGCACAGG - Intronic
1113466433 13:110516740-110516762 GTGTGTGTGCAGCTGTGCAGTGG + Intergenic
1113483057 13:110635673-110635695 GTGTGAACACGGGTGTGCACGGG - Intronic
1113613810 13:111666543-111666565 GTATGTGCATGTGTGTGCATTGG + Intronic
1113870551 13:113557075-113557097 GTGTGTGTACAGTTGTGCATGGG + Intergenic
1113870563 13:113557184-113557206 GTGTGTGCACATGTGTGTAGGGG + Intergenic
1113870567 13:113557260-113557282 GTGTGTGCACAGGTGTGTCCAGG + Intergenic
1113893854 13:113751273-113751295 GTGTGTGCGTGTGTGTGCATGGG + Intergenic
1113893857 13:113751314-113751336 GTGAGTGCATGTGTGTGCATGGG + Intergenic
1114658503 14:24330302-24330324 GTGTGTATGTGGGTGTGCAGAGG + Intronic
1115056120 14:29129272-29129294 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
1115413290 14:33101134-33101156 GTGTGTGCAGGTGTGTGTGGGGG - Intronic
1116359100 14:43970718-43970740 TGGTGTGCAGTGGTGTGCAGTGG + Intergenic
1118303953 14:64639052-64639074 CTGTGTGCTGGGGAGTGCAGGGG + Intergenic
1118438117 14:65789741-65789763 CGCTGTGCACGGGAGTGCAGAGG + Intergenic
1119137171 14:72231785-72231807 GTGTGTGCAAAGGTGCTCAGAGG + Intronic
1119282378 14:73420463-73420485 GTGTGTGCATGTGTGTGTATAGG + Intronic
1119695932 14:76713477-76713499 GTGTGTGCACGGATGTGTGCTGG - Intergenic
1119778698 14:77264264-77264286 GTGTGTGCATGGGCATGCACTGG - Intergenic
1121626187 14:95387091-95387113 GTGTGTGCAGAGGGGAGCAGAGG - Intergenic
1121626192 14:95387118-95387140 GTGTGTGCAGAGGGGAGCAGAGG - Intergenic
1121626199 14:95387145-95387167 GTGTGTGCAGAGGGGAGCAGAGG - Intergenic
1122020710 14:98835753-98835775 GTGTGAGCATGAGTGTGTAGGGG - Intergenic
1122544375 14:102514127-102514149 GTGTGTGCATGCGTGTGCGTGGG + Intergenic
1122919069 14:104872395-104872417 GGGTGTGCGTGGGTGTGCCGTGG + Intronic
1123007874 14:105333146-105333168 GTGTGTGCACACGCGTGCATGGG - Intronic
1123054746 14:105563989-105564011 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123079186 14:105683548-105683570 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1124635103 15:31360252-31360274 GTGTGGGCACGGACATGCAGCGG + Intronic
1124674730 15:31674484-31674506 GTAGGTGCAAGGGTATGCAGTGG - Intronic
1124869277 15:33524115-33524137 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127638223 15:60891310-60891332 GTGTGTGTGCATGTGTGCAGTGG + Intronic
1127920622 15:63491617-63491639 GTGTGGGGAGGGGTGGGCAGAGG - Intergenic
1128372480 15:67050496-67050518 GTGTGTGCACGGGTGCACATGGG - Intergenic
1128767424 15:70259697-70259719 GTGTGTGCCCGCATGTGCACGGG + Intergenic
1128809302 15:70559136-70559158 GTGTGTGCTGTGGTGTGCATGGG - Intergenic
1128999545 15:72320472-72320494 GTGTGTGCCTGTGTGTGCGGTGG - Exonic
1129674148 15:77623271-77623293 GTGAGAGCAAAGGTGTGCAGGGG + Intronic
1129687151 15:77693061-77693083 GTGTGTGCACGCGTGCACATGGG - Intronic
1129707784 15:77804621-77804643 GTGTGTGCAAGGATGTGCAGGGG + Intronic
1131346147 15:91650321-91650343 GTGTGTGCACACATGTGCATGGG - Intergenic
1131822335 15:96285786-96285808 GTTTGAGCAAGGGTGTGAAGCGG - Intergenic
1132124657 15:99212286-99212308 GTGTGTGCATGCATGTGCAATGG + Intronic
1132261971 15:100433708-100433730 GTGTGTGCACATGTGTGCATGGG - Intronic
1132353304 15:101154015-101154037 GTGGGTGCAGGGGTGTGTGGGGG - Intergenic
1132541892 16:514022-514044 CTGTGTGCTCTGGTGTGGAGGGG + Intronic
1132565127 16:618720-618742 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565178 16:619082-619104 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565198 16:619207-619229 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132619476 16:857735-857757 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132619606 16:858339-858361 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132619641 16:858502-858524 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132619646 16:858526-858548 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132619661 16:858596-858618 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132619666 16:858620-858642 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132619721 16:858875-858897 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132619726 16:858899-858921 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132619786 16:859206-859228 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132619815 16:859348-859370 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132619864 16:859584-859606 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132619869 16:859608-859630 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132619879 16:859655-859677 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132619884 16:859679-859701 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132619889 16:859703-859725 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132619894 16:859727-859749 GTCTCGGGACGGGTGTGCAGTGG + Intronic
1132692183 16:1186561-1186583 GTGTGTGGGCACGTGTGCAGAGG - Intronic
1132701329 16:1223400-1223422 GTGAGTGTCCGGGTGGGCAGGGG - Intronic
1132976074 16:2711791-2711813 GTGTGTGCACGGGTGCGTGTGGG + Intergenic
1133048273 16:3101231-3101253 TTGTCTGCCAGGGTGTGCAGGGG + Intergenic
1134203658 16:12219915-12219937 GTGTGTACACGTGTGTGCGCTGG - Intronic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1135161671 16:20102051-20102073 GTGTCTGTCTGGGTGTGCAGAGG + Intergenic
1135165403 16:20134640-20134662 GTGTGTGTATGTGTGTACAGGGG + Intergenic
1136294818 16:29295535-29295557 GTGTGTGCAGGGGTCTTAAGAGG - Intergenic
1136377515 16:29874038-29874060 GTGTGTGCAGAGGTGTTCAGAGG - Intronic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1136938142 16:34495260-34495282 GTGTGTGTGTGTGTGTGCAGAGG + Intergenic
1136961672 16:34853297-34853319 GTGTGTGTGTGTGTGTGCAGAGG - Intergenic
1137365478 16:47855895-47855917 GTGTGTGTGCGCGTGTTCAGAGG + Intergenic
1137400190 16:48146966-48146988 GTGTGTGCATGTGTGTGCGTGGG - Intronic
1137849515 16:51725241-51725263 GTGTGTGTGTGTGTGTGCAGTGG - Intergenic
1138271569 16:55699542-55699564 GTGTGTGCACAGGAGTGGACAGG + Exonic
1138340534 16:56286189-56286211 GTGTGTGCAGATGTGTGTAGCGG - Intronic
1138522376 16:57578224-57578246 GTGTGTGCATGTGTGTGTATGGG + Intronic
1138708858 16:58946180-58946202 GTGTGTGCGTGTGTGTGCATGGG + Intergenic
1139429215 16:66902095-66902117 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
1139504513 16:67392329-67392351 GTGTGGCCAGGGGTCTGCAGCGG - Intronic
1139968785 16:70761013-70761035 GTGTGTGCATGGGGGGGCGGGGG + Intronic
1140529883 16:75655976-75655998 GTGTGTGCACGTGTGTGTGAGGG - Intronic
1141567511 16:84913057-84913079 GTGTGTGTGTGTGTGTGCAGTGG + Intronic
1141928870 16:87187164-87187186 ATGTGTGCATGTGTGTGGAGGGG + Intronic
1141928981 16:87188206-87188228 ATGTGTGCACGTGTGAGTAGGGG + Intronic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1141983690 16:87565849-87565871 GTGTGTGCGTGTGTGTGTAGGGG + Intergenic
1142100709 16:88269546-88269568 GTGTGTGCAGGGGTCTTAAGAGG - Intergenic
1142255109 16:89010087-89010109 GTGTGTGCAGGCTTGTGCATGGG - Intergenic
1142260021 16:89038325-89038347 GTCTGTGCACGGCTGGCCAGAGG + Intergenic
1142363631 16:89638687-89638709 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
1142477421 17:197693-197715 GTGTGTACATGTGTGTGTAGTGG + Intergenic
1142561604 17:812573-812595 GTGTGTGCACGTGTGTGTGATGG + Intronic
1142562020 17:815855-815877 GTGTGTGCACGTGTGTGCACAGG - Intronic
1143157150 17:4845070-4845092 GTGTGTGCAGAGTTGAGCAGAGG + Intronic
1143601216 17:7947526-7947548 GTGGGTGCAAGTGTGTTCAGGGG - Intronic
1144755289 17:17676497-17676519 GTGTGTGTCGGGGTGTGCTGAGG + Intergenic
1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG + Intronic
1145322912 17:21776925-21776947 ATGTGTGCACGCGTGTTCACAGG + Intergenic
1146467136 17:33095284-33095306 GTGAGTGCAAAGGTGGGCAGAGG - Intronic
1146927780 17:36757087-36757109 GTGTGAGCAAGGGTATGAAGAGG + Intergenic
1146928383 17:36760852-36760874 GTGTGTGCATGTGTGTGGATGGG + Intergenic
1147186885 17:38717769-38717791 CTGTGTGTACCGGGGTGCAGGGG - Intronic
1147317136 17:39626475-39626497 GAGTGTGCAGGGGTGTGCCGGGG - Intergenic
1147382032 17:40061970-40061992 GTGTGTGTATGTGTGTGCTGGGG + Intronic
1148219404 17:45851233-45851255 GGGTGTGAACAGGTGTGCACGGG - Intergenic
1148330173 17:46809469-46809491 GTGTGTGTACGTGTGTGTTGGGG - Intronic
1148550256 17:48545987-48546009 GTGTGTGCATGAGTGTGGTGGGG + Intergenic
1148736987 17:49870388-49870410 GTGTGTGCACGATTGTGAGGCGG + Intergenic
1148780497 17:50118494-50118516 GGGAGTGGGCGGGTGTGCAGGGG + Intronic
1149117985 17:53122190-53122212 GTGTGTGTATGTGTGTGTAGAGG + Intergenic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1149658002 17:58320342-58320364 GGGTGGGCACGGCTGGGCAGGGG - Intronic
1150810956 17:68356842-68356864 GTGTGTGCACGGGTAGGTGGAGG - Intronic
1151212272 17:72553570-72553592 GTGTGTGGATGGGTGTGTGGGGG - Intergenic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1151447617 17:74177358-74177380 GTGTGTGCATGGATGAGCACAGG + Intergenic
1151512407 17:74569334-74569356 GTGCGTGCATGTGTGTGGAGGGG + Intergenic
1151713126 17:75817970-75817992 GTGTGTGCATGCATGTGAAGAGG + Intronic
1151800480 17:76376595-76376617 GTGTGTGCACAGTTTTCCAGGGG - Intronic
1151881903 17:76900977-76900999 GTGTGTGCATGTGTGTACATGGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152191887 17:78893139-78893161 GTGCGTACATGTGTGTGCAGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152273678 17:79341244-79341266 GTGTGTACATGTGTGTGCACAGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152293447 17:79453690-79453712 GTGTGTGCCGGTGTGTGCAGAGG + Intronic
1152333458 17:79686476-79686498 GTGTGGGCACAGGAGGGCAGGGG + Intergenic
1152521593 17:80859710-80859732 CTGTGTGCACGTGTGTGCGGGGG + Intronic
1152733417 17:81984828-81984850 GTGTGTGCAGGGGTGTGTGGGGG - Intronic
1152733457 17:81984995-81985017 GTGTGTGCAGGTGTGTGGGGGGG - Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152737865 17:82006158-82006180 GTGGGTGCACGTGTGTGCACGGG + Intronic
1152859882 17:82690184-82690206 GAGTGTGCATGTGTGTCCAGGGG + Intronic
1152859904 17:82690342-82690364 GAGTGTGTACGTGTGTCCAGGGG + Intronic
1152859934 17:82690582-82690604 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1152859958 17:82690741-82690763 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859969 17:82690820-82690842 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1153490040 18:5637772-5637794 GTTTGTGCACGGGTAGGCATTGG - Intergenic
1153539545 18:6139480-6139502 GTGTGTGCATGTGTGTTTAGGGG - Intronic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154227451 18:12519329-12519351 GTGTGTGCACATGTGTGTATAGG - Intronic
1154939605 18:21098122-21098144 GTATGTGCATGGGAGAGCAGGGG + Intronic
1156089270 18:33445326-33445348 GTGTGTGCACACATGTGCATGGG + Intergenic
1156669612 18:39452568-39452590 GTATGTGCATGTGTGTGTAGGGG - Intergenic
1157113759 18:44844326-44844348 GTGTGTGCACGTGTGTGTGTGGG - Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1157290434 18:46406033-46406055 GTGTGTACATGGGTGTGTAAGGG - Intronic
1158109124 18:53920420-53920442 GTGTGTGCACGTGTGTGTATGGG + Intergenic
1158400924 18:57121187-57121209 GTGTGTGCACGCGAGTGCGCAGG + Intergenic
1159274002 18:66192157-66192179 ATGTGTGCATGCGTGTGGAGAGG - Intergenic
1159903873 18:74073133-74073155 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
1159944739 18:74435922-74435944 GTGTGTGCACATGAGTGCACGGG - Exonic
1159963649 18:74575739-74575761 GTGTGTGCGCGTGTGTGAAGGGG + Intronic
1159982147 18:74795939-74795961 GTGTGTGCGCGTGTGCACAGCGG - Intronic
1160001612 18:75029609-75029631 GTGTGTGCCTGGGTGTGCGTGGG + Intronic
1160201720 18:76801830-76801852 AAGTGCGCACGGGTGTGCGGGGG + Intronic
1160357892 18:78244193-78244215 GTGTGTGCGCGTGTGTGAAGTGG - Intergenic
1160404551 18:78636675-78636697 GAGTGTGCATGGGTGTGTAGAGG + Intergenic
1160429132 18:78799603-78799625 GTGCGCGCGCGCGTGTGCAGTGG - Intergenic
1160532982 18:79576449-79576471 GTGTGAGCACAGCTGTGGAGCGG - Intergenic
1161236654 19:3201627-3201649 GTGAGTGCCGGGGTGGGCAGGGG + Intronic
1161251673 19:3284181-3284203 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1162015345 19:7843646-7843668 GTGTGTGCATGTGTGTGTATAGG + Intronic
1162129534 19:8517566-8517588 GTGTGTGTGCGTGTGTGCAGGGG + Intergenic
1163091055 19:15020825-15020847 GTGTGGGCAGGAGAGTGCAGGGG - Intronic
1163157783 19:15448944-15448966 GTGTGTGGAGGGGGGTGAAGGGG - Intronic
1165171437 19:33894737-33894759 GCGTGTGCACGGCATTGCAGTGG - Intergenic
1165171455 19:33894841-33894863 GCGTGTGCACGGCATTGCAGTGG - Intergenic
1165171522 19:33895158-33895180 GTGTGTGCACGGCATTGCAGTGG - Intergenic
1165211136 19:34236755-34236777 GGGTGTGGGCGAGTGTGCAGAGG - Intergenic
1165212195 19:34244840-34244862 GTTTGTGCATGGGAGAGCAGGGG - Intergenic
1165938188 19:39402451-39402473 CTGTGTGCCTGGGTATGCAGTGG - Intergenic
1167103465 19:47417920-47417942 GTGTGTGCATGTGTGTGTGGGGG - Intronic
1168059203 19:53882070-53882092 GTGTGTGCACGTGTGGGGGGCGG + Intronic
924991855 2:319291-319313 GTGTGGGCACGTGTGTGCCTGGG + Intergenic
924991878 2:319433-319455 GTGTGTGCGCGGGTGTGTGCAGG + Intergenic
925126629 2:1461699-1461721 CTGTGTGCACGTGTGTGTATGGG - Intronic
925587054 2:5474884-5474906 GAGTGTGCGCAGGTGTGGAGAGG - Intergenic
925878700 2:8332972-8332994 GTGGGGGCGAGGGTGTGCAGGGG - Intergenic
926906129 2:17807377-17807399 GTGTGTGCTCGTGTGTGTTGGGG - Intergenic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
927779607 2:25928854-25928876 GTGCGTGTGCGTGTGTGCAGGGG - Exonic
928269664 2:29844854-29844876 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
929315855 2:40477753-40477775 GTGTGTGCACGTGTGTGTAGGGG + Intronic
929543443 2:42840450-42840472 GTGTGTGTGTGTGTGTGCAGGGG + Intergenic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
931176451 2:59859614-59859636 GTGTGTGCATATGTGTGAAGGGG - Intergenic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
932572441 2:72945200-72945222 GGGTGGACACGGGGGTGCAGGGG - Intronic
932627636 2:73311096-73311118 GTGTGTGTACGTGTGTGTATGGG + Intergenic
932704987 2:74017247-74017269 GTGTGTGGAGTGGAGTGCAGCGG - Intronic
933009945 2:77048229-77048251 GTGTGTGCATGTGTGTGTAATGG + Intronic
933949445 2:87315488-87315510 GTGTGTGCATGTGTGTGCACGGG + Intergenic
934856601 2:97733727-97733749 GTGTGGGCACATGTGTGCACAGG - Intronic
935430165 2:102967378-102967400 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
936073712 2:109388078-109388100 GTGTGTGCATGTGTGTGCACAGG - Intronic
936075672 2:109400199-109400221 ATGTGTGCAAGTGTGTGTAGGGG - Intronic
936285894 2:111181135-111181157 GTGTTTGCACGAGTGTGTATGGG + Intergenic
936330747 2:111546109-111546131 GTGTGTGCATGTGTGTGCACGGG - Intergenic
937085535 2:119169320-119169342 GTGTGTGGGCAGGTGGGCAGAGG - Intergenic
937216174 2:120315042-120315064 GTGTGTGGACGAGTGTGCCGGGG - Intergenic
937260837 2:120586089-120586111 GTGTGTGTTGGGGTGTGCAGGGG + Intergenic
937300829 2:120840404-120840426 GTGCATGCACGCGTGTGCATGGG + Intronic
937720171 2:125085657-125085679 GTGTGTGTAGGGGTGCGTAGAGG + Intergenic
937871025 2:126786381-126786403 CTGAGTACACGGGTGTGTAGAGG + Intergenic
938870878 2:135474960-135474982 GTGTGTGAATGGGAGTGCAAGGG - Intronic
939312995 2:140509057-140509079 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
939963060 2:148583262-148583284 GTGAGTGCAGGGGTGTGAGGTGG + Intergenic
941264961 2:163349242-163349264 GTGTGTGTGCGTGTGTGTAGAGG - Intergenic
941574405 2:167212908-167212930 GTGTGTGTGTGTGTGTGCAGAGG - Intronic
943107592 2:183566137-183566159 GCGTGTGCACTGGAGTGCAGTGG + Intergenic
944083603 2:195818695-195818717 GTGTGTGGATGAGTGTGCAGAGG - Intronic
945186233 2:207142713-207142735 GTGTGAGCAAGGGTGTAGAGAGG + Intronic
945607929 2:211959982-211960004 GTGTGTACACAGGGGTGAAGTGG + Intronic
946311069 2:218882978-218883000 GTGTGTGTGCCTGTGTGCAGTGG + Intronic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
947572922 2:231249833-231249855 AGGTGTGCACGGGTGGGCGGTGG - Intronic
947572934 2:231249870-231249892 AGGTGTGCACGGGTGGGCGGTGG - Intronic
947572946 2:231249907-231249929 AGGTGTGCACGGGTGGGCGGTGG - Intronic
947572958 2:231249944-231249966 AGGTGTGCACGGGTGGGCGGTGG - Intronic
947572970 2:231249981-231250003 AGGTGTGCACGGGTGGGCGGTGG - Intronic
947746964 2:232512831-232512853 GCATGCGCACGTGTGTGCAGGGG + Intergenic
947917575 2:233843864-233843886 GTGTGTGCACGTGTGTGGCAGGG + Intronic
948227326 2:236321493-236321515 GTGTGTGAGTGGGTGTGGAGAGG - Intergenic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
948367246 2:237464946-237464968 GTGTGTGCGGGGGTGTGGGGGGG + Intergenic
948661564 2:239510096-239510118 GTGTGTGTGCGTGTGTGCAGTGG + Intergenic
948921838 2:241069528-241069550 CTGAGTGCACAGGTGGGCAGGGG - Intronic
949059829 2:241950280-241950302 GTGTGAGCACAGGTGTGCATGGG + Intergenic
1170045629 20:12082423-12082445 GTGTGTGCACGTGTGTGTCTGGG - Intergenic
1170210774 20:13844380-13844402 GTGTGTGTGCGTGTGTGTAGCGG + Intergenic
1170709847 20:18780784-18780806 GTGTGTATATGCGTGTGCAGAGG - Intergenic
1171109985 20:22471910-22471932 ATGTGTGCACGGGTGTGCTGTGG - Intergenic
1171183491 20:23108491-23108513 GTGTGTGCACGTAGGTGCACAGG + Intergenic
1171456488 20:25275498-25275520 GGGTGGTCACTGGTGTGCAGAGG + Intronic
1173657018 20:44706458-44706480 GTGTGTGCTGCCGTGTGCAGAGG + Intergenic
1173882289 20:46424615-46424637 GTGTGTGCGTGTGTGTGTAGGGG + Intronic
1173997516 20:47350241-47350263 GTGCGTGCATGTGTGTGCACGGG - Intronic
1174304983 20:49608675-49608697 GTGTGTGGACTCGTTTGCAGAGG - Intergenic
1174786984 20:53442180-53442202 GTGTGTGTACGTGTGTGTAAAGG + Intronic
1175270706 20:57731934-57731956 GAGAGAGCACGGGTGTGAAGGGG + Intergenic
1175334421 20:58185837-58185859 GCTGGTGCACGGCTGTGCAGTGG + Intergenic
1175404694 20:58718488-58718510 GTGAGTGCATGCGTGTGCACTGG + Intronic
1175684649 20:61019572-61019594 GTGGGTGCATGGGTGTGCGTGGG - Intergenic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175787127 20:61718756-61718778 GTGTGTGCAGGGGTGTAGGGTGG - Exonic
1175793856 20:61758915-61758937 GTGTGTGCACCTGTGTGCATGGG + Intronic
1175798958 20:61790129-61790151 GTGTGTGGATGGGTGGACAGAGG - Intronic
1175872600 20:62215582-62215604 CGGTGTGCAGGTGTGTGCAGGGG + Exonic
1175876018 20:62230398-62230420 GTGTGTGTATGGGTGTGTTGAGG - Intergenic
1176229946 20:64027435-64027457 GTGGGTGTACAGGTGTGCGGTGG - Intronic
1178706078 21:34874147-34874169 GTGTGTGTGCGTGTGTGCAAGGG - Intronic
1178719349 21:34994545-34994567 ATGTGTGCATAGGAGTGCAGTGG + Intronic
1178750477 21:35297721-35297743 GTGTGTGCATGTGTGTGAGGGGG - Intronic
1178844728 21:36165424-36165446 GTGTGTGCATGTGTGTGTATGGG + Intronic
1178926003 21:36775583-36775605 GTCTGAGTACTGGTGTGCAGTGG - Intronic
1179583651 21:42361246-42361268 GTGTGTGCTGCTGTGTGCAGGGG + Intergenic
1179684615 21:43046571-43046593 GGGTGAGGACGGGGGTGCAGGGG - Intergenic
1179827550 21:43975386-43975408 GTGTGTGCACTGGTGTGTGGTGG + Intronic
1179901411 21:44396362-44396384 GGGTGTGGAGGGGTGTGGAGGGG + Intronic
1179901439 21:44396451-44396473 GGGTGTGGAGGGGTGTGGAGGGG + Intronic
1179901534 21:44396752-44396774 GGGTGTGGAGGGGTGTGGAGGGG + Intronic
1179901586 21:44396900-44396922 GGGTGTGGAGGGGTGTGGAGGGG + Intronic
1180611535 22:17101350-17101372 GTGTGTGCACGCGTGTGTGCAGG - Intronic
1181495349 22:23284458-23284480 GTGTGTGCACGCCTATGCCGAGG - Intronic
1181557139 22:23677646-23677668 GTGTGTGAACAGGTGTGCTTGGG - Intergenic
1182012647 22:27013310-27013332 GTGTGTGCACGAGTGTGACAGGG + Intergenic
1182041635 22:27242811-27242833 GTGTGTGCGCGCGTGCGCGGGGG - Intergenic
1182897331 22:33869529-33869551 GTCTGTGCAGTGGTTTGCAGGGG + Intronic
1183186670 22:36295406-36295428 GTGTGTGTGTGTGTGTGCAGAGG + Intronic
1183278190 22:36914564-36914586 GTGTGTGCAGGTGTGTGTACTGG + Intronic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1183614847 22:38937641-38937663 GTGGGTGCACGTGTGTGCATGGG + Intergenic
1183733466 22:39630899-39630921 GTGTGTGCAGGGCTGGGGAGTGG + Intronic
1184026025 22:41857176-41857198 GAGTGTGGACGGGAGTGAAGAGG + Intronic
1184264730 22:43341076-43341098 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
1184379457 22:44136047-44136069 GTGTGTGCACGGGACTGAAGAGG - Intronic
1184412864 22:44335686-44335708 GTGTGTGCTGGGGTGTGCGATGG + Intergenic
1184914944 22:47562951-47562973 GTGTGTGTATGTGTGTGTAGGGG + Intergenic
1184955341 22:47882334-47882356 GTGCCTGCACTGGAGTGCAGTGG + Intergenic
1185023687 22:48395507-48395529 GTGTGTGCATGTGTGTGCACAGG - Intergenic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
1185100402 22:48837638-48837660 GTGTGCGCACGTGTGTGCATGGG - Intronic
1185233032 22:49694159-49694181 GTGGGTGCAGGTGAGTGCAGGGG - Intergenic
1185285604 22:49998446-49998468 GGCTGTGCACGTGTGTGCATGGG + Intronic
1185299251 22:50070968-50070990 GTGTGTGCAAGAGTGTGCCCTGG - Intronic
949255000 3:2035543-2035565 GTGTGTGCACACATGTGCTGAGG - Intergenic
949930773 3:9076783-9076805 GTGTGTGCATGGTTGGCCAGGGG + Intronic
950139653 3:10606597-10606619 GTGGGTGGACGTGTGTGCAGCGG + Intronic
950726899 3:14922572-14922594 GTGTGTGCATGGGGGTGGGGTGG + Intronic
951479999 3:23150284-23150306 TTGTGTGTGCGTGTGTGCAGTGG + Intergenic
951649753 3:24938029-24938051 GTGTGTGCGCATGTGTGCATAGG - Intergenic
951770107 3:26245648-26245670 GTGTGTGTAAGGGTGAGGAGTGG + Intergenic
952276581 3:31883185-31883207 GTGTCTGCAGGTGTGTGTAGGGG - Intronic
952384433 3:32829654-32829676 GTGTGTGCGTGTGTGTGCATTGG + Intronic
953004836 3:38968579-38968601 GTGTGTGCACATGTGTGTTGGGG - Intergenic
953541680 3:43824700-43824722 GTGTGTGCACAGGTGTGCTTAGG + Intergenic
954806007 3:53221074-53221096 GTGTGTGGAGGGGTGCTCAGTGG + Intergenic
955121366 3:56062636-56062658 GTGTGTTCATGTGTGTGCAATGG - Intronic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
959802621 3:110512943-110512965 GTGTGTGTTCGGGGGGGCAGAGG + Intergenic
959959195 3:112277006-112277028 GTGTGTGCAAATGTGTGCATGGG + Intronic
960052903 3:113254624-113254646 GGGTGTGCATGCGTGTGCACCGG - Intronic
960084019 3:113571481-113571503 GTGTGTGTGTGTGTGTGCAGAGG - Intronic
961219154 3:125186334-125186356 GTGTGTGCATGTGTGGGCGGTGG - Intronic
961793734 3:129394551-129394573 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
961793750 3:129394686-129394708 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
961793766 3:129394831-129394853 GTGTGTGTATGTGTGTGCAGGGG - Intergenic
961810039 3:129516612-129516634 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
962203102 3:133415962-133415984 GTGAGTAGACGGGTGAGCAGAGG - Intronic
963070927 3:141304569-141304591 GTGTGTGCAGGGGGTTGCTGGGG - Intergenic
963659805 3:148111191-148111213 GTGTTTGCAAGGTTGTGAAGAGG + Intergenic
965762571 3:172094802-172094824 GTCTGTGAGCGGGTGTGTAGTGG + Intronic
966036774 3:175426541-175426563 GTGTCTGCAAGGGTATGCACAGG + Intronic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
967241253 3:187441687-187441709 GTGTGTGTGCGTGTGTGTAGGGG - Intergenic
967748724 3:193088932-193088954 GTGTGTGCATGTGTGTGTGGGGG - Intergenic
968181815 3:196600956-196600978 CTGTGAACACGGGTGTGCAAAGG + Intergenic
968522993 4:1042726-1042748 GTGTGTGTATCGGTGTGCGGGGG - Intergenic
968569796 4:1333659-1333681 GTGGGTGCAGGGGTGGGCACGGG - Intronic
968584600 4:1410309-1410331 GTGTGTGCAGGGGCGAGAAGAGG - Intergenic
968627632 4:1634337-1634359 GTGTGTGGACGGGTGTGGAGGGG - Intronic
968628256 4:1637637-1637659 GGGTGGGCAGGGGTGGGCAGGGG + Intronic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
969301417 4:6299482-6299504 GGGTGTGCACGTGTGTGTAGGGG + Intronic
969301432 4:6299573-6299595 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301444 4:6299645-6299667 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301452 4:6299693-6299715 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301465 4:6299770-6299792 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301497 4:6299965-6299987 GTGTGTGCACGTGTGTGTACGGG + Intronic
969609310 4:8218130-8218152 GTGTGTGCACGTGTGTGTGTTGG + Intronic
970967823 4:21948685-21948707 GTCTGTCCACGGGTCTGCACGGG + Exonic
971145094 4:23967830-23967852 GTGTGTGAAGCGGTGTGCAAGGG + Intergenic
971257729 4:25030054-25030076 GTGTGTGTAGGGGCGTGCATAGG - Intronic
971403199 4:26295278-26295300 GTGTGTGCATGGGTGTGTGTGGG + Intronic
973862321 4:55077762-55077784 GTGTGTGGATGGGTGTGTGGGGG + Intergenic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
975822309 4:78284496-78284518 GTGTGTGCACAGCTGTGGACTGG + Exonic
978360194 4:107923472-107923494 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
979831905 4:125315086-125315108 GTGTGTGCATGCCTGTGCGGCGG + Intergenic
980739841 4:136935829-136935851 GTGTGTGTATGCGTGTGGAGGGG - Intergenic
982689185 4:158529019-158529041 GTGTGTGCTGGGGTGGGGAGAGG - Intronic
985074700 4:186202607-186202629 GTGTGTGCATGTGTGTGCATGGG - Intronic
985564856 5:610424-610446 GTATGTGCAACAGTGTGCAGGGG - Intergenic
985564912 5:610799-610821 GTGTGTGCAACAGTGTGCAGGGG - Intergenic
985681948 5:1260269-1260291 GTGTGTGCACAGGTGTGCAAGGG - Intronic
985730591 5:1545497-1545519 ATGTGTGCAGGTGTGTGCACAGG - Intergenic
985730604 5:1545634-1545656 ATGTGTGCAGGTGTGTGCAGAGG - Intergenic
985730616 5:1545740-1545762 ATGTGTGCAGGTGTGTGCAGAGG - Intergenic
985842016 5:2313841-2313863 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
985959886 5:3293446-3293468 GGGTGTGTGCGGGTGTGCAAAGG - Intergenic
986251299 5:6060846-6060868 GTGTGTGCACATGTGTGCGGGGG - Intergenic
987075466 5:14378155-14378177 GTGTGAGCACGGGAGTTTAGGGG - Intronic
987381266 5:17288092-17288114 GTGTGAGAAGGGGTGTGCAGTGG - Intergenic
989010346 5:36864588-36864610 GTGGGAGCATGGGTGGGCAGGGG - Intergenic
989106214 5:37865510-37865532 ACGTGTGCACACGTGTGCAGAGG - Intergenic
989740504 5:44765679-44765701 GTGTGTGCACATGTGTGTATCGG - Intergenic
989983837 5:50672844-50672866 GTGTGTGCAGGGGTGAGGAGGGG + Intronic
990355240 5:54960419-54960441 GGTTGTGCAGGTGTGTGCAGTGG - Intergenic
990529601 5:56660311-56660333 GTCTTTGCAGGGATGTGCAGGGG - Intergenic
990944645 5:61237185-61237207 GTGTGTGTGTGTGTGTGCAGAGG + Intergenic
991453041 5:66772932-66772954 GTGTGTGCACAGGGGTTCAAGGG - Intronic
991579672 5:68141169-68141191 ATGTGTGTACATGTGTGCAGGGG - Intergenic
992766005 5:80000808-80000830 GTGTGTGCACTGGTGAGGGGAGG + Intronic
993134874 5:83947389-83947411 GTGTGTGTGTGTGTGTGCAGAGG + Intronic
993612078 5:90066753-90066775 GTGTGTGTATGTGTGTGCATGGG - Intergenic
993617911 5:90136157-90136179 GTGTGTGGACGAGTGAGCACAGG + Intergenic
994939755 5:106307352-106307374 GAGTGTGCCCTGGTGTGGAGTGG - Intergenic
995022822 5:107385070-107385092 GTGTGTGCATACGTGTGCTGGGG - Intronic
995936151 5:117517521-117517543 GTGTGTGCGCCTGTGTGCAAAGG - Intergenic
996300268 5:121973598-121973620 GTGTGTGCATGTGTGTGTGGGGG + Intronic
996559538 5:124814047-124814069 CTGAGTGCACTGGAGTGCAGTGG - Intergenic
997236087 5:132272650-132272672 GTGTGTGCAAAGGTGAGCTGGGG + Exonic
997725586 5:136117499-136117521 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
999270984 5:150296281-150296303 GTGTGTGCATGTGTGTCCTGGGG - Intergenic
1000760145 5:165213496-165213518 GTATGTGCACATGTGTGCTGGGG - Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1002840619 6:902272-902294 GTGTGTGCATGTGTGTTGAGGGG + Intergenic
1003558734 6:7163740-7163762 GTGTGAGCACGTGTGTGCCTGGG + Intronic
1003618077 6:7673185-7673207 GGGTGTGCAGGGGTGGGGAGTGG + Intergenic
1003917928 6:10805052-10805074 GTGTGTGCATGTGTGTGTCGGGG + Intronic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1004351960 6:14898005-14898027 GTGTGTGCGCGTGTGTGTGGTGG - Intergenic
1005371392 6:25137304-25137326 GTGTGTGTTTGGGTGTGCATAGG - Intergenic
1005423765 6:25679490-25679512 GTGTGTGCAGGGGATTGAAGGGG + Intronic
1005430445 6:25751120-25751142 GGGTGTGCATGGGTGTGTAGGGG + Intergenic
1006173139 6:32106980-32107002 GTGTGTGCACGTGTGTGCATGGG - Intronic
1007384260 6:41510047-41510069 GTGTGTGTACGTGTGTGTTGGGG - Intergenic
1007514010 6:42396894-42396916 GTGTGTGTATGGGTGTGTACAGG - Intronic
1007784415 6:44271507-44271529 GCGTGTGCACAAGTGTGCATGGG - Intronic
1008975723 6:57423924-57423946 GTGCCTGCACAGGAGTGCAGTGG + Intronic
1010373742 6:75141745-75141767 GTGTGTGCATGTATGTGTAGTGG - Intronic
1010982677 6:82386988-82387010 GTGTGTGCGCGTGTGAGCATGGG + Intergenic
1011109648 6:83822922-83822944 ATTTGTGCACGAGTGTTCAGAGG - Intergenic
1013072855 6:106744573-106744595 GTATGTGCATGTGTGTGTAGGGG + Intergenic
1015576514 6:134677422-134677444 GTGTGTGCATGTGTGTGCATAGG - Intergenic
1016273992 6:142326791-142326813 GTGTGTGTATGTGTGTGGAGGGG + Intronic
1017679188 6:156846547-156846569 GTGTGTGGACGGGGCTGCGGTGG + Intronic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1018788174 6:167124925-167124947 GTGTGTGCATGGGTGTATATTGG - Intronic
1018877710 6:167840054-167840076 GTGTGTTCAGGGCTGTGAAGAGG + Intronic
1019067664 6:169315977-169315999 GTGTGTGAACTAGTGTGCAGAGG - Intergenic
1019183281 6:170206160-170206182 GTGTGAGCACGTGTGTGCATGGG + Intergenic
1019183283 6:170206170-170206192 GTGTGTGCATGGGTGTGTGTGGG + Intergenic
1019264736 7:108163-108185 GTGTGTGCACATGTGTACATGGG - Intergenic
1019352991 7:563893-563915 ATGTGTGCACACGTGTGCATGGG + Intronic
1019553816 7:1618675-1618697 GTGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019553836 7:1618785-1618807 GTGTGTGTAGGTGTGTGGAGGGG + Intergenic
1019553871 7:1619022-1619044 GTGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019553882 7:1619100-1619122 GTGTGTGTAGGGGTGTGTAGGGG + Intergenic
1019553885 7:1619110-1619132 GGGTGTGTAGGGGTGTGTAGGGG + Intergenic
1019560046 7:1651389-1651411 GTGTGTGCCCGTGTGTGCCTGGG - Intergenic
1019630721 7:2047774-2047796 GAGTGTGCATGTGTCTGCAGAGG - Intronic
1019694350 7:2436809-2436831 GTGTTTGCAGGGATGTGGAGGGG + Intergenic
1019790938 7:3013503-3013525 GTGTGTCCATGGATGTGCAGAGG - Intronic
1020093747 7:5356271-5356293 GTGTGCGCTCGGGTGCGGAGAGG - Intronic
1020672862 7:11140143-11140165 GTATGTACAGGTGTGTGCAGGGG - Intronic
1020904899 7:14052772-14052794 GTGTTTGCAGGGGTGGGTAGCGG - Intergenic
1021446696 7:20741775-20741797 GTGTGTGCATGTGTGTGTGGTGG - Intronic
1021991231 7:26143239-26143261 GTGTGTGTGTGTGTGTGCAGAGG - Intergenic
1022417959 7:30194471-30194493 GTGTTTGTACAGGTGTGTAGGGG + Intergenic
1023242157 7:38160124-38160146 GTATGTGCAAGGGAGTGAAGGGG + Intergenic
1023986022 7:45096541-45096563 GTGTGTGTATGTGTGTGCACTGG - Intergenic
1024148786 7:46545380-46545402 GAGTGTGCACGTGTGTGCATTGG - Intergenic
1024167674 7:46750766-46750788 ATGTGTCCAAGGGAGTGCAGGGG + Intronic
1026651504 7:72219662-72219684 GTGTATGCATGTGTGTGCAAGGG - Intronic
1027904587 7:84163289-84163311 GTGTGTGAATGGGTGTACACAGG + Intronic
1029315136 7:99704920-99704942 GTGTGGGAACTGGAGTGCAGTGG - Intronic
1030395472 7:108981030-108981052 GTGTGTGTATGTGTGTGTAGTGG - Intergenic
1031925607 7:127635335-127635357 GTGTGTTGAGGGGGGTGCAGTGG + Intergenic
1031971267 7:128066667-128066689 GTGTGTGACCGGGAGTGGAGGGG + Intronic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1032023379 7:128422280-128422302 GTGTGTGTAAGTGTGTGTAGGGG + Intergenic
1032709605 7:134450414-134450436 GTGTGTGCACGTGCCTGGAGGGG + Intronic
1032743127 7:134759574-134759596 ATGTGCGCATGTGTGTGCAGGGG + Intronic
1032807903 7:135375952-135375974 GTGTGTGTATGTGTGTACAGGGG + Intronic
1033510181 7:142052915-142052937 GGGGGTTCACGGGTGTGGAGGGG - Exonic
1033927271 7:146478673-146478695 GTGTGTGTACATGTGTGTAGAGG - Intronic
1034278216 7:149833572-149833594 GTGAGGGCACGCGTGTGAAGTGG + Intergenic
1034526847 7:151669765-151669787 GTGCGTGCAAGTGTGTGCACAGG - Intronic
1034526848 7:151669791-151669813 GTGTGTGCAAGTGTGTGCACAGG - Intronic
1034526857 7:151669963-151669985 GTGTGTGCACAGGTGTGTGCAGG - Intronic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1035117024 7:156533411-156533433 GGGTCAGCACGGGTGGGCAGAGG - Intergenic
1035117035 7:156533452-156533474 GGGTCAGCACGGGTGGGCAGAGG - Intergenic
1035351658 7:158251646-158251668 TGGTGTGCACAGGTGTGCAATGG + Intronic
1035351666 7:158251728-158251750 TGGTGTGCACAGGTGTGCAATGG + Intronic
1035548759 8:503842-503864 GTGTGTGCAGAGGTGGGCATTGG - Intronic
1035657491 8:1320887-1320909 CTGTATGCACAGGTGTGTAGGGG + Intergenic
1035721720 8:1797780-1797802 GTGTGTGTCAGTGTGTGCAGAGG - Intergenic
1035979062 8:4348591-4348613 GTGTGTGCGTGGGTGTGTTGGGG + Intronic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1037172829 8:15913886-15913908 GTGTGTGCACGTGTGTCTAAAGG + Intergenic
1038064696 8:23951569-23951591 GTTTGTGGAAGGGAGTGCAGAGG - Intergenic
1038097887 8:24336044-24336066 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1038680259 8:29660379-29660401 GTGTGTGCACACGTGTGTATGGG - Intergenic
1038680262 8:29660519-29660541 GTGTGTGTATGGGTGTGTATGGG - Intergenic
1038908416 8:31934382-31934404 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1039224288 8:35371171-35371193 GTGTGTGTGTGTGTGTGCAGTGG - Intronic
1039269227 8:35862648-35862670 GTGTGTGCTTGGGGGTGGAGCGG + Intergenic
1039550926 8:38442379-38442401 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1039778153 8:40757349-40757371 GTGTGTGTATGTGTGTACAGTGG - Intronic
1040028742 8:42805092-42805114 GCATGTGCATGGGGGTGCAGTGG - Intergenic
1040928824 8:52713924-52713946 GTGTGTGCACGGGAGGGCCCCGG - Intronic
1041392249 8:57357627-57357649 GTGTGTGTGTGTGTGTGCAGAGG + Intergenic
1042741543 8:72052940-72052962 GTGTGTGCATGTGTGGGAAGTGG + Intronic
1043054125 8:75415759-75415781 GTGTGTGCACGTGTGTGTGTTGG + Intronic
1045870762 8:106924347-106924369 GTGTGTGGAGGGGAGGGCAGGGG + Intergenic
1046785257 8:118258920-118258942 GTTTGGGCCTGGGTGTGCAGGGG - Intronic
1048254127 8:132892655-132892677 GTGTGTGTATGTGTGTGCTGTGG + Intronic
1048454819 8:134568046-134568068 GTGTGTGCACTCATGTGCTGGGG - Intronic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048988612 8:139748517-139748539 GTGGGTGTGAGGGTGTGCAGGGG + Intronic
1048994215 8:139781720-139781742 GTGTGTGCCTGTGTGTGCGGTGG + Intronic
1049189084 8:141276633-141276655 GTGAGTGCAGTGCTGTGCAGAGG - Intronic
1049251155 8:141589763-141589785 GTGTGTGCACACGTGTGTACAGG + Intergenic
1049251905 8:141593726-141593748 GTGTGTGTGCATGTGTGCAGGGG + Intergenic
1049398602 8:142413558-142413580 GTGTGTGCACGTGTGTGTGTGGG - Intergenic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1049641242 8:143716928-143716950 GTGTGTGCGTGGGTGTGTGGGGG + Intronic
1049784012 8:144441981-144442003 GTGTGTGCAGGGGTGAGCCTGGG - Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050367116 9:4882842-4882864 GTGTGTGCATGTGTGTGCATAGG - Intronic
1050749687 9:8922684-8922706 CTGTCTGCACTGGAGTGCAGTGG + Intronic
1051167268 9:14277316-14277338 GTGCGTGCACGTGTGTGCGCGGG - Intronic
1052611326 9:30778131-30778153 GTGTGTGTATGTGTGTACAGAGG + Intergenic
1052663951 9:31470661-31470683 GTGCGTGCTTGTGTGTGCAGTGG - Intergenic
1052855429 9:33403574-33403596 GTGTGTGCAGGGGTGGGGACTGG - Intergenic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1053348461 9:37395452-37395474 GTGTGAGCACGTGGGGGCAGAGG + Intergenic
1056537967 9:87547597-87547619 GTGTGTGTGCGTGTGTGTAGAGG + Intronic
1056705406 9:88948381-88948403 ATGTGTGCACGCATGTGCATGGG + Intergenic
1058983970 9:110195070-110195092 GTGTGTGCATGTGTGTGTGGAGG - Intronic
1059319856 9:113461221-113461243 GTGTGTGCACATGTGTGAGGTGG + Intronic
1059332075 9:113542011-113542033 GTGTGTGCACGTGTGTGTGTTGG - Intronic
1059652712 9:116330605-116330627 GTGTGTGCGTGTGTGTGTAGGGG + Intronic
1060201309 9:121653018-121653040 GTGTGTGCACAGGTGTGTGCTGG + Intronic
1060378445 9:123140825-123140847 GTGTGTGCATGATTGTGCACAGG + Intronic
1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG + Intronic
1060996148 9:127875781-127875803 GGGTGTGCAGGGCTGTGGAGAGG - Intronic
1061006095 9:127929196-127929218 GTGTGTGCATGTGTGCGCAGTGG - Intronic
1061025971 9:128049872-128049894 GTGTATGCACGGGTCTTCTGTGG - Intergenic
1061408274 9:130404639-130404661 GTGTGTGTACACGTGTGCACAGG + Intronic
1062022457 9:134326051-134326073 GTGTGTGCGCGAGTGTGTGGCGG + Intronic
1062187522 9:135226540-135226562 GTGTGTGAATGTGTGTGCAATGG - Intergenic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198177 9:135286217-135286239 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198185 9:135286280-135286302 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198202 9:135286400-135286422 GTGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198211 9:135286464-135286486 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062205970 9:135337559-135337581 GTGTATGCACATGTGTGCAGGGG + Intergenic
1062325558 9:136010915-136010937 GTGTGTGCAGGGGTGTGGTGAGG - Exonic
1062325560 9:136010925-136010947 GTGTGTGCGTGTGTGTGCAGGGG - Exonic
1062444160 9:136586469-136586491 GTGTGTGCCCGTGTGTGTAGAGG + Intergenic
1185480190 X:440363-440385 GTGTGTGCACCTGTGTGTGGGGG - Intergenic
1185700973 X:2229568-2229590 GTGTGTGCACAGATATGCATAGG + Intronic
1185764344 X:2712864-2712886 TTGTGTGCACGTGTGTGTATGGG - Intronic
1185776543 X:2807858-2807880 GTGTGTGCATGTGTGTCCATGGG + Intronic
1186398684 X:9236453-9236475 GTGTGAGAACATGTGTGCAGAGG + Intergenic
1187678621 X:21743402-21743424 GTGTGTGCACGTGTGTGTGGTGG - Intronic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1188923243 X:36005671-36005693 GTGTGTGCACATGTGTGCAATGG + Intergenic
1192148312 X:68696334-68696356 GTGTGTGCGCACGTGTGCATGGG + Intronic
1192193794 X:69015451-69015473 GTGTGAGCACATGTGTGTAGTGG + Intergenic
1192599840 X:72450377-72450399 GTGTGTGCCTGTGTGTGCATAGG - Intronic
1193684892 X:84565779-84565801 GGGTGTGAATGGATGTGCAGAGG + Intergenic
1194657514 X:96590720-96590742 GTGTGTGCAAGTGTGTGTATGGG + Intergenic
1195117063 X:101709729-101709751 GTGTGTGCACACGTATGCATGGG + Intergenic
1195208549 X:102627570-102627592 GTGGGGGCAGGGGTGTGGAGGGG - Intergenic
1196117882 X:112016711-112016733 ATGTGTGCATGTGTGTGTAGAGG + Intronic
1196644712 X:118105070-118105092 GTGTGTGCACAGGTGTGTGTTGG - Intronic
1196819464 X:119691588-119691610 CTCTGTGCTAGGGTGTGCAGGGG + Intronic
1198530764 X:137548382-137548404 CTGTGCGCAGGGGTGTGCTGAGG + Intergenic
1200167339 X:154045930-154045952 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1202608216 Y:26657038-26657060 TGGAGTGCAGGGGTGTGCAGTGG + Intergenic