ID: 1153328794

View in Genome Browser
Species Human (GRCh38)
Location 18:3850561-3850583
Sequence TAGGGCCCCCAAAATCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153328794 Original CRISPR TAGGGCCCCCAAAATCAACC TGG Intronic
902737590 1:18411436-18411458 TAGGGCCCCCAAGCTCAGCCTGG - Intergenic
903322555 1:22551737-22551759 AACGGCCCCCAAAATACACCTGG - Intergenic
903889344 1:26559051-26559073 TAGGGCCTCCAACATAAAACAGG + Intronic
905775705 1:40665814-40665836 TAGGTCCCCCAACCACAACCCGG - Intergenic
906526234 1:46494781-46494803 GAGGGCCCCCAAAGTGAACCTGG - Intergenic
907424856 1:54373166-54373188 CAGGGCCCCCAGAACCAACAGGG + Intronic
909348793 1:74624321-74624343 TAGGGCCACCAGCATCAACATGG - Intronic
915044701 1:153002355-153002377 TAAGGCTCCCACAATCCACCTGG - Intronic
915180384 1:154053881-154053903 TAGGGTCTCCACAACCAACCTGG + Intronic
916762582 1:167830739-167830761 TTGGGCCCCCAAAATCACTAAGG + Intronic
917835346 1:178937459-178937481 TTGGGCCCCCAAAACCAAAATGG - Intergenic
920273261 1:204783265-204783287 GAGAGCCTCCAAAATCTACCTGG + Intergenic
922087388 1:222363860-222363882 TAGGACCACCCAAAGCAACCAGG + Intergenic
923907443 1:238401301-238401323 TAGGGCTCGAAAACTCAACCAGG + Intergenic
1064637089 10:17379444-17379466 TTGGGCCCCCAAAATCACTAAGG + Intronic
1067673049 10:48343400-48343422 TAGGGCCCACAAGATAATCCAGG + Intronic
1069600969 10:69707726-69707748 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1071955188 10:90749909-90749931 CACAGCCACCAAAATCAACCAGG + Intronic
1075991172 10:126840122-126840144 TCAGGCCCCCAAAATCACTCAGG + Intergenic
1076670390 10:132117739-132117761 TAGGGTCCTCAAAACCAACAGGG - Intronic
1077565397 11:3295703-3295725 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1078070283 11:8104118-8104140 TAGGGCCCCTAGAAACCACCTGG + Exonic
1079323583 11:19472730-19472752 TAGCACCGCCTAAATCAACCAGG - Intronic
1080319448 11:30989422-30989444 TAGGGCTCTCAGATTCAACCTGG - Intronic
1085273194 11:75282392-75282414 TAGGCCCACCAAAATCATCCAGG - Intronic
1085360569 11:75881565-75881587 TTGGGCCCCCAAAATCATTAAGG - Intronic
1088727505 11:112652657-112652679 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1088732915 11:112699237-112699259 GAGGGCCCCCAGACTCAACCTGG - Intergenic
1089163904 11:116460243-116460265 AATGGCCCCCAAATTCAATCAGG + Intergenic
1093072151 12:14716735-14716757 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1102602468 12:114042402-114042424 TAGGGCTCCCAGAATGAACAAGG - Intergenic
1104687725 12:130799570-130799592 CGGGGCCCCCAAAATCAAAAAGG + Intronic
1105714970 13:23054081-23054103 TTGGGCCCCCAAAATCACTGAGG - Intergenic
1105748678 13:23401185-23401207 TTGGGCCCCCAAAATCGCTCAGG + Intronic
1108016454 13:46081500-46081522 TAAGGCCCCCTCAATCAACCAGG + Intronic
1108509243 13:51140009-51140031 TTGGGCCCCCAAAATCACGAAGG + Intergenic
1108946903 13:56038022-56038044 TGAGGCCCCCAAAAACAACTAGG + Intergenic
1112592224 13:100774277-100774299 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1114459458 14:22877382-22877404 TGGGGCCCCCAGGACCAACCCGG + Exonic
1118631654 14:67709852-67709874 TTGGGCCCCCAAAATCACTAAGG + Intronic
1118768881 14:68928729-68928751 TAGCTCCCCCAAAATGATCCCGG + Intronic
1120720818 14:87888283-87888305 TAAGGGCACCAAAATCCACCAGG - Intronic
1122343279 14:101042708-101042730 TAGGGCCTGCAAAAACACCCTGG - Intergenic
1122964762 14:105117553-105117575 CATGGCCCCCAAACCCAACCAGG + Intergenic
1124876477 15:33599683-33599705 TTGGGCCCCCAAAATCACTAAGG - Intronic
1133652270 16:7823527-7823549 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1139231172 16:65283828-65283850 TAGGGCCCCCAAAAAGATCTTGG - Intergenic
1140135834 16:72204719-72204741 AAGGGCCCCCAAAATCCACGTGG - Intergenic
1146694346 17:34897453-34897475 GGGTGCCCCCAACATCAACCTGG + Intergenic
1149379820 17:56082088-56082110 GAGGGCCCCCAAACCCCACCAGG - Intergenic
1151914164 17:77105198-77105220 TTGGGCCCCCAAAATCACTAAGG - Intronic
1153148106 18:2056611-2056633 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1153328794 18:3850561-3850583 TAGGGCCCCCAAAATCAACCTGG + Intronic
1155840650 18:30638244-30638266 TATGTCCCCCAAAATTCACCTGG - Intergenic
1160830417 19:1102128-1102150 TAGCACCCCCCAAGTCAACCCGG + Intergenic
1160876292 19:1297704-1297726 TCGGGCCCCCAGAAGCATCCTGG - Intronic
1161900775 19:7117432-7117454 CAGGGCCCCCAGACTCACCCAGG - Intronic
1166598252 19:44070878-44070900 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1167698627 19:51029439-51029461 GGGGGCCCCCAGAATCACCCTGG + Exonic
929735359 2:44542321-44542343 TAGGGCCCCCAAAAATCAACTGG + Intronic
931451873 2:62374569-62374591 TTGGGCCCCCAAAATCACTAAGG - Intergenic
932439938 2:71728134-71728156 TAGGGCTTCCAAAGTCACCCCGG + Intergenic
932827633 2:74956428-74956450 TAGGGCCCCCACGCTCCACCAGG - Intergenic
933114209 2:78446542-78446564 TAGGGCACCCATGACCAACCCGG - Intergenic
933445034 2:82368838-82368860 TTGGGCCCCCAAAATCACTCAGG - Intergenic
934547311 2:95228802-95228824 TTGGGCCCCCAAAATCATTAAGG + Intronic
940657266 2:156503049-156503071 CAAGGTCCCCAAAATCAACAAGG - Intronic
942344807 2:174991391-174991413 AAGGGGCCAGAAAATCAACCTGG + Intronic
945074142 2:206020926-206020948 GAGGGCTCCCAAAATCAAAAAGG + Intronic
946822724 2:223647066-223647088 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1169342232 20:4805232-4805254 TAGGGCCCCCCAGATAATCCAGG - Intronic
1171493847 20:25540484-25540506 TATGCCCCCCAGAATCCACCGGG + Intronic
1176979703 21:15367075-15367097 TTGGGCCCCCAAAATCACTAAGG + Intergenic
1177291427 21:19118653-19118675 AAGGGATCCCAAAATCAACAGGG - Intergenic
1177534397 21:22405422-22405444 TTGGGCCCCCAAAATCACTAAGG + Intergenic
1178330430 21:31685714-31685736 TAGGTCCCACCACATCAACCGGG - Exonic
1178674141 21:34616375-34616397 TTGGGCCCCCAAAATCACTAAGG + Intergenic
1178813708 21:35907881-35907903 ATGGGCCCCCAAAATAAACTCGG + Intronic
1181679855 22:24486756-24486778 TGGGGCCCAAAAATTCAACCTGG + Intergenic
950525292 3:13519513-13519535 AAGGGCCCCCAATCTCAGCCTGG - Intergenic
952288519 3:31992443-31992465 TAGAGCCTCCAGAATCAACATGG - Intronic
953784371 3:45899633-45899655 TAGGACTCCCAAATTCCACCAGG - Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955604329 3:60684255-60684277 TAGGTCTCCCAAAATAATCCAGG + Intronic
956828147 3:73018037-73018059 TAGTTTCCCCAAAACCAACCTGG - Intronic
959127533 3:102308142-102308164 TAGGGCCAAAAAAGTCAACCAGG - Intronic
963560354 3:146856833-146856855 TAGTGCCTGAAAAATCAACCTGG + Intergenic
971539382 4:27796520-27796542 TAGGACCACCAAAGTGAACCTGG + Intergenic
972035157 4:34510377-34510399 TTGGGCCCCCAAAATCACTAAGG - Intergenic
972496600 4:39639989-39640011 CAGGGCCCCCAAAATTTAGCGGG - Intergenic
977123861 4:93139404-93139426 TAGGGCCCACATAATCTGCCAGG + Intronic
978032579 4:103953339-103953361 TTGGGCCCCCAAAATCACTAAGG + Intergenic
981025561 4:140073782-140073804 TGGGGTCACCAAAATCAAACAGG + Intronic
981847901 4:149190747-149190769 TTTTGCCCCCAAAATCAACAAGG + Intergenic
984407558 4:179352598-179352620 TTGGGCCCCCAAAATCACTAAGG - Intergenic
985226881 4:187770783-187770805 TTGGGCCCCCAAAATCAATAAGG - Intergenic
985227306 4:187775559-187775581 TTGGGCCCCCAAAATCACTAAGG - Intergenic
986712727 5:10499579-10499601 CAGGGCCCCCACAATCCACCAGG - Intergenic
986947593 5:13043652-13043674 TTGGGGCCCCAAAATCACTCAGG + Intergenic
991100748 5:62789807-62789829 TAGGGACCCCTAGATCAGCCAGG - Intergenic
995295360 5:110514772-110514794 GAGGGCCCCCAAAATAGACTTGG - Intronic
997408676 5:133673214-133673236 TTGGGCCCCCAAAATCATTAAGG - Intergenic
999340833 5:150770243-150770265 TTGGGCCCCCAAAATCACTAAGG + Intergenic
1003054023 6:2803058-2803080 CAGGGCCCCCAACTTGAACCTGG - Intergenic
1018362226 6:163083163-163083185 TTGGGCCCCCAAAATCACTCAGG + Intronic
1018626259 6:165781629-165781651 TTGGGCCCCCAAGATCATCCAGG - Intronic
1018840069 6:167510088-167510110 CAGGGCCCCCAACATGAGCCTGG + Intergenic
1020022911 7:4879692-4879714 TAGGGCCACAGAAAGCAACCAGG + Intronic
1021093782 7:16512119-16512141 TTGGGCCCCCAAAATCACTAAGG + Intronic
1023712150 7:43006381-43006403 TGGAGCCCCCAAAATCATCCTGG - Intergenic
1033582918 7:142752864-142752886 CAGGGCCACCAGAATCACCCTGG - Exonic
1033585944 7:142774352-142774374 CAGGGCCACCAGAATCACCCTGG - Intergenic
1040477956 8:47797443-47797465 TAGGGCCCTAAAAGTCAAACTGG + Intronic
1046440572 8:114247701-114247723 TTGGGCCCCCAAAATCACTAAGG + Intergenic
1053350815 9:37412182-37412204 AAGTGCCCCCAGAATAAACCAGG - Intergenic
1055246527 9:74251446-74251468 TAGGTCCCCCAAAATCTATATGG - Intergenic
1061358071 9:130121456-130121478 TGGGACCCCCAAAACCAACAAGG + Intronic
1185569597 X:1123462-1123484 CAGGCACCCCAAAATCACCCTGG + Intergenic
1187616111 X:20995211-20995233 TTGGGCCCCCAAAATCACTAAGG + Intergenic
1187616520 X:21000607-21000629 TTGGGCCCCCGAAATCACCAAGG + Intergenic
1189559688 X:42179150-42179172 TGGGGCCCCCAGAATAAACTGGG - Intergenic
1189990370 X:46588270-46588292 TAGGGCCTCCCAAATGAATCTGG - Intronic
1191202707 X:57802101-57802123 TTGGGCCCCCAAAATCACTAAGG + Intergenic
1192036018 X:67563868-67563890 TAGGGGCCCCAAACTCAAAGAGG - Intronic
1194101203 X:89706516-89706538 AAGGGACCACAAAATAAACCAGG - Intergenic
1194578004 X:95637993-95638015 TAGGGACCCAAAAACCAGCCTGG + Intergenic
1196998069 X:121406153-121406175 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1198880139 X:141272115-141272137 TTGGGCCCCCAAAATCACTAAGG - Intergenic
1199511166 X:148624728-148624750 TAGGGCACCCAAAATCCAGATGG + Intronic
1200454154 Y:3367602-3367624 AAGGGACCACAAAATAAACCAGG - Intergenic
1200822169 Y:7597827-7597849 TAGTGCCTGGAAAATCAACCTGG - Intergenic
1202238132 Y:22736190-22736212 TAGTGCCTGGAAAATCAACCTGG + Intergenic