ID: 1153328851

View in Genome Browser
Species Human (GRCh38)
Location 18:3851236-3851258
Sequence AAATTTACGCAGCAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153328842_1153328851 28 Left 1153328842 18:3851185-3851207 CCCCAAAAGTAAGGGCCTTAATC 0: 1
1: 0
2: 3
3: 6
4: 114
Right 1153328851 18:3851236-3851258 AAATTTACGCAGCAGGTGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 124
1153328847_1153328851 6 Left 1153328847 18:3851207-3851229 CCAAGAGGAAAGTGCTGCAGAAA 0: 1
1: 0
2: 3
3: 31
4: 331
Right 1153328851 18:3851236-3851258 AAATTTACGCAGCAGGTGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 124
1153328843_1153328851 27 Left 1153328843 18:3851186-3851208 CCCAAAAGTAAGGGCCTTAATCC 0: 1
1: 0
2: 5
3: 76
4: 211
Right 1153328851 18:3851236-3851258 AAATTTACGCAGCAGGTGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 124
1153328844_1153328851 26 Left 1153328844 18:3851187-3851209 CCAAAAGTAAGGGCCTTAATCCA 0: 1
1: 0
2: 3
3: 27
4: 279
Right 1153328851 18:3851236-3851258 AAATTTACGCAGCAGGTGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 124
1153328846_1153328851 13 Left 1153328846 18:3851200-3851222 CCTTAATCCAAGAGGAAAGTGCT 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1153328851 18:3851236-3851258 AAATTTACGCAGCAGGTGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153328851 Original CRISPR AAATTTACGCAGCAGGTGGA GGG Intronic
901254661 1:7812328-7812350 AAATTGAAGCTGCAGGTGGCCGG + Intronic
904945284 1:34194660-34194682 AAATTAATCCAGCAGGAGGAGGG - Intronic
905620018 1:39437029-39437051 CCATTTACACAGCTGGTGGAGGG + Intronic
906321743 1:44821543-44821565 AAAGCCATGCAGCAGGTGGAAGG - Intronic
906810141 1:48818212-48818234 TAATTTACGCAGCTGGAAGATGG - Intronic
909648215 1:77940895-77940917 GAATTTACGCACCAGGTAGCAGG + Intronic
912163980 1:107020519-107020541 AAATGTCCCCTGCAGGTGGAGGG + Intergenic
919777830 1:201205765-201205787 AAACTGCCGCAGCAGGTGCATGG - Intronic
921326633 1:213990548-213990570 CACTTTAGGCAGCAGGTGGAGGG + Intronic
1064848216 10:19680475-19680497 AAATTTACCAAGCAAATGGAAGG - Intronic
1065972104 10:30813790-30813812 AAATTTAAGAAGCAGGTCTAGGG - Intergenic
1067850098 10:49749295-49749317 ACATTTCCTCAGCAGGTCGATGG + Intronic
1067923434 10:50482862-50482884 AAATTTACCAAGCAAATGGAAGG + Intronic
1071914014 10:90270022-90270044 AAACTTACGGAGCAGTAGGAAGG + Intergenic
1072905479 10:99449339-99449361 AAGTCTAGGCAGAAGGTGGAAGG + Intergenic
1073056462 10:100706409-100706431 AAATTTACACAGCTAGTGAATGG - Intergenic
1073106687 10:101036336-101036358 AAGTTTACGCCGGAGATGGAGGG + Intronic
1075517422 10:123119781-123119803 ATATTCACGCAGCCGGTGCAAGG + Intergenic
1076670951 10:132120880-132120902 AAATCTACGCGTGAGGTGGAGGG + Intronic
1079089728 11:17472497-17472519 AAATTTAGGGGGCAGGTGGGAGG - Intronic
1079482067 11:20891666-20891688 AAATTTACCAAGCAAATGGAAGG + Intronic
1082892505 11:58155110-58155132 AAATTTGCAGAGCAGGTGGCAGG + Intronic
1083055825 11:59818742-59818764 CAGTTTATGCAGCAGGTGGTAGG + Intergenic
1085704003 11:78769769-78769791 GGATTTAGGCAGCAGGTGGAAGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1090049783 11:123367919-123367941 AAAATTCGGTAGCAGGTGGATGG + Intergenic
1090652113 11:128815898-128815920 CAAGTTACCCAGTAGGTGGAAGG - Intergenic
1091662298 12:2393464-2393486 AAAGTTACACAGCTAGTGGATGG - Intronic
1096765832 12:53888506-53888528 AAATATAAGCATCAGGAGGATGG - Intergenic
1099540460 12:83901774-83901796 ACATTTAAGCAGCATGTAGAGGG + Intergenic
1103679434 12:122681539-122681561 AAATCTATGCATCAGGTGGCAGG + Intergenic
1104569351 12:129911358-129911380 AAATAAACGCAGCAGCAGGAGGG + Intergenic
1106700212 13:32221200-32221222 ACATTTACAGAGCTGGTGGAGGG - Intronic
1108436419 13:50405711-50405733 AAATTAATGAAACAGGTGGATGG + Intronic
1110924942 13:81138971-81138993 AATATTTCTCAGCAGGTGGAGGG + Intergenic
1117482844 14:56166276-56166298 AAAGTTAAAAAGCAGGTGGAGGG - Intronic
1118864988 14:69695693-69695715 AATTTCACCCAGCAGGTGGGTGG - Intronic
1119084989 14:71731355-71731377 AGATTTTAGCTGCAGGTGGATGG - Intronic
1120535862 14:85693994-85694016 AAACTTACACAACTGGTGGAAGG - Intergenic
1121240996 14:92430135-92430157 AAAGTTACTCAGAAGGTGGAAGG - Intronic
1122358229 14:101137146-101137168 AGCTTTACGCTGCTGGTGGAGGG + Intergenic
1129689869 15:77707096-77707118 AAATTGCCTCAGCAGGTGGCAGG + Intronic
1131435418 15:92417975-92417997 ATATTTAGGCAGGAGGTGAAGGG + Intronic
1131863533 15:96680553-96680575 AAAATTACACTGCAGGTGGTTGG - Intergenic
1134818336 16:17224985-17225007 TAACTTACGCAACAGGTGGTGGG + Intronic
1139617893 16:68111460-68111482 AAATTTACAAAGCAAATGGAAGG - Intronic
1146689463 17:34863234-34863256 AAAGCCACTCAGCAGGTGGATGG + Intergenic
1146820145 17:35978218-35978240 TACTTCAGGCAGCAGGTGGATGG + Exonic
1148239863 17:45993164-45993186 AAAGACACGCAGCAGGTGGTGGG - Intronic
1151329804 17:73400083-73400105 CCATCTACGCAGCAGGTGGAGGG + Intronic
1152188376 17:78873181-78873203 AAATTCATGTCGCAGGTGGAGGG - Intronic
1153328851 18:3851236-3851258 AAATTTACGCAGCAGGTGGAGGG + Intronic
1153912380 18:9715438-9715460 AAACTTACACAGCAGTTGAAAGG + Intronic
1155862594 18:30922188-30922210 AACTTATCGCAGAAGGTGGATGG - Intergenic
1157080710 18:44522217-44522239 AAATATAAGCAGCATTTGGAAGG + Intergenic
1157314205 18:46574832-46574854 AAAGTCACACAGCAGGTGGACGG + Intronic
1161670014 19:5601800-5601822 AATTTTGTGCAGCAGGTGAAAGG - Intronic
927505639 2:23612216-23612238 AAATCTAAAAAGCAGGTGGAAGG + Intronic
927525173 2:23733406-23733428 AAGTTTAAGCAGCAGGTAGAGGG - Intergenic
927694641 2:25231466-25231488 AAATTCACACAGCTGGTGGCCGG - Exonic
930558254 2:52927636-52927658 TAATTTAGGCAACAGGTGGCGGG - Intergenic
935892615 2:107695376-107695398 AACTTGACTAAGCAGGTGGAGGG - Intergenic
936838584 2:116740582-116740604 AAAATTATGCTGGAGGTGGAAGG + Intergenic
936848767 2:116871136-116871158 AAATTTACCAAGCAAATGGAAGG - Intergenic
945402259 2:209398281-209398303 AAATTTACACAGCAGGTTTAGGG - Intergenic
948060508 2:235040348-235040370 AAATTTAAGAAGCAGGTTGAGGG + Intronic
1172636649 20:36414562-36414584 AAGGTCACACAGCAGGTGGAGGG - Intronic
1180902146 22:19381982-19382004 AAATTTGCACAGAAAGTGGATGG - Intronic
1181576791 22:23800450-23800472 GACTTTACTCAGCAGGTGGCTGG - Intronic
1182192685 22:28479255-28479277 ATACATACACAGCAGGTGGAAGG + Intronic
1183044974 22:35212190-35212212 AAATGTCCTCAGCAGCTGGAAGG + Intergenic
1184581469 22:45420721-45420743 AAATATATGCAGGAGGTAGAAGG - Intronic
949191095 3:1250189-1250211 AAATTTTCACAGCAAGTGAATGG + Intronic
950640799 3:14346899-14346921 AGGTTTAACCAGCAGGTGGAGGG + Intergenic
950652151 3:14413845-14413867 AAAATTACGCAGCAAGTTCAAGG + Intronic
950783629 3:15413862-15413884 ATATTTACCCAGCACCTGGAAGG - Intronic
954779331 3:53046968-53046990 AACTTTCCGGAGCAGGTGGGCGG - Intronic
954800629 3:53185113-53185135 GAATTTAGGCAGCAGAGGGAGGG + Intronic
955451368 3:59070850-59070872 AGGATTAGGCAGCAGGTGGAAGG - Intergenic
958067460 3:88562096-88562118 AAATTTACTCAGCTGGAAGATGG + Intergenic
958431898 3:94049512-94049534 CAATTTACTCACCAGGAGGAGGG - Exonic
959273324 3:104242279-104242301 AAATTTCAGCAGCAGGCAGATGG - Intergenic
959429304 3:106232919-106232941 TAATGTATGCAGCAGGAGGAAGG + Intergenic
959485547 3:106924684-106924706 AAATATATGCATCAGGTGGGAGG + Intergenic
962859213 3:139382336-139382358 AAATTTTGGCAGCAGGTGAAGGG - Intronic
965272403 3:166635642-166635664 AAATATTTGGAGCAGGTGGATGG + Intergenic
966905688 3:184524224-184524246 AAATTTTCACAGCAGGAGAATGG + Intronic
967113754 3:186318390-186318412 AAATGTGAGCAGCAGATGGAAGG - Intronic
967336248 3:188347888-188347910 AAATTCACACAGCAGGTTAATGG + Intronic
968126037 3:196161109-196161131 AAAGTTAGGCAGCTGGTGGCAGG + Intergenic
969548303 4:7846695-7846717 ATATTTACACAGCAGGTGCTAGG + Intronic
971052402 4:22876003-22876025 AAAGTGACACAGCTGGTGGATGG + Intergenic
972585250 4:40431681-40431703 AAATTTATCTAGGAGGTGGATGG + Intronic
974912800 4:68144072-68144094 AAATTTTTGCATCAGGTGTAAGG + Intergenic
975351765 4:73355247-73355269 AAATTGACGATGCAGGAGGAAGG - Intergenic
975465659 4:74706529-74706551 AAAGTCACCCAGCAAGTGGATGG - Intergenic
977726922 4:100306736-100306758 AAATATACTGAGCGGGTGGAGGG + Intergenic
984124464 4:175789772-175789794 AAATTTAGGGAGCAGGAAGATGG - Intronic
985075541 4:186210355-186210377 ACATTTTCGCAGTAGGTGGAAGG - Intronic
986011631 5:3722212-3722234 AAATTTACAAAGCAAATGGAAGG - Intergenic
988244672 5:28664482-28664504 AAAATTAAGCAGAAGGTAGAGGG - Intergenic
992919712 5:81502038-81502060 AAAATGAGGCAGTAGGTGGAGGG - Intronic
993312372 5:86350727-86350749 AAATTTAATCAGAAAGTGGAGGG - Intergenic
996216908 5:120879428-120879450 AAATATATACAGCAGGTGAAAGG - Intergenic
999495443 5:152092008-152092030 AAATTGAGGCAGGAGCTGGAAGG - Intergenic
1000151156 5:158502452-158502474 AAATTTAAGCAGCAGCAGAAGGG + Intergenic
1002372817 5:178768657-178768679 ATATTTTACCAGCAGGTGGAAGG - Intergenic
1003596633 6:7480004-7480026 AAACTTACCCAGAAGCTGGAAGG + Intergenic
1004614049 6:17272815-17272837 AAGTTTATGCAGTAGGTTGAAGG - Intergenic
1005276811 6:24228341-24228363 GATTTTAAGCAGCAGGTGGTAGG + Intronic
1007164887 6:39822134-39822156 AAGTCTATGCAGCAGGGGGATGG + Intronic
1009931627 6:70182960-70182982 AGATTGACGCAACTGGTGGAGGG + Intronic
1010054636 6:71551210-71551232 AAATGTACGAAGGAGATGGAAGG - Intergenic
1019319084 7:407135-407157 AAATTTTCCCACCATGTGGACGG - Intergenic
1019782603 7:2952680-2952702 AAATTAACGGGGAAGGTGGAAGG - Intronic
1021448946 7:20763369-20763391 AAATTTTGGCAGCAGCTGCATGG + Intronic
1023531576 7:41162185-41162207 AAATGTACGAAGCAGATGAAAGG + Intergenic
1024615104 7:51105346-51105368 AAGTTCGCGCAGCAGGTGGTGGG - Intronic
1026430917 7:70346522-70346544 AAATTTACACTGAAGGTGGAGGG - Intronic
1030839068 7:114325848-114325870 AAATTTAAGCAGCTGCTAGATGG + Intronic
1034727796 7:153355890-153355912 AAATTTATCCAGCAGGTAGAAGG - Intergenic
1036509521 8:9387506-9387528 AAAGTGAGGCCGCAGGTGGATGG + Intergenic
1039516685 8:38139756-38139778 AAATGTAAGCAGCACGAGGAAGG + Exonic
1042938370 8:74083054-74083076 AAATTAATCCAGCAGGGGGACGG - Intergenic
1043364749 8:79520040-79520062 AAATTTAGGCTGCAGGGGAAAGG - Intergenic
1044080133 8:87873182-87873204 AAATCAAGGCAGCGGGTGGAAGG - Exonic
1044396906 8:91723466-91723488 AAATGTACTCAGCAGGCTGATGG - Intergenic
1044511447 8:93085018-93085040 AATTTTACGCAGGAGGTGGGCGG - Intergenic
1045749299 8:105462531-105462553 AAATTTACTGAGCAGGGGAATGG - Intronic
1047797507 8:128273081-128273103 AGATTTTAGCAGCAGATGGAGGG - Intergenic
1051035566 9:12740946-12740968 AAATATAAGCTGCAAGTGGAAGG - Intergenic
1055942020 9:81659523-81659545 AAATGTAAGCAGCAGGATGAAGG + Intronic
1188609684 X:32080696-32080718 AACTTGTCCCAGCAGGTGGAAGG + Intronic
1190336682 X:49266959-49266981 ATAATTACGCAGGAGGTGTAGGG - Intergenic
1192273640 X:69608536-69608558 AATTTTAAGCAGCAGTTTGAAGG - Intergenic
1193417289 X:81240259-81240281 AAAGTTAAAAAGCAGGTGGATGG + Intronic
1194158758 X:90424728-90424750 ATATTTACGAAGCAAATGGAAGG + Intergenic
1200505073 Y:4001695-4001717 ATATTTACGGAGCAAATGGAAGG + Intergenic