ID: 1153325997

View in Genome Browser
Species Human (GRCh38)
Location 18:3820883-3820905
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 2, 1: 0, 2: 3, 3: 14, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903660525 1:24974529-24974551 TGGAAAAATCACAATGAGCTTGG - Intergenic
904958447 1:34309473-34309495 TGGAATAATCTCAGTAGGATTGG - Intergenic
906391157 1:45417566-45417588 TAGAAAAATCTCCATGAGATTGG - Intronic
906594965 1:47067776-47067798 TGTAAAAATCACAATGAGATTGG - Intronic
907561395 1:55392444-55392466 TGGAATAGTTTCAATAAGATTGG + Intergenic
908070156 1:60451636-60451658 TGGAATAATATTAATGAGCAGGG - Intergenic
908275601 1:62467693-62467715 TGGAATAATGTCAATAGGATTGG - Intronic
908660400 1:66428783-66428805 TGGAATAGTGTCAATAAGATTGG + Intergenic
908862215 1:68502097-68502119 TGGAATACTGTCAATGGGATTGG - Intergenic
908883697 1:68762668-68762690 TGGAATAGCTTCAATGAGGTTGG - Intergenic
912135011 1:106650302-106650324 TGGAAGAATTTCAAGGAGCATGG - Intergenic
913071939 1:115307144-115307166 TGGAACAAACTAAGTGAGCTGGG + Intronic
913244542 1:116860108-116860130 AGCAATAATCTGAATGAGGTAGG - Intergenic
914288326 1:146248900-146248922 TGGACTCATGTCAATGAGCAGGG - Intergenic
914549363 1:148699646-148699668 TGGACTCATGTCAATGAGCAGGG - Intergenic
914617321 1:149372072-149372094 TGGACTCATGTCAATGAGCAGGG + Intergenic
916566077 1:165979150-165979172 TGGAATAATGTCAATAAGATTGG + Intergenic
918722459 1:187870733-187870755 TGGAAAAATTCCAAAGAGCTTGG - Intergenic
919262235 1:195210640-195210662 TGGAAAAATCTAGATGATCTTGG - Intergenic
919405432 1:197175843-197175865 TGAGATGATCTCAATGAGATAGG - Intronic
919407751 1:197205801-197205823 TGGAATAATGTCAATAGGATTGG + Intergenic
920402329 1:205683866-205683888 TAGAATAATTTTAATAAGCTAGG + Intergenic
920423746 1:205856380-205856402 TGGAATAATTTCAGTAAGATTGG - Intergenic
923161706 1:231320090-231320112 TGGAATTATGTGAATCAGCTGGG - Intergenic
924930188 1:248724262-248724284 TGGAATCATGTCAATAAGATTGG - Intronic
1063363291 10:5474082-5474104 TGGGATATTGTCAATGAGCAGGG - Intergenic
1065499996 10:26370747-26370769 TGGAATAGTCTCAATAGGATTGG + Intergenic
1068245750 10:54364828-54364850 GCCAATAATCTGAATGAGCTTGG - Intronic
1069228829 10:65980420-65980442 TGGAATAATGTCAATCGGATTGG - Intronic
1069648499 10:70023434-70023456 TGGAATAGTGTCAATAAGATTGG - Intergenic
1070465186 10:76714890-76714912 TGGAATAATGTCAATAGGATTGG - Intergenic
1071772684 10:88747201-88747223 TGGAATTATTTCAATAAGATTGG - Intronic
1073247332 10:102100756-102100778 TGGAGTAATCCCAAGTAGCTGGG + Intergenic
1073510594 10:104040255-104040277 TGGATGAAGCTGAATGAGCTGGG - Intronic
1073930432 10:108567919-108567941 TTGAATAATTTTAGTGAGCTTGG - Intergenic
1079523725 11:21359552-21359574 TGGAATAGTTTCAGTGAGATTGG + Intronic
1079856118 11:25607464-25607486 TGGAATAGTGTCAATAAGATTGG + Intergenic
1086006109 11:82038477-82038499 TGGAATAATCTCCCTGAAATAGG - Intergenic
1088372193 11:109103443-109103465 TGGAATAGTGTCAATAAGATTGG + Intergenic
1090248015 11:125230493-125230515 TGGAAAAATCTGATTGAGATGGG - Intronic
1090508666 11:127347709-127347731 TAGAATTATCTCAATAAGTTTGG + Intergenic
1093001748 12:14004643-14004665 TGGAATAGTGTCAATAAGATTGG + Intergenic
1093290831 12:17319578-17319600 TGGAATAGTGTCAATAAGATTGG + Intergenic
1095487445 12:42699749-42699771 TGCCAAAATCTGAATGAGCTTGG - Intergenic
1098441651 12:70525475-70525497 TGGAAGAATCTCAAAGATGTTGG + Intronic
1099140076 12:78962182-78962204 AGGAATTATCTCAATGAGGCTGG + Intronic
1101073200 12:101097917-101097939 TGGAATAATTTCATGGAACTTGG + Exonic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1105660932 13:22494338-22494360 TTGAAAACTCTCAATAAGCTAGG - Intergenic
1109659949 13:65444407-65444429 TGGAAGAATCTCAAAATGCTGGG - Intergenic
1109695786 13:65955351-65955373 TTGAATAATTTCAATAAGATTGG + Intergenic
1110271763 13:73599233-73599255 TGGAATAATCTCCATGTGAATGG - Intergenic
1111813050 13:93115864-93115886 TGCTATAATCTCAGTGAGCTGGG - Intergenic
1112147864 13:96721789-96721811 TGCAGTAATTTTAATGAGCTTGG - Intronic
1112617567 13:101020879-101020901 TGCAGTAAGCTCAATGAACTTGG + Intergenic
1113534635 13:111055626-111055648 TGGAATAGTGTCAATGGGATTGG + Intergenic
1114430547 14:22656956-22656978 TGGATCAAGCTCAATGAGCATGG + Intergenic
1114766403 14:25375959-25375981 TGTAATAAGCTCGATGACCTTGG + Intergenic
1116645097 14:47517633-47517655 TGCAATCAACTCAATGAACTTGG + Intronic
1120361037 14:83502669-83502691 TGGAAAAATCTTAATGAGAGAGG + Intergenic
1121466512 14:94118908-94118930 GTGAATAATCTGAAGGAGCTTGG + Intergenic
1124063385 15:26316975-26316997 TGGACTAATGTCAATTATCTCGG - Intergenic
1124858971 15:33419288-33419310 TTGAAGAATTTCAATGTGCTTGG - Intronic
1125738673 15:41946072-41946094 TGGAAGCATTTCAATAAGCTGGG - Intronic
1127664583 15:61133313-61133335 TGGAATAGTCACAATGTGCATGG + Intronic
1129762597 15:78139238-78139260 TGGGAGAATCCCAGTGAGCTGGG + Intronic
1131348142 15:91670645-91670667 TGGAATCATCTGAATCACCTGGG - Intergenic
1131484692 15:92809885-92809907 GAGAAAAATCTCAATGATCTGGG + Intergenic
1132175358 15:99709906-99709928 TGTAATGATGTCACTGAGCTTGG + Intronic
1133455005 16:5934315-5934337 TATAATAAACACAATGAGCTGGG - Intergenic
1134289485 16:12892152-12892174 GGTAAAACTCTCAATGAGCTAGG - Intergenic
1139231556 16:65287773-65287795 GTGTATAATCTCAATGTGCTTGG - Intergenic
1140640396 16:76965147-76965169 TGACATAATCTCAAGGAGTTGGG + Intergenic
1145075399 17:19850772-19850794 TGGCATGATCTCGATGATCTCGG - Intronic
1146461653 17:33050739-33050761 TGGAACAATCTCAAGTAGCCAGG - Intronic
1146599583 17:34203128-34203150 TTGATTAATCTCACTGAGCAAGG - Intergenic
1150350678 17:64442226-64442248 TGGAATAATATTAATCAGCTGGG - Intergenic
1150513984 17:65788095-65788117 TGTGATAATCTTAATAAGCTAGG - Intronic
1153071611 18:1112403-1112425 TGGAATAATGTCAATAGGATTGG + Intergenic
1153325988 18:3820720-3820742 TGGAATAATCTCAATGAGCTAGG + Intronic
1153325997 18:3820883-3820905 TGGAATAATCTCAATGAGCTAGG + Intronic
1153785714 18:8533051-8533073 TTGAAAACTCTCAATGAACTAGG + Intergenic
1155311311 18:24526661-24526683 TGGAATAATCCCAATGGTATGGG + Intergenic
1160597249 18:79984767-79984789 TAAAATAGTCTCAGTGAGCTGGG - Intronic
1161123384 19:2542511-2542533 AGGAAGAACCTGAATGAGCTGGG + Intronic
1162203451 19:9038055-9038077 TGGAGTAATCTCTAGGAGTTTGG - Intergenic
1163602967 19:18259727-18259749 TGGAATAACCACACTGATCTGGG + Intronic
1167005614 19:46774755-46774777 TGGAGTGATCTCAAAGTGCTGGG + Intronic
1168049854 19:53821331-53821353 TAAAATAATCACAATGAGCTGGG - Intronic
926616320 2:15000178-15000200 TGGCTTAATCTCACTGGGCTGGG + Intergenic
928168305 2:28986863-28986885 TGGAATATTCTCAATAACCTTGG + Intronic
930791502 2:55335758-55335780 TTAAATAATCTCAACAAGCTTGG + Intronic
931457608 2:62424544-62424566 TGGAATACTCACACAGAGCTTGG + Intergenic
931736786 2:65202094-65202116 TGGAATAATCTGAATAAGATTGG - Intergenic
933433201 2:82211594-82211616 TGGAATACTGTCAATGGGATTGG + Intergenic
933670115 2:84999093-84999115 TGGAGTAATCCCAAAGTGCTGGG + Intronic
935750209 2:106225516-106225538 TGGATAAATATCAAGGAGCTTGG + Intergenic
937030350 2:118733849-118733871 TTGAATAACTTGAATGAGCTTGG - Intergenic
939716152 2:145586661-145586683 TGAAATAATCTTATTGAGTTAGG + Intergenic
939997894 2:148937300-148937322 TGGGATGATCCCCATGAGCTGGG - Exonic
941108215 2:161386779-161386801 TGTAGTAATCACAATGATCTTGG - Intronic
941339200 2:164285468-164285490 TGGAATAATCTCATAGATATGGG - Intergenic
941358258 2:164518959-164518981 TGGAATAGTGTCAATGGGATTGG - Intronic
944315318 2:198278774-198278796 TGAAATATACTTAATGAGCTAGG + Intronic
946786599 2:223251750-223251772 TGCAATAAGCTAAATGAGTTTGG - Intergenic
947099631 2:226605934-226605956 TGGAAGAATCTCTATGTGCTTGG - Intergenic
1170726644 20:18934018-18934040 TGGAATAATCTCAATAGGATTGG + Intergenic
1170741328 20:19060020-19060042 TGGAATAATGTCAATAGGATTGG - Intergenic
1170970376 20:21110402-21110424 TGAAATAATGGCAATGACCTTGG + Intergenic
1171062222 20:21976770-21976792 TGGAATAATTTCAGTAAGATAGG + Intergenic
1172917802 20:38456672-38456694 TGGAACAATCACTATGTGCTGGG + Intergenic
1177306373 21:19322165-19322187 TGGAAAAATCTCAGTGAGAAAGG + Intergenic
1178038495 21:28612012-28612034 TGGAATAGTGTCAATAAGATTGG - Intergenic
1178733153 21:35123893-35123915 TGGAATAGTGTCAATGGGATTGG - Intronic
1179083857 21:38199355-38199377 TGGAATAGTGTCAATAAGATTGG + Intronic
1182199065 22:28551317-28551339 TGGAATAGTGTCAATAAGATTGG - Intronic
1183505525 22:38206678-38206700 GGGAATAATCACAATAATCTTGG - Intronic
1184390246 22:44199663-44199685 TAGAATAATCTCAAGGAGTCAGG + Intronic
950588206 3:13912627-13912649 TGGAATAATTTCAGTAAGATTGG - Intergenic
951294819 3:20921011-20921033 TGGAATAGTGTCAATAAGATTGG - Intergenic
952601782 3:35092165-35092187 TGGAATAGTGTCAATAAGATTGG - Intergenic
952623227 3:35371242-35371264 TGGAATAATTTCAGTAAGATTGG - Intergenic
953205241 3:40821816-40821838 TGGAAAATTTTCAATGAACTGGG + Intergenic
955949649 3:64229628-64229650 GGTAGTAATCTAAATGAGCTAGG - Intronic
956928658 3:74017531-74017553 TCTAATAACCTCAATGAGCAAGG + Intergenic
957592740 3:82221827-82221849 TGGAATACTTTCAATAAGATTGG + Intergenic
957613512 3:82498922-82498944 TGGAATAGTTTCAATAAGATTGG - Intergenic
959266053 3:104140235-104140257 CCCAATAATCTGAATGAGCTTGG + Intergenic
959424101 3:106164847-106164869 TGGAATAATATCAATAAGATTGG - Intergenic
962027754 3:131566588-131566610 TGGAATTATCTGCATGAGTTTGG - Intronic
963523448 3:146385667-146385689 TGCTATCATCTCAAAGAGCTGGG - Intergenic
964120122 3:153174457-153174479 TGGAATTAACTCAATGATCATGG + Intergenic
964186272 3:153947602-153947624 TGCAAAAATCTGAATGACCTTGG + Intergenic
967428347 3:189353220-189353242 TTGATTCATCTCATTGAGCTGGG - Intergenic
968887960 4:3345666-3345688 TGGCATCATCTCAACGCGCTGGG + Intronic
970115385 4:12688850-12688872 TGGCATGATCTCAAGTAGCTGGG - Intergenic
970200533 4:13600119-13600141 TGGCATCATCTCTACGAGCTCGG - Exonic
970283938 4:14488154-14488176 TGGAATAATGTCAATAGGGTTGG - Intergenic
971734423 4:30427934-30427956 TGGTATCATCTCAATGTGTTAGG + Intergenic
973831225 4:54761407-54761429 TGGAATAGTGTCAATGGGATTGG + Intergenic
974561489 4:63527900-63527922 TGTAATAATCCCTATGAGTTAGG + Intergenic
974581626 4:63811043-63811065 TTAAAAAATCTCAATGAGTTTGG - Intergenic
974951391 4:68586971-68586993 TGCAATGATCTGAATGAGATTGG + Intronic
976664236 4:87572930-87572952 TGCAATAAGCTGAATGAGCTTGG - Intergenic
976940339 4:90693557-90693579 TGGAATAAGCTTGATGACCTTGG + Intronic
978216585 4:106212763-106212785 AGTAATCATCTCAATGAGATTGG - Exonic
978559131 4:110013068-110013090 TAGAAAAATCTAAATTAGCTGGG - Intergenic
979169018 4:117575951-117575973 TGGCATCATCTCGATGATCTTGG + Intergenic
979589212 4:122459218-122459240 TGTAAAAATCTGAATGAGCTCGG + Intergenic
981204878 4:142028516-142028538 TGAACCAATCTCAATCAGCTAGG + Exonic
981881830 4:149622793-149622815 AGGAATAATGCCCATGAGCTGGG - Intergenic
982829002 4:160036829-160036851 TGGAATAATATCTATGATCATGG + Intergenic
988355440 5:30167967-30167989 TGGAATAGTGTCAATAAGATTGG - Intergenic
989306129 5:39958764-39958786 AAGAATAAGATCAATGAGCTAGG + Intergenic
989694094 5:44179217-44179239 TGGAATAGTCTCAATAGGATTGG + Intergenic
990320685 5:54627479-54627501 TTGAATACTCACTATGAGCTAGG - Intergenic
990691662 5:58370870-58370892 AGAAATAATCTCACTGAACTGGG - Intergenic
991050100 5:62263718-62263740 TGGAAGAATCTTATTCAGCTTGG - Intergenic
992219876 5:74561161-74561183 TGGCACGATCTCAATGATCTTGG - Intergenic
993138909 5:84005267-84005289 TGGAATAATATCAGTGGGATTGG - Intronic
993948281 5:94141097-94141119 TGGAATAGTGTCAATAAGATTGG + Intergenic
994636343 5:102348940-102348962 TGGAATAATTTCAATAGGATTGG - Intergenic
995992464 5:118258416-118258438 TGGAATATTCAAAATGAGCCTGG + Intergenic
996037165 5:118771342-118771364 TGGAAAAATCACAATGTGGTTGG + Intergenic
996495032 5:124145462-124145484 TGGAATAATGTCAATAGGATTGG + Intergenic
996963732 5:129282791-129282813 TGGAATATTTTCAATAAGGTTGG - Intergenic
997150922 5:131494125-131494147 TACAACAATCTCAATGAACTAGG + Intronic
999055197 5:148567481-148567503 TGGGATATTCTGCATGAGCTGGG - Intronic
1000688606 5:164285725-164285747 TGGAATAGTGTCAATAAGATTGG + Intergenic
1002162018 5:177319980-177320002 TTGAATAATTTCAATGGGTTTGG - Intergenic
1003476771 6:6490978-6491000 TGGAACAATCTGACTGAGATTGG + Intergenic
1004591547 6:17056455-17056477 TGGAATAATCTTCATGGGGTGGG - Intergenic
1007145727 6:39628202-39628224 TGGAAAAATCTGAATAAGATTGG - Intronic
1007694316 6:43722418-43722440 TGGAAAAATATTAAGGAGCTAGG - Intergenic
1009045627 6:58234205-58234227 TGGAATAATTTCAATAGGATTGG + Intergenic
1009221445 6:60988525-60988547 TGGAATAATTTCAATAGGATTGG + Intergenic
1009744500 6:67796058-67796080 TACAATAAGCTGAATGAGCTTGG + Intergenic
1009876661 6:69514390-69514412 TGGAATAATTTCAGTAAGATTGG - Intergenic
1010458914 6:76090711-76090733 TGGAATAGTGTCAATGGGATTGG + Intergenic
1010499136 6:76573294-76573316 TTGAATAATCACAAAGAGCAGGG + Intergenic
1011402145 6:86975217-86975239 TGGAATAAACTCAATGGAGTTGG - Intronic
1012183429 6:96183996-96184018 TGGAATAGTCTCAATAGGATTGG + Intronic
1012786491 6:103635044-103635066 TGGAATAATGTCAATAGGATTGG - Intergenic
1015362084 6:132351694-132351716 TGGAATAATGTCAAAAAGATTGG + Intronic
1018563941 6:165131675-165131697 TGGAATAATCTGAATGTGATTGG - Intergenic
1018755553 6:166846298-166846320 TGGAATAGTGTCAATAGGCTTGG - Intronic
1020354878 7:7265192-7265214 GCCAATATTCTCAATGAGCTTGG + Intergenic
1020608843 7:10370333-10370355 TGGAATAGTGTCAATAAGATTGG - Intergenic
1023367998 7:39484143-39484165 GGAAATAAACTCAGTGAGCTAGG - Intronic
1023573902 7:41604417-41604439 TGAAATAATTTCAATAAGATTGG + Intergenic
1023621895 7:42081941-42081963 TGGAATTTACTCAATCAGCTTGG + Intronic
1023621896 7:42081961-42081983 TGGAATCATCTCAATCAGCTAGG + Intronic
1024498867 7:50079197-50079219 AGATATAATCTCAATGAGGTAGG - Intronic
1024500724 7:50102397-50102419 TGCAACAATCTGAATGCGCTTGG - Intronic
1026466552 7:70659569-70659591 TGCAATAATCTCTAGGAGATAGG - Intronic
1027970992 7:85081529-85081551 TGGAATTATGTAAATTAGCTGGG - Exonic
1028250674 7:88536332-88536354 TGGAATAATGTCAATAGGATTGG + Intergenic
1028644779 7:93083364-93083386 TGGAATAGTTTCAATAAGATTGG - Intergenic
1028780777 7:94733812-94733834 TTGAAAACTCTCAATAAGCTAGG + Intergenic
1030771875 7:113485260-113485282 TGGAATACTCACATTGAACTTGG + Intergenic
1031611673 7:123835135-123835157 TGGAATAGTGTCAATAAGTTTGG + Intronic
1032929199 7:136646759-136646781 TGGAATACTCACAATTTGCTTGG - Intergenic
1033709083 7:143920076-143920098 TGAAATAATTTCAATAAGATTGG + Intergenic
1036213533 8:6861673-6861695 TGCATTCATCTCAATGAGCAGGG - Intergenic
1039666834 8:39543032-39543054 TGGAATAATTTCAGTCAGATTGG + Intergenic
1039810229 8:41040883-41040905 TGGAATAGTGTCAATAAGATTGG + Intergenic
1040639119 8:49311249-49311271 TGGAAGATGCACAATGAGCTTGG + Intergenic
1042088898 8:65137042-65137064 TGGAATAGTGTCAATAAGATTGG - Intergenic
1043086201 8:75836582-75836604 TAGAAGAATCTCTATGATCTAGG + Intergenic
1043596198 8:81888609-81888631 TGGTATAATCACATTGTGCTAGG + Intergenic
1043967783 8:86498347-86498369 TGGAATAATTTCAATAGGATTGG - Intronic
1044368056 8:91373777-91373799 TGGAATAGTTTCAATGAGCTTGG + Intronic
1045007598 8:97929760-97929782 TGGACTAATCTCATTGAGAGGGG - Intronic
1046389548 8:113551866-113551888 TAAGATAATCTCTATGAGCTGGG + Intergenic
1047606963 8:126484516-126484538 TGGAATAGTGTCAATAAGATTGG + Intergenic
1047685147 8:127297543-127297565 AAGAAGAATCTCAATGATCTGGG - Intergenic
1047901547 8:129427900-129427922 TGGAATAGTGTCAATCAGATTGG + Intergenic
1048179157 8:132179582-132179604 CTGAACAATCTCCATGAGCTTGG + Intronic
1049557800 8:143291707-143291729 GGGAAGAAGCTCGATGAGCTGGG - Exonic
1051556241 9:18385456-18385478 TGAAATAATCTCAAGGAGCAAGG - Intergenic
1052006382 9:23354531-23354553 TGGAATAGTGTCAATAAGATTGG + Intergenic
1055072285 9:72179030-72179052 TGGAAACATATCATTGAGCTCGG - Intronic
1058607777 9:106742123-106742145 TCCAGTAATCTGAATGAGCTTGG - Intergenic
1059287376 9:113186437-113186459 TGGAATAAAGTGGATGAGCTGGG + Intronic
1059363244 9:113764630-113764652 TGGAAGATGCTCACTGAGCTAGG + Intergenic
1186210106 X:7241866-7241888 TGCAACTATCTGAATGAGCTTGG - Intronic
1186761611 X:12729319-12729341 TCCAACAATCTGAATGAGCTTGG - Intergenic
1187803969 X:23097638-23097660 TGGAATAATTTCAATCGGATTGG - Intergenic
1187848973 X:23572079-23572101 TGGAATAATGTCAATAGGATTGG - Intergenic
1188428704 X:30080175-30080197 GGGGAAAATCTCAATGACCTTGG - Intergenic
1188947573 X:36325841-36325863 GGCAATAATCTCAATAATCTGGG + Intronic
1191670411 X:63743523-63743545 TGGAAACATCTCACTGATCTGGG - Intronic
1191768506 X:64729452-64729474 TTGAAAACTCTCAATAAGCTAGG - Intergenic
1192164245 X:68816154-68816176 TGGAATAGTGTCAATAGGCTTGG - Intergenic
1192609987 X:72558178-72558200 TGGAATAGTGTCAATAAGATTGG - Intronic
1193208403 X:78776452-78776474 TGGAATAATGTCAATAGGATTGG + Intergenic
1193776221 X:85645576-85645598 TGGAATAATTTCAGTGGGATTGG - Intergenic
1194058657 X:89168919-89168941 TGGAATAATTTCAATAGGATTGG - Intergenic
1194168362 X:90551097-90551119 TGGAATAATCTCAAAAGGATTGG - Intergenic
1194226235 X:91262086-91262108 GGGAATAATTTCAATAAGATTGG + Intergenic
1194564693 X:95470235-95470257 TGCAAAAACCTGAATGAGCTTGG + Intergenic
1194602383 X:95938284-95938306 TGGAATAGTGTCAATAAGATTGG + Intergenic
1194742646 X:97593258-97593280 TGGAATAATCTCAATGTCAATGG + Intronic
1196477788 X:116108882-116108904 TGGAATAGTTTCAATAAGATTGG + Intergenic
1197255539 X:124259083-124259105 CAGAATAATCTCAATGATCAGGG - Intronic
1198559599 X:137834783-137834805 TGGAATAATGTCAATAGGATTGG + Intergenic
1199087100 X:143640055-143640077 TGGAAAAACCTCAAAGATCTGGG - Intergenic
1199224129 X:145352791-145352813 GGGAAAAATCTGATTGAGCTGGG + Intergenic
1202070030 Y:20981878-20981900 TTAAATACTCTCAATGAACTAGG - Intergenic