ID: 1153328085

View in Genome Browser
Species Human (GRCh38)
Location 18:3842318-3842340
Sequence CTAAGTCATGTTTAAAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 312}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153328084_1153328085 -5 Left 1153328084 18:3842300-3842322 CCAGCTACATCATACTCTCTAAG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1153328085 18:3842318-3842340 CTAAGTCATGTTTAAAAGTTTGG 0: 1
1: 0
2: 0
3: 27
4: 312
1153328082_1153328085 -3 Left 1153328082 18:3842298-3842320 CCCCAGCTACATCATACTCTCTA 0: 1
1: 0
2: 0
3: 13
4: 168
Right 1153328085 18:3842318-3842340 CTAAGTCATGTTTAAAAGTTTGG 0: 1
1: 0
2: 0
3: 27
4: 312
1153328083_1153328085 -4 Left 1153328083 18:3842299-3842321 CCCAGCTACATCATACTCTCTAA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1153328085 18:3842318-3842340 CTAAGTCATGTTTAAAAGTTTGG 0: 1
1: 0
2: 0
3: 27
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153328085 Original CRISPR CTAAGTCATGTTTAAAAGTT TGG Intronic
902889766 1:19433978-19434000 CTAAAATATGTTTAAAACTTTGG - Intronic
905966299 1:42099636-42099658 TTAATTCTTCTTTAAAAGTTTGG - Intergenic
906679417 1:47715307-47715329 CTAGGTTATGTTGGAAAGTTTGG - Intergenic
906833282 1:49057507-49057529 AAAAGTCATGTTAAAGAGTTTGG - Intronic
907901597 1:58746515-58746537 ATATGTCATGCTTAAAAGTTTGG - Intergenic
908158839 1:61386062-61386084 CTAAGACATTTTTAAAAGGTTGG + Intronic
908265882 1:62378762-62378784 CTAACTCATCTCTAAAATTTGGG - Intergenic
908282766 1:62559766-62559788 GAAAGTCCTGTTTACAAGTTTGG + Intronic
910182111 1:84496395-84496417 CTAAGTCATTTTTAAAGTATGGG + Intronic
910785751 1:90996618-90996640 CTAAATAATGTTTAAAAATTAGG + Intronic
914978452 1:152389663-152389685 CTAATCCATGTTAAGAAGTTTGG - Intergenic
918493699 1:185110627-185110649 CTAAGTTATGTTTTACTGTTGGG - Intergenic
920143504 1:203838603-203838625 TTAAGCCATGTTAGAAAGTTTGG + Intronic
920644589 1:207791017-207791039 CTAGGTTATAATTAAAAGTTTGG + Intronic
921047444 1:211487566-211487588 CATATTCAAGTTTAAAAGTTGGG + Intronic
921278544 1:213543175-213543197 CTGAGTCTTGTTGAAAAGCTGGG + Intergenic
924281989 1:242447619-242447641 TTAAGTACTGTTTAAAAGGTTGG - Intronic
1063089806 10:2853241-2853263 CTAATTCAAATTTAAAAGTTTGG + Intergenic
1063322926 10:5068924-5068946 CTAAGTTATGTTCAAATATTAGG - Intronic
1063813148 10:9737905-9737927 TGAAATCATATTTAAAAGTTGGG - Intergenic
1063946496 10:11181210-11181232 CAATGTCATGGTTAAAAGTGGGG - Intronic
1065232840 10:23616224-23616246 CTAAGAAATTTTTAAAAGTAGGG + Intergenic
1066444779 10:35471952-35471974 GAAATTGATGTTTAAAAGTTTGG - Intronic
1067804446 10:49383304-49383326 CTAAGTCATGTTGGAAAGGGAGG - Intronic
1068237135 10:54251907-54251929 TTAAATTATTTTTAAAAGTTTGG - Intronic
1069775362 10:70924038-70924060 CGAAGTCATGTGGAAAATTTGGG + Intergenic
1071407709 10:85355028-85355050 CTCAGTCATGTTTAAAATCAAGG + Intergenic
1071745439 10:88413604-88413626 CTCAGTGATGCTTAATAGTTTGG - Intronic
1071953750 10:90734599-90734621 CTAAGTCATGTAGATCAGTTTGG + Intergenic
1073869103 10:107841448-107841470 TTAAGTCGTCTTTAAATGTTTGG - Intergenic
1073904320 10:108259949-108259971 CTCTGTCCTTTTTAAAAGTTTGG + Intergenic
1074934246 10:118162042-118162064 CAGAGTCATTTATAAAAGTTGGG - Intergenic
1075059847 10:119248568-119248590 CTAAGTCCTGTTTCAAAGCCAGG - Intronic
1075195333 10:120352432-120352454 CTAGTTCTTCTTTAAAAGTTTGG - Intergenic
1075596306 10:123732105-123732127 CCAAGCCATGATTAAAAGCTTGG - Intronic
1079586803 11:22135774-22135796 CTAAATCTTCTTTAAATGTTTGG - Intergenic
1080187793 11:29511532-29511554 AAAAGTCAAGTTTAAAAGTCAGG + Intergenic
1080740142 11:35056219-35056241 ATCAGTCTTTTTTAAAAGTTGGG + Intergenic
1080805169 11:35646569-35646591 CTACGGCATGTTTAAAACTAGGG - Intergenic
1082651842 11:55803860-55803882 CTAAGTTATTTTTACAAGGTTGG + Intergenic
1086081086 11:82902544-82902566 GTAAGTCATGTTAAAGAGTTTGG - Intronic
1087589777 11:100172819-100172841 CTATGTCATGCTAAGAAGTTTGG + Intronic
1087714272 11:101590180-101590202 CTAATTCTTCTTTAAATGTTTGG - Intronic
1087814175 11:102640696-102640718 TTAGGATATGTTTAAAAGTTTGG - Intergenic
1089280074 11:117368032-117368054 CTTATTCATATTTAACAGTTTGG + Intronic
1089547082 11:119236431-119236453 CTAAGTCATATTTCAATGTATGG + Intronic
1090508797 11:127349362-127349384 CAAAGACATGTTTAACACTTAGG - Intergenic
1092290035 12:7154700-7154722 CCATGTAATCTTTAAAAGTTTGG + Intronic
1092937849 12:13380426-13380448 TTAAGAGATGTTTAAAAGATGGG - Intronic
1094228503 12:28075405-28075427 CTAATTCTTCTTTAAATGTTTGG - Intergenic
1094327371 12:29255490-29255512 TTAAGTTATTTTTAAAAGTGTGG - Intronic
1094759721 12:33516957-33516979 CTAAATCATGTCTAAATTTTCGG + Intergenic
1096401403 12:51309736-51309758 TTAAGTGATGTTTAAATGGTGGG + Intronic
1097447501 12:59690236-59690258 GAAAATCATATTTAAAAGTTTGG + Intronic
1097447838 12:59695178-59695200 CTAAGGCATATCTAAAAATTAGG - Intronic
1098851047 12:75596487-75596509 CTAAGCAATGTTTAAAAATTTGG + Intergenic
1099684935 12:85872892-85872914 CTAAGTAATTATTAAATGTTTGG + Intergenic
1100070805 12:90715017-90715039 CTCAGTCATGTTTAAAAAGTGGG + Intergenic
1100627353 12:96348874-96348896 TTAATTCATCTTTAAATGTTTGG - Intronic
1100683912 12:96964179-96964201 CTAATTCTTCTTTAAACGTTTGG - Intergenic
1100733759 12:97503222-97503244 TAAAGTCCTATTTAAAAGTTGGG - Intergenic
1100780175 12:98016722-98016744 CTAAGTCTTATTTAAATGTCTGG - Intergenic
1101548482 12:105739408-105739430 AAAAGTCATGCTTAAAAGATAGG - Intergenic
1101745137 12:107534854-107534876 TTAATTCTTCTTTAAAAGTTTGG - Intronic
1105447884 13:20473354-20473376 CTCACTGATGTTTAAAAGTCTGG - Intronic
1106378497 13:29212929-29212951 CCAAGTCATGATTAGAAGCTTGG - Intronic
1106978931 13:35255146-35255168 ATAAGTAATGTTTTAGAGTTTGG - Intronic
1107181427 13:37464859-37464881 CTAATTCTTCTTTAAATGTTTGG + Intergenic
1107486904 13:40836689-40836711 CTAAATGAAATTTAAAAGTTAGG + Intergenic
1107615419 13:42161975-42161997 TTAAGAAATGTTTAAAAGTTAGG - Intronic
1107778011 13:43867424-43867446 CTAGGACAGGTTTAAAGGTTAGG - Intronic
1108037029 13:46301490-46301512 TTAAGTCTTCTTTAAAAGTCTGG - Intergenic
1108966902 13:56319014-56319036 CTAAGTCATGTTTCAAAATAGGG + Intergenic
1109035438 13:57253575-57253597 CTAAGTCATTTTTATGAGTTGGG - Intergenic
1110232959 13:73185675-73185697 CTAAATCATCTTTAAAATCTAGG - Intergenic
1110373164 13:74762120-74762142 CTCAGTTATGTTTAAAAAATTGG - Intergenic
1110412183 13:75216345-75216367 CTAGGTCATTTTTAAACGTCTGG - Intergenic
1110503392 13:76255321-76255343 CTAACTTGTCTTTAAAAGTTTGG + Intergenic
1110775312 13:79402520-79402542 TTGAGTCATGTTTAAGACTTTGG - Intronic
1110908775 13:80928414-80928436 ATATGACATGTATAAAAGTTTGG + Intergenic
1110950779 13:81487643-81487665 CCAAGACATGATTAAAACTTTGG - Intergenic
1113302506 13:109037510-109037532 GTAAGTCATGTATAAAACTCTGG + Intronic
1114305428 14:21419056-21419078 CTACGTCATTTTAAAAAGTCTGG + Intronic
1116401959 14:44518161-44518183 TTAATTCTTGTTTAAAGGTTTGG + Intergenic
1116493326 14:45532069-45532091 ATAACTTATGCTTAAAAGTTTGG - Intergenic
1118141883 14:63093012-63093034 CTAAGACATGATTAGAGGTTTGG + Intronic
1118223199 14:63874736-63874758 TTTAGCAATGTTTAAAAGTTTGG + Intronic
1118754856 14:68833704-68833726 TTAATTCTTGTTTAAATGTTTGG + Intergenic
1119922633 14:78460380-78460402 CTAAGGCATGATTAGAGGTTTGG - Intronic
1120254312 14:82098931-82098953 ATAAGTCATGTTCTAAATTTTGG + Intergenic
1120400648 14:84026304-84026326 CTAAGTTATTTTTAAATGATTGG + Intergenic
1121594372 14:95148292-95148314 CTAAGGCATGATTAGAGGTTTGG - Intronic
1123100889 14:105799393-105799415 GTAAGTCTTGCATAAAAGTTGGG - Intergenic
1124553369 15:30703952-30703974 TTAATTCATATTTAAATGTTTGG + Intronic
1124677876 15:31701716-31701738 TTAATTCATATTTAAATGTTTGG - Intronic
1124867258 15:33504657-33504679 CTAAGCCATGTTTAGGAATTTGG - Intronic
1125802560 15:42463097-42463119 TTAAAACATTTTTAAAAGTTTGG - Intronic
1127011018 15:54628491-54628513 CTAATTCATGTTAAACTGTTAGG + Exonic
1127197653 15:56606952-56606974 CTAATTCTTCTTTAAATGTTTGG + Intergenic
1132365687 15:101254595-101254617 CTAAGTAATTTTTAAAGGTAAGG + Intergenic
1133799760 16:9075536-9075558 CTAAGACATTTTTAGAACTTAGG + Intergenic
1134164767 16:11921069-11921091 CCAAGTCATGATTAGAAGCTTGG - Intergenic
1138783548 16:59818119-59818141 TTAGTTCATGTTTAAATGTTTGG - Intergenic
1139875860 16:70145446-70145468 CCAAGTCATCCTTAAAAATTAGG - Intronic
1140114872 16:72033349-72033371 CTAAGATATTTTTAAAATTTAGG + Intergenic
1140359928 16:74335652-74335674 CCAAGTCATCCTTAAAAATTAGG + Intergenic
1141275527 16:82584415-82584437 CTAAGTGATGATTCAAATTTGGG + Intergenic
1141337500 16:83170822-83170844 GTCACTCATGTTGAAAAGTTTGG - Intronic
1203137400 16_KI270728v1_random:1737200-1737222 CTAGGTCCTGTTTATAATTTGGG - Intergenic
1143213623 17:5207923-5207945 GTAAGCCATGTTAAAGAGTTTGG + Intergenic
1145744993 17:27311149-27311171 CCAAGACATTTTTAAAAGCTAGG - Intronic
1149930811 17:60753314-60753336 AAAAGTCATGATTTAAAGTTAGG - Intronic
1153073573 18:1134842-1134864 CTGGAACATGTTTAAAAGTTAGG - Intergenic
1153328085 18:3842318-3842340 CTAAGTCATGTTTAAAAGTTTGG + Intronic
1153380462 18:4433421-4433443 CTAAGTGGTTTTTAGAAGTTTGG - Intronic
1154280605 18:12999040-12999062 TTAGGACATATTTAAAAGTTTGG - Intronic
1155109331 18:22698427-22698449 CTTAGTCATTTTTAGAAGATTGG - Intergenic
1155469752 18:26178749-26178771 CTAAGTAAAGTTTAGAGGTTTGG - Intronic
1157376430 18:47171449-47171471 TTAAGTCTTCTTTAAATGTTTGG + Intronic
1157512862 18:48290984-48291006 TCAAGTCATATTTAAAAGTTTGG + Intronic
1158026800 18:52908015-52908037 CTAAGTCAGTCTTACAAGTTCGG - Intronic
1159401134 18:67936261-67936283 ACAAGACATGTTAAAAAGTTAGG - Intergenic
1159616556 18:70586883-70586905 TTAATTCATCTTTAAATGTTTGG - Intergenic
1159691153 18:71489161-71489183 CTCCGTCGTGTTTAAAAGTAAGG + Intergenic
1159821910 18:73155755-73155777 CTAAGTCATATTATAAAGCTGGG + Intronic
1160562628 18:79768998-79769020 CTAAGTGATATTTAAACATTTGG + Intergenic
1163696551 19:18766904-18766926 TTAATTCCTCTTTAAAAGTTTGG + Intronic
1165647105 19:37450226-37450248 TTAATTCATCTTTAAATGTTTGG + Intronic
1166233632 19:41440584-41440606 CCACGTCATTTTTAAAAATTAGG + Intronic
1166517436 19:43457898-43457920 CTGAGTCATGTACCAAAGTTAGG + Intergenic
926661181 2:15468818-15468840 CAAAGGCATTTATAAAAGTTAGG - Intronic
927204924 2:20601896-20601918 GTAAGTTATGTTGAAGAGTTTGG + Intronic
928149017 2:28810055-28810077 ACAAGGCATGTTTAAAAATTAGG + Intronic
928611326 2:32995016-32995038 CTAAGTATTTTTTAAAAGATGGG - Intronic
928643620 2:33327234-33327256 CTATTTCATGTTCAAAAGATAGG - Intronic
928925357 2:36573167-36573189 CTAAGTCTTGTTGAGAAGATAGG - Intronic
930726219 2:54684221-54684243 CTAAATAAGGTTTAAAATTTTGG + Intergenic
930765789 2:55084032-55084054 CCAACCCATGATTAAAAGTTTGG + Intronic
930845269 2:55896862-55896884 GCCAGTCATGTTTTAAAGTTTGG - Intronic
931143926 2:59495595-59495617 CTAAGTCATTTTTCATATTTAGG + Intergenic
931601326 2:64006014-64006036 CTCAGTCATTTTAAAAAGGTGGG + Intronic
931893744 2:66705113-66705135 CTAAGTCATTTTTAGGAGTGAGG - Intergenic
932059452 2:68481191-68481213 ATTAGTCTTTTTTAAAAGTTTGG + Intronic
933588909 2:84209813-84209835 ATAATACATTTTTAAAAGTTTGG + Intergenic
935068241 2:99670626-99670648 ATTAGTCTTGTTTAAAAGTATGG + Intronic
935522435 2:104124095-104124117 CTATATCATGTTCAAAAGTAGGG - Intergenic
936147815 2:109993176-109993198 CTAGGTCCTGTTTATAATTTGGG + Intergenic
936196876 2:110378271-110378293 CTAGGTCCTGTTTATAATTTGGG - Intergenic
936667785 2:114617324-114617346 CTTATACATGTCTAAAAGTTGGG - Intronic
936990518 2:118359818-118359840 TTAAGTCTTCTTTAAATGTTTGG + Intergenic
937536191 2:122890872-122890894 CTAACTCTTCTTTAAATGTTTGG - Intergenic
937837075 2:126482620-126482642 CAAAGTAATGGTTAAAAGTGAGG + Intergenic
939121518 2:138123328-138123350 ATAAGTCATGTTATGAAGTTTGG + Intergenic
939854154 2:147337107-147337129 GTCAGTCACTTTTAAAAGTTAGG + Intergenic
940336199 2:152530070-152530092 TTAAGTCATTTTTAAAAGGTGGG - Intronic
940570379 2:155425216-155425238 TTAATTCTTCTTTAAAAGTTTGG + Intergenic
941087818 2:161138493-161138515 CCAAGTCATTTTTAGAAGCTAGG + Intronic
941199026 2:162486406-162486428 CTAAATGATTTTTAAAAGATAGG + Intronic
941659877 2:168184830-168184852 GTAAGTGATGATCAAAAGTTTGG + Intronic
943236386 2:185325820-185325842 AAAAGTCATTTTTAAAAGTCTGG - Intergenic
943236722 2:185331160-185331182 CTAGTTCTTCTTTAAAAGTTTGG + Intergenic
943349738 2:186783205-186783227 TTAATTCTTCTTTAAAAGTTTGG - Intergenic
944061764 2:195576976-195576998 CTAAGTCATAATTATAACTTGGG - Intronic
945031783 2:205671841-205671863 CTTAGTCATGTTAAAAATTTGGG + Intergenic
945773780 2:214079491-214079513 ATAAGCCATGTTAGAAAGTTTGG + Intronic
947883062 2:233537422-233537444 CAAAGTCTTTTTTAAAATTTTGG - Intronic
948324843 2:237106905-237106927 CTAATTTTTGTTTAAATGTTTGG - Intergenic
1169789508 20:9394434-9394456 CTCAGTCATGTTAAAAATGTGGG - Intronic
1170376077 20:15701295-15701317 ATAAGTCATGTACAAAAGTATGG + Intronic
1170410520 20:16085344-16085366 TTAATTCTTCTTTAAAAGTTTGG - Intergenic
1170960225 20:21019023-21019045 CTAAGTCCCCTTTTAAAGTTCGG - Intergenic
1173107011 20:40146601-40146623 CAAAGTCATTTATGAAAGTTAGG + Intergenic
1173720070 20:45250267-45250289 TTAACTCTTCTTTAAAAGTTTGG - Intergenic
1175725418 20:61315028-61315050 CTGAGTCATGTTTAAAATAAAGG - Intronic
1176945005 21:14969193-14969215 ATAAGTCATGGTAAAAAGTATGG - Intronic
1177376692 21:20279550-20279572 CCAAGTCATGATTAGAAGTTTGG - Intergenic
1180552217 22:16549752-16549774 CTAGGTCCTGTTTATAATTTGGG - Intergenic
949921183 3:9002996-9003018 CTAATTCTTTTTTAAATGTTTGG - Intronic
950160876 3:10760128-10760150 CTAAGGTATGATAAAAAGTTTGG - Intergenic
950876740 3:16282306-16282328 CAGATTCATGTTTAAAAGTATGG - Intronic
951285859 3:20812985-20813007 AGAAGTCATAATTAAAAGTTTGG - Intergenic
951843196 3:27057418-27057440 CTATGTCATGTTTCAAATCTTGG + Intergenic
952515641 3:34102335-34102357 CTAAGTCATATAAAGAAGTTGGG - Intergenic
953208301 3:40851574-40851596 CAAAGTCTGGTTGAAAAGTTTGG - Intergenic
956772131 3:72535561-72535583 TTAATTCATTTTTAAAAGTTGGG - Intergenic
957448881 3:80350232-80350254 CAAATTCAAGTTTGAAAGTTTGG + Intergenic
958700699 3:97585430-97585452 CTGAGTTATTTTTAAAACTTTGG - Intronic
959679258 3:109074113-109074135 CTAAGTAATGTTTTAAAATTAGG - Intronic
959909423 3:111747001-111747023 CTAAGTCTTGATTTATAGTTTGG - Intronic
960133512 3:114082795-114082817 GTAAGAAATTTTTAAAAGTTTGG + Intronic
960297244 3:115959306-115959328 CTAAATCATGCCTAAAATTTTGG - Intronic
960478119 3:118156126-118156148 TTAATTCCTCTTTAAAAGTTTGG - Intergenic
960857942 3:122122538-122122560 GGAACTTATGTTTAAAAGTTTGG + Intergenic
963440937 3:145338762-145338784 TTAAGTCATTTTTGGAAGTTGGG + Intergenic
964022202 3:152026092-152026114 CTAATGTATGTTTAAAAGATGGG + Intergenic
964097957 3:152955296-152955318 CTATGCCATGTTTAGAGGTTTGG - Intergenic
964392679 3:156213885-156213907 CTAAGCCATGATTAGAAGCTTGG + Intronic
965133240 3:164727908-164727930 CAAAATCATTTTTAAAAGTAGGG + Intergenic
965287602 3:166837312-166837334 CCAAGTCATGATTAGAAGCTTGG + Intergenic
965815575 3:172633299-172633321 CAAATTCATTTTTAAAAATTAGG + Exonic
966041743 3:175499320-175499342 CTAAGTAAAGTTTAAATGTTTGG - Intronic
966573033 3:181468233-181468255 CTGAGCCATGATTAGAAGTTTGG - Intergenic
967292843 3:187937992-187938014 ATAAGTCATGTATAAAACTGTGG + Intergenic
967433009 3:189410296-189410318 TTAATTCATGTATAAAAGTATGG - Intergenic
967575391 3:191084481-191084503 TTAAGTCTTGGTTAAAAGTTGGG - Intergenic
968938984 4:3628243-3628265 CTAGTTCCTGTTTAAAAGTCAGG + Intergenic
969145279 4:5118133-5118155 CTAATTCTTCTTTAAATGTTTGG + Intronic
969166391 4:5319492-5319514 GTAAGTCATGATAAGAAGTTTGG - Intronic
971786419 4:31109173-31109195 CTAAGCCTAGTTTAAAAGGTAGG + Intronic
972190264 4:36583020-36583042 CAAAATCATGTTGAAGAGTTGGG + Intergenic
973232343 4:47855912-47855934 TTAAGTCATGTCTTAAAGTGTGG - Intronic
973239185 4:47939148-47939170 CTAAGTTATGTTTAGAAGCTTGG + Intronic
973845323 4:54906315-54906337 CTAATTCTTCTTTAAATGTTTGG - Intergenic
978054193 4:104242884-104242906 CTATGACATGTTTAAATATTTGG + Intergenic
980368028 4:131831861-131831883 CTGAGACATGTTTAAAACTGAGG + Intergenic
981231116 4:142356818-142356840 CCAAGGCATGGTTACAAGTTTGG + Intronic
981643591 4:146973107-146973129 CTAAGCCATGATTATAAGCTTGG - Intergenic
981950448 4:150400172-150400194 CCAAGTCATGTTGTAAAGCTGGG + Intronic
983437969 4:167740234-167740256 CTAAATTATGTTTCAATGTTAGG + Intergenic
984537567 4:180995820-180995842 GTAAGACATGCTAAAAAGTTTGG + Intergenic
985036581 4:185846559-185846581 CTCAGTCATGTTTTAAAGTCAGG - Intronic
986116529 5:4780700-4780722 ATAATTTATGTTTAAAAGATGGG + Intergenic
986508687 5:8479760-8479782 GTATGTCATTTTTAAAATTTGGG + Intergenic
986797786 5:11229217-11229239 ATAAGGCATGTTTAAAAATGAGG + Intronic
990087406 5:51995691-51995713 CTGAGTCATGTTGAAAAATTTGG + Intergenic
990112340 5:52342718-52342740 CTATGCCATGTGTAAAACTTGGG + Intergenic
990185983 5:53209671-53209693 TAAAGTCATGTTTAAATGCTTGG - Intergenic
990887736 5:60614261-60614283 TAAAGTGATTTTTAAAAGTTGGG - Intronic
991132204 5:63135825-63135847 TAAAGTCATGTTTACAGGTTAGG - Intergenic
993044532 5:82852511-82852533 TTAAGGCAGGTTTAAATGTTGGG - Intergenic
993372312 5:87108156-87108178 CTAAGTCCAGGTTAAATGTTTGG - Intergenic
994030040 5:95131011-95131033 CTAACCCATGCTTAAAAATTAGG + Intronic
994247498 5:97496678-97496700 CTCAAACATGTTTAAAAGTAAGG + Intergenic
994608128 5:101997170-101997192 CTTATTCATGTTTAGAACTTTGG - Intergenic
995029865 5:107467983-107468005 CTATGTCATAATTGAAAGTTTGG - Intronic
995051320 5:107708030-107708052 CTCAGTCATTTTTACAAATTAGG - Intergenic
995160773 5:108978168-108978190 CTTTGTCATGTTTAGATGTTTGG + Intronic
995244109 5:109918051-109918073 GGAAGTTATGTTTAAAAGTCTGG + Intergenic
995268808 5:110196871-110196893 TTAATTCTTCTTTAAAAGTTTGG - Intergenic
996906144 5:128602689-128602711 TTAAGTCTTCTTTAAATGTTTGG + Intronic
996927863 5:128849970-128849992 TTAAGTCATCTTTAAATTTTTGG - Intronic
997053709 5:130414176-130414198 CTAAGTCTGGTTTAAAATGTTGG - Intergenic
1001800167 5:174536253-174536275 CTAATTCTTCTTTAAATGTTTGG - Intergenic
1002556007 5:180041191-180041213 CTAAGGAAAATTTAAAAGTTTGG + Intronic
1003013134 6:2445108-2445130 CTGAGGCAGGTTTAAAGGTTTGG - Intergenic
1003702430 6:8482792-8482814 CTTAATCATGTTTAAAAATATGG + Intergenic
1004044950 6:12013769-12013791 CTAAGTGATCTATAAAAGATAGG - Intronic
1005087714 6:22023843-22023865 CTAATTCCTGCTTAAAAGTCTGG - Intergenic
1005367698 6:25095807-25095829 CTATTTCATGTTTAAAACATTGG + Intergenic
1006267740 6:32939237-32939259 CCAAGTCATGATTAGAAGTCTGG + Intronic
1007361780 6:41362536-41362558 TTAATTCCTTTTTAAAAGTTTGG - Intergenic
1007429639 6:41769372-41769394 TAAAGTCCTGTTTAAAGGTTTGG + Intergenic
1008483953 6:52015182-52015204 CTAAGTCACCTTTAAAAATTAGG - Intronic
1009409205 6:63346263-63346285 CTAAGTCATGATTTAAAGCCTGG + Intergenic
1010023847 6:71193169-71193191 CTAAGCCATGATTAAAAGTCTGG + Intergenic
1010547468 6:77175107-77175129 CTAACTCATGTTATAAAGTCAGG - Intergenic
1011756434 6:90502860-90502882 CTAAGCCATGTTTAAAACTAAGG + Intergenic
1012394890 6:98785097-98785119 TTATACCATGTTTAAAAGTTTGG + Intergenic
1013690434 6:112635274-112635296 CGAAGTCATGATTCAAAGTCAGG - Intergenic
1014002232 6:116377286-116377308 CAAATTCCTTTTTAAAAGTTAGG - Intronic
1016580114 6:145619968-145619990 TTAAGCCATGTTTATATGTTAGG - Intronic
1017348953 6:153417372-153417394 ATAAGATATTTTTAAAAGTTAGG - Intergenic
1018767703 6:166946586-166946608 CAAAGTCATCTTTAAAATTAAGG - Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1019086995 6:169487820-169487842 TTCAGTCATGGTTAATAGTTTGG + Intronic
1020806763 7:12799564-12799586 CTAAGTGGGTTTTAAAAGTTGGG - Intergenic
1020818884 7:12940527-12940549 CTAAACCATGTTAAAGAGTTAGG - Intergenic
1023035541 7:36128340-36128362 CTCAGTGAGGTTTAAAAATTTGG - Intergenic
1024136878 7:46417960-46417982 CTAAGTCATGTGAAAATGTAAGG + Intergenic
1024328781 7:48135679-48135701 CTAAATTATGTTGAAATGTTAGG - Intergenic
1026218330 7:68369328-68369350 CTAAGCCATGGTTAGAAGCTTGG + Intergenic
1026677351 7:72438919-72438941 TTAAGGAATGTTGAAAAGTTAGG - Intronic
1027538844 7:79442142-79442164 AGAAGTCAGATTTAAAAGTTTGG - Intronic
1027671531 7:81105410-81105432 TAAAGCCATGTTCAAAAGTTTGG + Intergenic
1028427616 7:90707586-90707608 GTAAGCCATGCTAAAAAGTTGGG - Intronic
1028609556 7:92694990-92695012 CTACGACATATTAAAAAGTTTGG + Intronic
1028961302 7:96752203-96752225 CCAAGAGATGATTAAAAGTTAGG + Intergenic
1030190482 7:106805743-106805765 CCAAGTCATTTGTAGAAGTTGGG + Intergenic
1030584417 7:111399738-111399760 CTACTACATGTTTAAAAGGTAGG - Intronic
1031014963 7:116563825-116563847 CTACTTTTTGTTTAAAAGTTGGG + Intergenic
1032754321 7:134874112-134874134 TTAAGTTATTTTTAAAAATTTGG + Intronic
1033004764 7:137549441-137549463 TTAATTCATCTTTAAAAATTAGG - Intronic
1037124940 8:15336837-15336859 ATAATCCATGTTTAAATGTTTGG - Intergenic
1038041819 8:23729664-23729686 CTAAGTCAAGATTAGAATTTAGG - Intergenic
1039725988 8:40217245-40217267 CTAAAACATTTTTAAATGTTTGG - Intergenic
1041522158 8:58768669-58768691 ATAAGACATGATCAAAAGTTTGG + Intergenic
1041569059 8:59315202-59315224 CTCACACATTTTTAAAAGTTAGG - Intergenic
1042990136 8:74630047-74630069 CGAAGGCATGTTCAAAAGCTAGG + Intronic
1043006555 8:74826451-74826473 ATAAGTTATATTAAAAAGTTTGG + Intronic
1045308155 8:100976887-100976909 CTAAGTCATAATTAACAGTAAGG - Intergenic
1045366164 8:101478113-101478135 CTAAGCCATGTCTAAACATTTGG - Intergenic
1046123686 8:109877542-109877564 TTAAGTCAAGGTAAAAAGTTTGG + Intergenic
1046241519 8:111501717-111501739 TTAAGACATGTAAAAAAGTTGGG - Intergenic
1046241959 8:111508268-111508290 CTTAGCAATGTTTAAAATTTTGG + Intergenic
1046437985 8:114218872-114218894 TTAAGTTATGTGTAAAAGTGTGG + Intergenic
1046679414 8:117152010-117152032 CTATGTAATTTTTAAAAATTAGG + Intronic
1046829647 8:118730432-118730454 GTAAATCATGGTAAAAAGTTAGG - Intergenic
1048361217 8:133698517-133698539 CTAAATATTGGTTAAAAGTTAGG - Intergenic
1049984214 9:933224-933246 CTAAGCCTTGATTAAAAGCTTGG - Intronic
1050343872 9:4666921-4666943 CTTAAACATATTTAAAAGTTAGG + Intergenic
1051647931 9:19288578-19288600 CTAATTCATGTTTTACAGTGGGG + Exonic
1053632380 9:39957566-39957588 CTGAGACATGTTTAAAACTGAGG + Intergenic
1053773381 9:41505965-41505987 CTGAGACATGTTTAAAACTGAGG - Intergenic
1054211508 9:62293131-62293153 CTGAGACATGTTTAAAACTGAGG - Intergenic
1054451763 9:65407077-65407099 CTAATTCCTGTTTAAAAGTCAGG - Intergenic
1055094930 9:72402635-72402657 ACAAGTAATTTTTAAAAGTTAGG - Intergenic
1056287367 9:85104071-85104093 TTAATTCATCTTTAAATGTTAGG + Intergenic
1057944553 9:99313850-99313872 ATAAGGCAGGTTTAAAAGTCTGG - Intergenic
1058554964 9:106157379-106157401 CTAAGTCATGTTAAGAAGGAAGG - Intergenic
1059825432 9:118023275-118023297 CTAACTCATGGTTATAACTTAGG - Intergenic
1060129564 9:121081906-121081928 CTAAGGCATGTTTAGAGGGTTGG - Intronic
1060763253 9:126274201-126274223 GTCATTCATGTTTAAAAGTGTGG + Intergenic
1188144893 X:26599445-26599467 CTCAGTCATCTTTAATATTTTGG + Intergenic
1188209343 X:27401866-27401888 GTCATTCATGTTTAAAACTTTGG + Intergenic
1188386028 X:29559403-29559425 TTAATTCTTCTTTAAAAGTTTGG + Intronic
1188858343 X:35224953-35224975 CTCAGTTATTTTTAAAATTTAGG + Intergenic
1189883733 X:45518353-45518375 CTAAGTATTGTTTAGAAATTTGG - Intergenic
1190429392 X:50364835-50364857 CTTAGTCGTGTTTAATAGGTAGG - Intergenic
1190684229 X:52856237-52856259 GTATGTCATGTTGAAAAGCTTGG + Intergenic
1191143015 X:57135610-57135632 CTTTGTCTTGTTGAAAAGTTCGG - Exonic
1192255711 X:69456049-69456071 CTAATTCATCCTTAAATGTTTGG + Intergenic
1194141152 X:90211592-90211614 ATAAGTCTTATTTAAATGTTTGG - Intergenic
1194350523 X:92820927-92820949 CTAAATTATGTTCAAATGTTAGG - Intergenic
1194412718 X:93577398-93577420 CTTAGTTTTGTTTAAAAGTTTGG - Intergenic
1196177290 X:112653259-112653281 CTAAGTAATGGTTGAAAGCTAGG + Intronic
1196181536 X:112696888-112696910 CTAATTCCTCTTTAAATGTTTGG + Intergenic
1196610180 X:117705099-117705121 ATAAGTCATGTTCAAAAAGTAGG + Intergenic
1196696997 X:118623990-118624012 CTAAGTCAATTTTAAGACTTGGG - Intronic
1196734553 X:118973165-118973187 TTAAGTCATGTTTCAGAGTTGGG - Intergenic
1197128858 X:122980167-122980189 ATGAATCATGTTTAGAAGTTTGG + Intergenic
1197136558 X:123067176-123067198 CAAAATCATGTTGAAAAGATCGG - Intergenic
1197173680 X:123462315-123462337 GTAGGTCATGGTAAAAAGTTTGG - Intronic
1197449777 X:126597606-126597628 CTAAGCCATGCTCAAGAGTTTGG - Intergenic
1198228927 X:134671311-134671333 GTAAAACATGTTTAAAAGTGGGG + Intronic
1198971628 X:142287507-142287529 CAAAGTCTTGTTTAAATGTCTGG - Intergenic
1199037577 X:143071289-143071311 CTAAGTCATGTTAATAATTGTGG + Intergenic
1199584670 X:149401843-149401865 TTAACTCATCTTTAAATGTTAGG + Intergenic
1200486911 Y:3780706-3780728 ATAAGTCTTATTTAAATGTTTGG - Intergenic
1200658838 Y:5937567-5937589 CTAAATTATGTTCAAATGTTAGG - Intergenic