ID: 1153330999

View in Genome Browser
Species Human (GRCh38)
Location 18:3874506-3874528
Sequence CTTTTAAAAAGCAGAATTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 991
Summary {0: 1, 1: 0, 2: 9, 3: 116, 4: 865}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153330999 Original CRISPR CTTTTAAAAAGCAGAATTCT TGG (reversed) Intronic
900964338 1:5947406-5947428 CTCTTAAAAAGCAGCGTTTTGGG - Intronic
901841642 1:11957604-11957626 CTTGTAAAATGCAGATTCCTGGG - Intronic
902648862 1:17823430-17823452 ATCTTAAAAAGCAGAATTCCTGG - Intronic
902928022 1:19710079-19710101 TTTTTAAAAAATAGAATTCCAGG - Intronic
903059041 1:20656742-20656764 TTTTTAAAAAGCAGTGTACTGGG - Intronic
903090334 1:20909593-20909615 GATTTAAAAAGCATAATTATAGG + Intronic
904264192 1:29308721-29308743 CTTTTAAAAAATATATTTCTTGG + Intronic
904459664 1:30668807-30668829 CTTTTAAGTAGCAAAAATCTAGG + Intergenic
904877104 1:33663593-33663615 CTTTCCCAGAGCAGAATTCTGGG + Intronic
904888920 1:33763414-33763436 CTTTTAAAATACAAAATTCTTGG - Intronic
905357418 1:37394560-37394582 TTTTTAAATTGCAAAATTCTGGG + Intergenic
905545319 1:38793297-38793319 CTTTGAAAAATCAGAACTTTTGG - Intergenic
905751559 1:40469204-40469226 CTTTTGAAAAGCAGATTGCCTGG - Intergenic
907359829 1:53905565-53905587 CTGTTAAAACGCAGATGTCTGGG + Intronic
907421469 1:54350315-54350337 CTTTCAAAAAGAAGCATTCAGGG - Intronic
907981077 1:59481559-59481581 TTTTTACAAAACAGATTTCTTGG - Intronic
907982547 1:59498420-59498442 CTTTTAAAAATAAGAATCCTAGG + Intronic
908498244 1:64716836-64716858 TTTTTAAAATGCAGAGTACTGGG + Intergenic
908539175 1:65106339-65106361 CTGTCAAAATGCAGAATTCCAGG + Intergenic
908705268 1:66947075-66947097 ATTTTAAAAAGCAGATTTTTTGG + Intronic
908873263 1:68639275-68639297 ATTTTCAAAAGCAGGATTCCAGG + Intergenic
908889611 1:68829697-68829719 CTTTTAAAAGATAGAATTCTGGG + Intergenic
909236435 1:73158205-73158227 ATTTTAAAAAGCTGAACTCATGG + Intergenic
909703448 1:78553047-78553069 CTTTTTAGATGCAGAAATCTTGG + Intergenic
910187080 1:84555712-84555734 CTTTTAAAATACAGATTCCTGGG + Intronic
910297156 1:85659866-85659888 ATTTTAAAAAGAATAATTCCAGG - Intronic
910796059 1:91099032-91099054 CTTATGAAATGCAGATTTCTGGG + Intergenic
910975760 1:92903577-92903599 CTTCTAAAATGCAGAATTTCAGG + Intronic
911665080 1:100542820-100542842 ATTTTAAATAGCTAAATTCTAGG + Intergenic
911949600 1:104155357-104155379 CTTTTAAAAAAGGGAAATCTTGG + Intergenic
912075452 1:105869096-105869118 CTGTTAAAAACCATAATTTTAGG - Intergenic
912158952 1:106957330-106957352 CATTTAAAAAGATGAAATCTTGG + Intergenic
912247514 1:107975869-107975891 TCTTTGAAAAGCAGAATTCAAGG - Intergenic
912868963 1:113285755-113285777 CTTAAAAAAAACAGAAGTCTAGG + Intergenic
913019195 1:114769989-114770011 ATTTTATCAAGCAGAGTTCTTGG + Exonic
913840698 1:123417629-123417651 CTGCTAGAAAGAAGAATTCTCGG + Intergenic
914214325 1:145610877-145610899 CTTTTAAAAAAGTGACTTCTGGG - Intronic
914739223 1:150449607-150449629 CTTATAAAAAGGTGAAATCTGGG - Intronic
914963483 1:152228792-152228814 CTTTTAAAAAGAAGGATGCCTGG - Intergenic
914992379 1:152510150-152510172 CTTTAAAAGGGCAGAAGTCTAGG - Intergenic
915025630 1:152827060-152827082 TTTTTAAAAAGCAGAACTGCAGG + Intergenic
915186213 1:154107167-154107189 ATTTTAAAAAGCAGAAATCCTGG + Intronic
915879791 1:159656778-159656800 TTTTTAAAAAGCATAAATATTGG + Intergenic
916360721 1:163964111-163964133 TTTTTAAAAAGCAGAAATTCTGG + Intergenic
916515168 1:165509974-165509996 TTTTTAAAACACAGATTTCTGGG + Intergenic
917046950 1:170871464-170871486 CATTGAAAAAGCACTATTCTGGG + Intergenic
917177977 1:172260656-172260678 TTTTTAAAAAGCAGAAATTTTGG - Intronic
918150904 1:181797608-181797630 CTTTTCAAAGGCAGACTCCTGGG - Intronic
918323444 1:183386598-183386620 CTTTTAAAAAGCAAAATAATTGG + Intronic
918542296 1:185645471-185645493 CTCTTAGAAAGAAGATTTCTTGG + Intergenic
919071066 1:192755271-192755293 ATTTCAAAAAGTAAAATTCTAGG + Intergenic
919234204 1:194817019-194817041 ATTTTAAAAAGTATAATTCTAGG + Intergenic
919576376 1:199315334-199315356 CTTGTAAAATGTAGATTTCTGGG - Intergenic
921072377 1:211672694-211672716 TGTTTAAAATGCAGAGTTCTGGG - Intronic
921396161 1:214671979-214672001 TTCTTAAAAAGCACCATTCTGGG - Intergenic
921455091 1:215361473-215361495 CTTTTAAGAAGTTGAATTCATGG - Intergenic
922002632 1:221495305-221495327 CTCTTAAAAATAAGAATTCCTGG + Intergenic
922125815 1:222722132-222722154 CTTTTAAAATACAGATTTCTGGG - Intronic
922636351 1:227176339-227176361 ATGTTAAGAATCAGAATTCTTGG - Intronic
922758961 1:228112884-228112906 TTTTTAAAAAACACAATTATGGG - Intergenic
923567666 1:235088667-235088689 CTGTGAAAAGGCAGAATCCTGGG + Intergenic
923601547 1:235407594-235407616 CTTGTAATAAACTGAATTCTTGG + Intronic
923649900 1:235864617-235864639 CTTTTAAAAATGATCATTCTGGG - Intronic
924920887 1:248627957-248627979 CTTTTTAAAAACTTAATTCTGGG - Intergenic
1063027875 10:2200900-2200922 TTTTATAAAGGCAGAATTCTAGG - Intergenic
1063073733 10:2692921-2692943 CTTTTAGAAAACATATTTCTAGG - Intergenic
1063484486 10:6406247-6406269 ATTTTAAAAAGAACAATTTTAGG - Intergenic
1064313044 10:14228835-14228857 CTGTTCAAAAGCAGAATTCTAGG + Intronic
1064672337 10:17729468-17729490 CTTCTAAAAACCAGAATGCTCGG + Intergenic
1064676467 10:17765119-17765141 CTTTTAAAAAGGGAAAATCTGGG - Intronic
1064971961 10:21075104-21075126 CTTTTTAAAAAAATAATTCTGGG - Intronic
1065034241 10:21621543-21621565 CTTTTAAAAAATTAAATTCTTGG - Intronic
1065167511 10:22995037-22995059 GTTTTAAAATCCAGAATTATAGG - Intronic
1065623357 10:27606226-27606248 CTTAGAAATAGCAGATTTCTAGG + Intergenic
1065891618 10:30126207-30126229 TTTGTAAAAAGCAGATTCCTGGG + Intergenic
1066404699 10:35107579-35107601 ATTTTAAAAAGTAGAAGACTTGG + Intergenic
1066593206 10:37018852-37018874 CTTTTAAAGAGAAGTTTTCTTGG - Intergenic
1069125517 10:64628024-64628046 ATCTTAAAATACAGAATTCTAGG - Intergenic
1069494477 10:68890588-68890610 TTTTTAAAATGTAGATTTCTAGG - Intronic
1070943077 10:80363646-80363668 TTTTTAAAAATCAGATTTTTTGG - Intronic
1071660828 10:87501023-87501045 CTTTTATTAAGCAGAATTAAAGG - Intergenic
1071770785 10:88727197-88727219 GTTTTGAAAATCAGAAATCTAGG + Intronic
1071847383 10:89535146-89535168 GTTTTCAAATGCAGACTTCTCGG - Intronic
1071912122 10:90248048-90248070 TTTTTAAAAAGCAAGATTGTTGG - Intergenic
1072077954 10:91997514-91997536 CTTTTAAAAAGTTAAAATCTTGG + Intronic
1072266557 10:93733915-93733937 TTTTTTAAAAACAGAAATCTTGG + Intergenic
1072274340 10:93807918-93807940 CATTTAAAAATAAGAATTCCTGG - Intergenic
1072324768 10:94287147-94287169 CTTTTAAAAAACAACATACTTGG - Intronic
1072520874 10:96228932-96228954 CTTTAAAAAAAAAGAATTGTAGG + Intronic
1072523760 10:96253645-96253667 TTGTTAAAAAGCAGATTGCTGGG - Intronic
1072651467 10:97299138-97299160 CTTTTAAAAAACGAAAATCTAGG + Intergenic
1072806705 10:98428082-98428104 CTGTTGAGAAGCAGAGTTCTGGG - Intronic
1072846067 10:98831744-98831766 TTATTAAAAAGTAGACTTCTAGG - Intronic
1073549420 10:104383932-104383954 TTCTTAAAAAGGAAAATTCTGGG - Intronic
1073665262 10:105525000-105525022 CTTTCAAAGAGAAGTATTCTGGG + Intergenic
1073940325 10:108690625-108690647 TTTTTTAAATGCAGAATTGTGGG + Intergenic
1073963440 10:108960672-108960694 ATTTTAAAAATCAGAATTTTTGG + Intergenic
1073983883 10:109186216-109186238 CATTTAATAATCAGAAATCTTGG - Intergenic
1074006941 10:109436048-109436070 ATTTTAGAAAGCAGAATACTAGG + Intergenic
1074080824 10:110166857-110166879 CTATTCAAAAGCAGATTCCTGGG - Intergenic
1074515977 10:114170079-114170101 CTTTTTAAAAACAGAATAATAGG + Intronic
1074601688 10:114920596-114920618 TTTTTAAAAATCAAAATTCCTGG + Intergenic
1074800265 10:116992658-116992680 CTTTTAAAATGCAAACTTCTGGG + Intronic
1074962518 10:118460686-118460708 CCTTTAAAAAATAGATTTCTAGG - Intergenic
1075035550 10:119064147-119064169 TTTTTAAAATGCAGATTTCTAGG - Intronic
1075099126 10:119493563-119493585 CTTTTAAAAAACTGGATACTAGG + Intergenic
1075284983 10:121175929-121175951 CTTTAAAAAGTCACAATTCTAGG + Intergenic
1075480676 10:122779141-122779163 CTTTTAAAAAACATAGTACTGGG - Intergenic
1076770477 10:132660429-132660451 CTTTTAAAAAACAAAATTCCAGG + Intronic
1077318752 11:1931062-1931084 TTTAAAAAAAGCAGAATTCAAGG - Intronic
1077732322 11:4745421-4745443 CTATTAAAATGCAGGATTCTGGG - Intronic
1077831000 11:5870243-5870265 ATTTTAAGAAGTAGAAATCTTGG - Intronic
1078061956 11:8053799-8053821 CTTTTAAAAACGACAATTATTGG - Intronic
1078370932 11:10744540-10744562 ATTTGAATAAGCAGAATTGTGGG - Intergenic
1079509511 11:21194694-21194716 TTATTAAAATGCAGATTTCTGGG - Intronic
1079592877 11:22202145-22202167 ATTTTAAAAAGCAGATTTATGGG - Intronic
1079718548 11:23781228-23781250 CTTTTATAAAACAGATTACTAGG + Intergenic
1080126767 11:28744067-28744089 ATTTTAAGAAACAGAAATCTGGG - Intergenic
1080173107 11:29329863-29329885 CTGTTAAAATGCAGATTGCTGGG + Intergenic
1080185834 11:29484546-29484568 GTTTGAAAGAGCAGAATTCAAGG + Intergenic
1080382192 11:31783933-31783955 CATTTAAAAAACAGCATTTTTGG - Exonic
1080623947 11:34011524-34011546 CTTTTAAAAAGTTGAGTGCTTGG - Intergenic
1080907295 11:36559705-36559727 CCATTAAAAAACAGAAATCTTGG - Intronic
1080922675 11:36724527-36724549 CAGTTAAAATGCAGAATCCTGGG + Intergenic
1081226389 11:40528114-40528136 ATTTTAAAAAACTGATTTCTTGG + Intronic
1081763774 11:45595073-45595095 TGTTGAAAAAACAGAATTCTGGG - Intergenic
1081959962 11:47128686-47128708 ATTTTAAAAAATAGAAATCTAGG - Intronic
1082199317 11:49344448-49344470 CTTCTAAAAAGAAGAATTAAAGG - Intergenic
1082736229 11:56859070-56859092 CTTTTAAAAAGCAGGGTGGTTGG + Intergenic
1083086771 11:60156142-60156164 CTTTTGAGAAGCTGAAATCTAGG + Intergenic
1083905243 11:65664841-65664863 TCTTTAAAATACAGAATTCTGGG - Intergenic
1085168960 11:74431631-74431653 ATTTTAAAAGGCATATTTCTTGG - Intergenic
1085416623 11:76322569-76322591 GTTTTAAAGAGCTGATTTCTGGG - Intergenic
1085648558 11:78245809-78245831 GTTTTTAAAAGCAGATCTCTTGG + Intronic
1085898553 11:80668831-80668853 CTTTTAAAAAAAAAAATTGTAGG + Intergenic
1086562011 11:88178654-88178676 CTCTAAAATATCAGAATTCTGGG + Intergenic
1086595564 11:88566961-88566983 CTTTTAAATGGGAGAAATCTGGG - Intronic
1086656501 11:89363679-89363701 CTTCTAAAAAGAAGAATTAAAGG + Intronic
1086951289 11:92892709-92892731 TTTTTAAAAAGCACAGTTTTGGG - Exonic
1087368034 11:97247031-97247053 TTTTTAAAAAGCAGAAATTCTGG - Intergenic
1087420120 11:97912260-97912282 ATTTTCAAAAGCAGATTCCTAGG - Intergenic
1087609701 11:100419452-100419474 TTATTAAAAGGCAGAATTCAGGG + Intergenic
1087944447 11:104141201-104141223 CTTTTAAAAAGCTGAATCTGGGG - Intronic
1088094966 11:106088378-106088400 CTTTTTAAATGCAGATTTTTTGG + Intronic
1088164621 11:106918356-106918378 CTTTCAAAGAGCAGAATTAAAGG - Intronic
1088267906 11:108005002-108005024 TATTTTAAAAGCAGATTTCTAGG - Intergenic
1088298793 11:108332088-108332110 ATTTTAAAAAGAAATATTCTAGG - Intronic
1088311058 11:108461023-108461045 ACTTTAAAAAGCAGACTTTTTGG - Intronic
1088368539 11:109064053-109064075 CTTTTAAAAGGCTGAAATCTAGG - Intergenic
1088428441 11:109730560-109730582 CTTTCAAAGAGCATAATTTTTGG - Intergenic
1088644409 11:111905450-111905472 ATTTTTTAAAGAAGAATTCTGGG - Intergenic
1089174568 11:116539170-116539192 CTTTTAAAATGCAGATGCCTGGG - Intergenic
1090564077 11:127967216-127967238 CTTTTCAAAAGCTGGAGTCTAGG - Intergenic
1091527957 12:1324372-1324394 CTATGAAAAAGCAAAAATCTTGG - Intronic
1092122718 12:6056050-6056072 GTTTTAAAAAGCTGCTTTCTTGG - Intronic
1093096482 12:14977675-14977697 ATTTTAAAACTCAGAAATCTAGG - Intronic
1093987258 12:25549631-25549653 CCTTTGAAAAGCAGAATTCTGGG - Intronic
1094055749 12:26267941-26267963 TTTTTAAAAAAGAAAATTCTGGG - Intronic
1094749321 12:33387273-33387295 CTTTTAGAAAGTAGAAAACTGGG - Intronic
1095263269 12:40122958-40122980 CTTTTAAAAAACAGCTTTATTGG - Intergenic
1095446187 12:42285236-42285258 CTTTTCAAAAGCACATTTTTGGG + Intronic
1095457222 12:42401010-42401032 CATTTAAAATGAACAATTCTGGG + Intronic
1095480887 12:42634393-42634415 CTTTTCACTAGCAGAGTTCTTGG - Intergenic
1095498893 12:42815035-42815057 CTGTTTAAAAGCAGAGTTCCTGG + Intergenic
1096617458 12:52841944-52841966 CATTTAAAAAGCAGGTTTCTGGG + Intronic
1096828736 12:54298737-54298759 CTTTTAAAATGCTGATTCCTGGG - Intronic
1096851599 12:54442165-54442187 CTTTAAAAATGCAGATTCCTAGG - Intergenic
1097160063 12:57039768-57039790 CTGTTAAAATACAGATTTCTGGG + Intronic
1097569185 12:61310191-61310213 CTTTTAAAAAACATAGTTTTAGG - Intergenic
1098035887 12:66302072-66302094 CATTAAAAAGACAGAATTCTAGG + Intergenic
1098171561 12:67752064-67752086 ATTTTAAAAAGACAAATTCTGGG - Intergenic
1098332561 12:69369135-69369157 CTGTTAAAAAGCAGTTTTCTTGG - Intronic
1098574939 12:72030286-72030308 CCTTTAAAATGAAGATTTCTAGG + Intronic
1098834516 12:75406111-75406133 CTTTTAAAAGTGAGAATACTTGG - Intronic
1098965057 12:76778961-76778983 CTTTTAAAAAGGAGAAAATTTGG - Intronic
1099317553 12:81103717-81103739 CTTTTAAAAAAGAAAATCCTAGG + Intronic
1099812091 12:87596046-87596068 ATTTTATAATGCAGACTTCTAGG + Intergenic
1100520298 12:95368422-95368444 ATCTTAGAAAGCTGAATTCTAGG + Intergenic
1100655186 12:96636654-96636676 CTTTTAAAAAACAGCTTTATTGG + Intronic
1100676559 12:96874915-96874937 CTTTAAAAAAGCAGAGATCCCGG - Intronic
1100801335 12:98234280-98234302 ATTTTAAAAAGGAAAATTTTAGG - Intergenic
1101019413 12:100538008-100538030 CTTATAACAAGCAGATTTCTCGG - Intronic
1101427275 12:104598607-104598629 TGTTAAAAAAGCAGATTTCTGGG - Intronic
1101436144 12:104666431-104666453 CTTTGGCAAAGCAGAATTCAAGG - Intronic
1101460590 12:104888649-104888671 CTTTTGAAACCCAGAATTCCTGG + Intronic
1101615907 12:106336809-106336831 CTCTTCAATAGCACAATTCTAGG - Intronic
1102863646 12:116357304-116357326 TTTTTAAAAAGAAGAAATTTGGG + Intergenic
1102941595 12:116947346-116947368 GTGTTAACAAGGAGAATTCTAGG + Intronic
1104097479 12:125570778-125570800 ATTTTAAAAATCAGAAGTCAAGG + Intronic
1104703633 12:130926183-130926205 CTTTTATAAAACAGAATTTTTGG + Intergenic
1104905241 12:132209974-132209996 CTTGTACAAGGCAGAATTCGGGG - Intronic
1105333884 13:19445638-19445660 ATTTTTAAAAGCAGTATTATTGG + Intronic
1105787260 13:23761822-23761844 CTTTTAAAAAACAGAAGCTTGGG + Intronic
1105861048 13:24413729-24413751 ATTTTTAAAAGCAGTATTATTGG - Intergenic
1105922535 13:24978168-24978190 ATTTTTAAAAGCAGTATTATTGG + Intergenic
1106119836 13:26851080-26851102 CTTTTCAGAAACAGATTTCTGGG + Intergenic
1106682532 13:32022793-32022815 CTTCTAAAAGGCAGAAACCTGGG + Intergenic
1107123874 13:36823247-36823269 CTTTTATCTACCAGAATTCTAGG - Intronic
1107488033 13:40850161-40850183 ATTTTTAAAAGCAGCATTATTGG + Intergenic
1107791030 13:44002452-44002474 ATTTTAAACAGCAGAATAATGGG - Intergenic
1107794729 13:44038413-44038435 TTTTTAAAAACCAGAAGTTTTGG - Intergenic
1107979919 13:45725151-45725173 CTTTTAAAAACCTGATTTGTTGG + Intergenic
1108210409 13:48133994-48134016 CTTTAAAAATGCAGCTTTCTAGG - Intergenic
1108222004 13:48244600-48244622 CATTTAAAATGCAGAACTTTTGG - Intronic
1108263751 13:48683828-48683850 AATTTACAAAACAGAATTCTGGG - Intronic
1108337440 13:49459684-49459706 TTTTTAAAAAGCAGTATTGTTGG + Intronic
1108627886 13:52249626-52249648 ATTTTTAAAAGCAGCATTATTGG + Intergenic
1108658172 13:52556825-52556847 ATTTTTAAAAGCAGCATTATTGG - Intergenic
1108967062 13:56321701-56321723 TTTTTAAAAAACAGAATGGTAGG - Intergenic
1109266262 13:60204136-60204158 ATTTTAGAATTCAGAATTCTTGG + Intergenic
1109295525 13:60525472-60525494 TTTTTAAAAATAAGAATTCCTGG - Intronic
1109351164 13:61183173-61183195 ATTTTAAAAATCAGAATTCTTGG + Intergenic
1109450009 13:62500547-62500569 TTTTTAAAAATCAGGAATCTAGG + Intergenic
1109471059 13:62804155-62804177 ATTTTAAAAAGGAGTATTTTAGG + Intergenic
1109542116 13:63793045-63793067 TTTTTAAAAAGCAGAAAACCAGG - Intergenic
1109658002 13:65419986-65420008 ATTTTAAACAGCAGAATGATGGG - Intergenic
1109680408 13:65745078-65745100 TTTTTAATAAACAGATTTCTGGG - Intergenic
1110100282 13:71592209-71592231 ATTTTAAAAAGGAGAATTAGGGG + Intronic
1110355946 13:74567670-74567692 TTTTTCAAAAGAATAATTCTGGG - Intergenic
1110470866 13:75858453-75858475 TTTTTAAAAATCAGAATAATAGG - Exonic
1110494130 13:76146113-76146135 TTTTAAAAACACAGAATTCTGGG - Intergenic
1110507988 13:76311977-76311999 CTTTTCAAAAGCACAAATTTTGG + Intergenic
1110950621 13:81485529-81485551 CTTTTATAAAGAATAATTCATGG - Intergenic
1111018185 13:82408123-82408145 CTTTTAAAAATGAGAAGACTTGG + Intergenic
1111037301 13:82693381-82693403 ATTTTAGAAAGTAAAATTCTTGG - Intergenic
1111166916 13:84470857-84470879 CATTGAATAAGCAGAATTCCTGG + Intergenic
1111601218 13:90477238-90477260 CATTTCAAAAGGAAAATTCTAGG + Intergenic
1111729972 13:92062057-92062079 CTTTTAAAAATAAGAAAGCTTGG - Intronic
1112227154 13:97551066-97551088 CTGTTAAAACACAGACTTCTGGG + Intergenic
1112393460 13:99006789-99006811 CTTTTAAAAAGCAAAAAGCATGG + Intronic
1112440187 13:99419519-99419541 CATTTAAAAACCAGGACTCTGGG + Intergenic
1112919915 13:104599783-104599805 TTATCAAAAAGTAGAATTCTTGG - Intergenic
1113136775 13:107099490-107099512 CTTTTCTAAAGAAGAATTCTAGG + Intergenic
1113155245 13:107313070-107313092 TTTTTAAAAAACAGAATACTTGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114380267 14:22196128-22196150 TTTTTAAAAAGCCAAAGTCTGGG + Intergenic
1114551699 14:23536290-23536312 CTTTTGAATGGCAGAATTCTAGG + Intronic
1114919062 14:27303673-27303695 CTTTTAAGATGCAGATTTCATGG + Intergenic
1115118010 14:29906236-29906258 CATGTAAAAAGCTGAAATCTAGG + Intronic
1115467252 14:33729018-33729040 CTTATATAAAGCACAATCCTAGG + Intronic
1115775625 14:36711611-36711633 ATTTTAAAAAACACAGTTCTAGG - Intronic
1116253830 14:42523469-42523491 AGTTTAAAAAGCAGAATTTCTGG + Intergenic
1116416863 14:44688535-44688557 TTTTGAAAGAGAAGAATTCTAGG + Intergenic
1116661988 14:47722042-47722064 CTTATAAGAAGAAGAAATCTGGG + Intergenic
1117035794 14:51727185-51727207 CTTTAAAAGGCCAGAATTCTTGG - Intronic
1117694892 14:58350647-58350669 CTTTAAAGAAGCAAAATTCAGGG + Intronic
1118113079 14:62744861-62744883 GTTTGAAAAATCAGAATCCTTGG + Intronic
1118494113 14:66291275-66291297 CTGTTAAATATCAGGATTCTGGG - Intergenic
1118697506 14:68399006-68399028 TTTGTAAAATGCAGAATCCTAGG - Intronic
1118871796 14:69749244-69749266 CTGTTAAAAGGCAGATTTCCAGG - Intronic
1119572301 14:75685902-75685924 TGTTTAAAATGCAGAATCCTGGG + Intronic
1119686604 14:76637595-76637617 CTTATAAAAAGCAGTCTTGTGGG + Intergenic
1119867089 14:77982729-77982751 ATTTTAAAAAGCAGAAAGCAAGG + Intergenic
1120040388 14:79746276-79746298 TTGTCAAAAAGCAGATTTCTAGG - Intronic
1120384451 14:83826823-83826845 CTTTTAAAAAGTACTCTTCTAGG + Intergenic
1120409767 14:84139262-84139284 ATTTTTAAAAGCAGATTTTTAGG + Intergenic
1120535905 14:85694644-85694666 CTTATAAAAAGGGGAAATCTTGG + Intergenic
1120548359 14:85838610-85838632 CTTTTAAAAATTAAATTTCTAGG + Intergenic
1120811208 14:88805306-88805328 CTTTCAAATAGTAGAATTGTTGG - Intergenic
1121114431 14:91333712-91333734 CCTGTAAAATGCAGATTTCTAGG + Intronic
1121230341 14:92352925-92352947 CTTCTGAAAAGCAGAATGTTGGG - Intronic
1121647275 14:95527267-95527289 TTCTTAAAAAGCAGCATTCTGGG - Intergenic
1121770266 14:96529408-96529430 TTTTTAAAAAGCAGTATTTTAGG - Intronic
1121943064 14:98091816-98091838 CTTTTAAAAAGCCCCCTTCTTGG - Intergenic
1122170346 14:99868741-99868763 TTTTTAAAAAAAACAATTCTTGG + Intronic
1122570093 14:102691537-102691559 TTTTTAAAAAGCTGAAAACTAGG - Intronic
1202882038 14_KI270722v1_random:69324-69346 ATTTTAAAAAACATAATTGTAGG + Intergenic
1123670723 15:22654267-22654289 CTTTTCAACAGCTGAATTGTGGG - Intergenic
1123689804 15:22828697-22828719 CATTTAAAAAGCAGAATCCAGGG + Exonic
1124097217 15:26659884-26659906 CCTTTAAAAAGCACACTTCAGGG + Intronic
1124360683 15:29034756-29034778 CTTTTAACATGCAGACTTCAGGG + Intronic
1124591717 15:31059705-31059727 GTTTTAAAAACCACATTTCTTGG - Intronic
1124663344 15:31568965-31568987 ATTTTAAAAAGAGGATTTCTTGG - Intronic
1125607212 15:40947048-40947070 CATTCCAAAAGCATAATTCTAGG + Intergenic
1125621976 15:41071391-41071413 CTTTTAAAAAGCTGTATCCTGGG - Intronic
1126228009 15:46293941-46293963 CTTTAAAAAAACAGAATGATTGG - Intergenic
1126270169 15:46806779-46806801 TTTTAACAATGCAGAATTCTAGG - Intergenic
1126339064 15:47619645-47619667 CTTGTTAAAAACAGACTTCTGGG - Intronic
1126517788 15:49555231-49555253 CTCTTATAAAGCAGATTTGTTGG + Intronic
1126896010 15:53257975-53257997 CTTATAAAAAGCAGATTTCCTGG + Intergenic
1127141572 15:55983120-55983142 CTCTTAAAAAAAAAAATTCTAGG + Intronic
1127317987 15:57815560-57815582 CTTTTAAGAAGCAAAATATTGGG - Intergenic
1127344737 15:58083148-58083170 CTTATAAGAAGAAGAAATCTGGG - Intronic
1127513612 15:59669859-59669881 CATTTAAAAAGGAGAAGTCTAGG - Intronic
1127531377 15:59846662-59846684 CTTTTAAAATGCAAATGTCTGGG - Intergenic
1127625222 15:60773867-60773889 CTTTTCAAAAACAGAGTTCTTGG - Intronic
1127669375 15:61180587-61180609 CTCTTTAAAAGAAGAATTCAGGG - Intronic
1127695049 15:61437488-61437510 CTTTAAACATGCAGAATTCTGGG + Intergenic
1128272093 15:66319237-66319259 TTTTTAAAAAACAGAATCTTGGG - Intronic
1128580149 15:68804112-68804134 TTTTTAAAAATCAGAACTTTTGG + Intronic
1128781251 15:70360052-70360074 CATTTAAAATGCAGACTTCCGGG - Intergenic
1128796710 15:70471663-70471685 CATCTAAGAAGCAGAGTTCTGGG - Intergenic
1128840714 15:70849056-70849078 TTTTTAAAAAACATATTTCTTGG + Intronic
1128928221 15:71678529-71678551 TTTTTATTAAGCAGAACTCTAGG + Intronic
1128972749 15:72122005-72122027 CTTTTAAAAGTCAGAAATGTAGG - Intronic
1128972752 15:72122053-72122075 CTTTTAAAAGACAGAAATGTAGG - Intronic
1128972777 15:72122288-72122310 CTTTTAAAAGTCAGAAATGTAGG - Intronic
1129874200 15:78961902-78961924 CTTTTAAACAGCTGTACTCTTGG - Exonic
1129886993 15:79045482-79045504 CTATTAAAAAGCAGCCTTGTGGG + Intronic
1130311707 15:82761809-82761831 ATTTGAAAAATCAGAATGCTGGG - Intronic
1130405578 15:83597906-83597928 TTTTTAAAAAGCATAATTAAGGG - Intronic
1130891429 15:88137023-88137045 TTCTAAAAAAGCAGATTTCTGGG - Intronic
1130988915 15:88863378-88863400 CTTTTAAAAAGCATCATGCCTGG + Intronic
1131608112 15:93931036-93931058 TTTCTAAAAGGCAGATTTCTAGG + Intergenic
1131979725 15:97983094-97983116 TTTTTGAAAAGCAGAAATCCAGG - Intergenic
1132279334 15:100599763-100599785 CTGTTAAAAAGCAAAATTTGAGG + Intronic
1132439563 15:101845955-101845977 GTTTTAAAAAACAGAAATATGGG - Intergenic
1132802291 16:1760357-1760379 CTTTGAAAAAGCAGAAAGATGGG - Intronic
1133138029 16:3725752-3725774 GTTTTAAATAGCTGAATACTTGG - Exonic
1133329455 16:4963305-4963327 CTTCTAAAGAGAAGGATTCTAGG + Intronic
1133480174 16:6162413-6162435 CTGTTAAAATACAGAAATCTGGG - Intronic
1133727510 16:8551152-8551174 CTGGTAAAAACCAGAATTCTAGG - Intergenic
1133788406 16:8990565-8990587 TTTTTAAAATGCAGATTCCTCGG + Intergenic
1133875741 16:9732669-9732691 CTGTTAAAATGAAGATTTCTGGG - Intergenic
1133998932 16:10767648-10767670 CTCTTAAAATGCAGACTCCTGGG + Exonic
1134288217 16:12880806-12880828 ATTTTAAAATGCTGATTTCTGGG + Intergenic
1134886268 16:17795389-17795411 TCTTTAAAATGCAGAAATCTTGG + Intergenic
1134902770 16:17953565-17953587 CTTGTTAAAAGCAGATTCCTGGG - Intergenic
1135145709 16:19961021-19961043 CTTTTATAAAGCAAAATCCTTGG - Intergenic
1135276986 16:21121734-21121756 CTTGTTAGAAGCACAATTCTGGG + Intronic
1137340713 16:47601402-47601424 CTTTTAAAAATCTGACTTCTAGG + Intronic
1137344529 16:47643645-47643667 CTTATAAGGAGCAGAATACTAGG - Intronic
1138327415 16:56187098-56187120 TTTTTAAAGAGCAGATTTCTGGG - Intergenic
1140603825 16:76509983-76510005 CTTTTAAAAGGGTGAATTATAGG - Intronic
1140863039 16:79035893-79035915 CCTTTAAGAAGCTGAATTCTTGG - Intronic
1142317745 16:89359350-89359372 CCTTTAAAAAGCAGACTCCCAGG + Intronic
1142787006 17:2232237-2232259 TTTTTAAAAATTAAAATTCTTGG + Intronic
1143949442 17:10621028-10621050 GTTTTAAAAAGCGGATTCCTGGG - Intergenic
1144215082 17:13048307-13048329 CTGTTAAAATACAGATTTCTGGG - Intergenic
1144252808 17:13436954-13436976 CTATTAAAAAACAAGATTCTTGG + Intergenic
1144416415 17:15051757-15051779 CTTTTAAAAATCAAAAGTATAGG + Intergenic
1144448386 17:15353278-15353300 CTTTTAAAATGTAGATTTCAGGG + Intergenic
1144542265 17:16155844-16155866 CTTTCAAAAGGCAGCATACTGGG + Intronic
1145889348 17:28404172-28404194 TTTTTAAAAACCAGTCTTCTCGG - Intronic
1146187407 17:30732716-30732738 AGTAGAAAAAGCAGAATTCTGGG - Intergenic
1146431828 17:32804068-32804090 CTTGTGGATAGCAGAATTCTTGG + Intronic
1147239486 17:39081156-39081178 CTTGTAAAATGCAGATTCCTGGG - Intronic
1147764716 17:42825989-42826011 AATTTAAAAAGCAGAAGCCTGGG - Intronic
1148603848 17:48913651-48913673 CTTGTAAAAAACAGATTTCTGGG - Intronic
1148841018 17:50497216-50497238 CTTTTAAGAAGCAGAAGGTTGGG + Intergenic
1148923031 17:51056295-51056317 TTTTAAAAAAGAATAATTCTTGG - Intronic
1148963942 17:51418600-51418622 TCTTTAAAATGCAGATTTCTGGG - Intergenic
1149013911 17:51886402-51886424 CTTTTAAAAAACCTAATTCCTGG + Intronic
1149119567 17:53146029-53146051 CTTATAAAAAACAATATTCTAGG + Intergenic
1149226661 17:54479222-54479244 CATTCCAAAAGCATAATTCTGGG - Intergenic
1149349495 17:55772709-55772731 CTTTCATAAAACAGAATTTTGGG - Intronic
1149759149 17:59213889-59213911 TTTTTAAAAAACAGAATATTAGG - Intronic
1149976913 17:61275149-61275171 CTTTTCAAAAACAGATTTCAGGG - Intronic
1150954364 17:69840506-69840528 CTTTTAAAGAACAGATTTCCAGG + Intergenic
1151249295 17:72821200-72821222 CTTATAAAAAGGGGAAATCTGGG + Intronic
1151851443 17:76692551-76692573 TTTTTAAAAATCAGACTTCCAGG - Intronic
1151878681 17:76881635-76881657 CTGTTAAAATTCAGATTTCTGGG - Intronic
1152898126 17:82925280-82925302 ACTTGAAAAAGCTGAATTCTGGG + Intronic
1153122719 18:1749674-1749696 CCTTTGCAAAGGAGAATTCTTGG - Intergenic
1153284067 18:3441425-3441447 ATTTTGAACAGGAGAATTCTTGG + Intronic
1153330999 18:3874506-3874528 CTTTTAAAAAGCAGAATTCTTGG - Intronic
1153417432 18:4863120-4863142 GTTTTTAAAAGCTGGATTCTGGG - Intergenic
1155076277 18:22358566-22358588 TTTTTAAAAAGGAGACTTCTTGG - Intergenic
1155183480 18:23368116-23368138 AGTTTAAAATGTAGAATTCTTGG + Intronic
1155275551 18:24184017-24184039 CTATCATAAAGCATAATTCTGGG + Intronic
1155447813 18:25930218-25930240 TTTCTTAAAAGCAGAATTGTGGG - Intergenic
1155597114 18:27501124-27501146 ATTTTGAAATACAGAATTCTAGG + Intergenic
1155791830 18:29981663-29981685 CTTTTAAGAAGGAGAGTTATGGG + Intergenic
1155814496 18:30288162-30288184 TTTTTAAAAAGCAAGATTGTAGG - Intergenic
1156377346 18:36526701-36526723 TTTTTAGAAAGCTGAATTATGGG - Intronic
1156434031 18:37106941-37106963 CTTTTTAAAAACTGAATTCTTGG + Intronic
1156557088 18:38079635-38079657 AACTTAAAAAGCAGAATACTTGG - Intergenic
1156817720 18:41330904-41330926 CATTTAAAATGAAGATTTCTGGG + Intergenic
1156887657 18:42154078-42154100 GGTTTGAAAAGCAAAATTCTAGG - Intergenic
1157088723 18:44609515-44609537 CTTTAAAACAGCATTATTCTTGG + Intergenic
1157465462 18:47940667-47940689 CTTTTAAAAATCAGCTTTATTGG + Intergenic
1157698053 18:49739323-49739345 CTTTTAAAAACCAGAGTTTGAGG - Intergenic
1157706951 18:49814596-49814618 TGTTTGAAAAGCAGGATTCTAGG - Intronic
1157794645 18:50562093-50562115 CTGCTCAAAAGCAGAATTCTAGG - Intronic
1157925336 18:51758941-51758963 ATTTTAAAAAGTAGAAATATTGG - Intergenic
1157991777 18:52504861-52504883 CTTTCCAAAACCAGAATTGTCGG - Intronic
1158012523 18:52745470-52745492 ATATTAAAATGCACAATTCTAGG - Intronic
1158364611 18:56719261-56719283 ATTTTAAAAAACAGAATTGCTGG + Intronic
1158496676 18:57961294-57961316 CTTTTTAAAAGTAGTTTTCTAGG + Intergenic
1158768707 18:60488108-60488130 CTGTTAAAAAGCAAAATTACAGG + Intergenic
1159454445 18:68642872-68642894 CTTTTAAAGAGCAGGTTTCCAGG - Intergenic
1160614173 18:80111183-80111205 CTTTAAAAACACAGAATACTTGG - Intronic
1161001080 19:1911471-1911493 ATTTTCAAAAGCACAATTCATGG - Intronic
1161831480 19:6607937-6607959 TTTTTAAAAATAAAAATTCTCGG - Intergenic
1163593610 19:18208086-18208108 CTTTTAAAAAGAAGATATTTAGG - Exonic
1163871876 19:19828532-19828554 CATTCCAAAAGCATAATTCTGGG - Intergenic
1163891083 19:20014469-20014491 CTTTTAAAAAGCAGAAAATTGGG + Intronic
1164138905 19:22439960-22439982 CTGTAAAAAAGCAGAACTGTGGG - Intronic
1164279308 19:23755026-23755048 CTTTTATAAATCAGTATTTTGGG - Intronic
1165207352 19:34201706-34201728 CCTTTTAAAATCAGAATACTAGG - Intronic
1165707548 19:37987304-37987326 CATCTGAAAAGCAGACTTCTAGG - Intronic
1166038792 19:40190100-40190122 CTTGTAAGAGGCAAAATTCTGGG - Intergenic
1167793943 19:51697023-51697045 TATTTAAAATGCAGATTTCTGGG + Intergenic
1167914651 19:52730882-52730904 CTTTATAAAAGCAGTAGTCTTGG - Intronic
1202657653 1_KI270708v1_random:38422-38444 ATTTTAAAAAACATAATTGTAGG + Intergenic
925004319 2:429249-429271 CTTTTCAAAACCAGATCTCTTGG - Intergenic
925498180 2:4476041-4476063 CATTTTTAATGCAGAATTCTAGG + Intergenic
926018996 2:9478187-9478209 ATTTTAAAAAGATGAATTGTGGG - Intronic
926169863 2:10546173-10546195 CCTTTAAAAAGAAAAATTCTGGG - Intergenic
926346906 2:11955323-11955345 CCTTTAAAATGTAGACTTCTAGG - Intergenic
926367892 2:12150300-12150322 ATCTTAAAATGTAGAATTCTGGG + Intergenic
926522119 2:13928375-13928397 TTTTTTAAAAACAAAATTCTGGG + Intergenic
926636978 2:15191360-15191382 TTTGTAAAATGCAGAATTCATGG - Intronic
927042253 2:19241266-19241288 CTTTTGAAAAGTAAAATGCTGGG + Intergenic
927338793 2:21956309-21956331 CTTTTAAGAAGCAGAATTAGAGG - Intergenic
928132236 2:28660951-28660973 CTTTTAAAATCCAGATTGCTGGG - Intergenic
928226269 2:29450869-29450891 CTGTTAAAAAACAGATTCCTAGG + Intronic
928506055 2:31954281-31954303 CTTTTAGAAATCATAATTCTTGG + Intronic
928736426 2:34296123-34296145 CTATTAAAATGCAAAATCCTAGG + Intergenic
928898745 2:36294986-36295008 CTATTAAAACGCAGGTTTCTAGG - Intergenic
929185345 2:39088238-39088260 TTTTTTAAATGCAGGATTCTGGG + Intronic
929210590 2:39352679-39352701 CTTCTATAAAGCAGAATACCTGG - Intronic
929549907 2:42883430-42883452 CTTTATACAAGCAGAAATCTGGG + Intergenic
929849583 2:45572261-45572283 TTTTTAAAATATAGAATTCTTGG - Intronic
930036347 2:47087683-47087705 CTTTTAAAAATTAGAACTCGTGG - Intronic
930296362 2:49559620-49559642 ATTTTATACAGGAGAATTCTGGG + Intergenic
930621290 2:53646504-53646526 TTCTTAAAAAGTAGAATTATTGG - Intronic
930648869 2:53943935-53943957 CTTTTAAAAAGTATACTTTTAGG + Intronic
930649845 2:53953533-53953555 CTTTTAAAATGCATTATTCTTGG + Intronic
930865288 2:56116686-56116708 GTTTTAAAAAGCAGATTACTAGG - Intergenic
931123020 2:59241618-59241640 CTATTAAAATGCAGATTGCTGGG + Intergenic
931163938 2:59725015-59725037 ATTTTAAAAAGCAGAAATTATGG - Intergenic
932086666 2:68768751-68768773 CTTATCAAAAGCAAAACTCTCGG + Intronic
932249331 2:70228590-70228612 CTTTAAAAATGCAAAATTGTTGG + Intronic
932395907 2:71447804-71447826 CTTTTAAAAGCCAGATTCCTGGG + Intergenic
932531990 2:72544912-72544934 CTGTAAAAATGCAAAATTCTAGG - Intronic
932874840 2:75440618-75440640 AATTTAAAAACCAGCATTCTTGG + Intergenic
932998277 2:76884104-76884126 CTTTTAAAAATCACATTTCCTGG - Intronic
933069728 2:77842217-77842239 CTTGTTAAAAACAGATTTCTGGG + Intergenic
933209418 2:79549916-79549938 CCTGTAAATAGCAGAACTCTCGG - Intronic
934533783 2:95115312-95115334 CTTTTAAGAATCAGATTTTTAGG + Intronic
934718375 2:96556163-96556185 TCTTTAAAAACCAGAATTTTTGG + Intergenic
935009135 2:99114706-99114728 CTTTCAAAAGGAAGAATTTTTGG - Intronic
935375453 2:102391327-102391349 CTTTTAAAAAGAACAAATCCTGG + Intronic
935559329 2:104544331-104544353 CTTTGAAAGAGCTGAATACTTGG - Intergenic
935836703 2:107062851-107062873 TATTTTAAAAGCAGAGTTCTGGG - Intergenic
937280634 2:120715152-120715174 CTTTTAAAAGGGAAAATTCCTGG + Intergenic
937383512 2:121404200-121404222 TCTTTTAAAAACAGAATTCTTGG - Intronic
937768519 2:125690669-125690691 CATTTAAAAAACATAATCCTTGG + Intergenic
938783940 2:134608815-134608837 CTTTTCACCAGCACAATTCTCGG - Intronic
939102602 2:137912868-137912890 TTTTTAAAAAGCAACATTTTGGG + Intergenic
939532622 2:143383309-143383331 CTTTTCTCAAGCAGATTTCTTGG + Intronic
939844934 2:147231354-147231376 CTTTTAAAAACCAGAGATGTGGG - Intergenic
940220338 2:151345005-151345027 ATTGAACAAAGCAGAATTCTCGG - Intergenic
940268349 2:151863982-151864004 CTTTTATAAAAAAGAATTTTGGG - Intronic
940421561 2:153485001-153485023 ATTTTAAAAATCATAACTCTTGG - Intergenic
940424365 2:153513950-153513972 CTTTTAGAAACTACAATTCTAGG - Intergenic
940959353 2:159765979-159766001 TTTTTAAAATGGAGAAATCTGGG - Intronic
941068029 2:160925146-160925168 CTTTTAAAATGCAGATTCCTGGG + Intergenic
941187074 2:162330362-162330384 CTATTAAAAATCAAAATTATTGG - Intronic
941283686 2:163582912-163582934 CTTTTAGAACACAGATTTCTGGG + Intergenic
941639322 2:167970176-167970198 CTATGAGAAAGAAGAATTCTGGG - Intronic
941733667 2:168948252-168948274 CTTTTAAAAAGCAAACATCCAGG + Intronic
941948416 2:171126587-171126609 CTTTTAAAAACCTGCATTCTAGG - Intronic
942100687 2:172580001-172580023 ATTTTAAAAATAAGGATTCTTGG - Intronic
942230554 2:173857686-173857708 CTTTAAAAAATTAGAATTCTAGG + Intergenic
942473637 2:176290579-176290601 CTTATAAAAAGCTGATCTCTTGG - Intronic
943063948 2:183067806-183067828 CTTTTAAAAAACACAATTTTTGG - Intergenic
943401562 2:187418188-187418210 CTTTTAATGACCAGAATTCCAGG - Intronic
943474219 2:188334435-188334457 TTTTTAAAATTCAGACTTCTGGG + Intronic
943501136 2:188690921-188690943 TTTTTAAAAAGCATAACTCCTGG + Intergenic
943690772 2:190867683-190867705 TTTTTAAAAATCATATTTCTGGG + Intergenic
943813997 2:192227998-192228020 CTTTTTAAAAATAGGATTCTGGG + Intergenic
943996547 2:194773789-194773811 TTTTTAAAAAACAGTACTCTTGG + Intergenic
944091782 2:195919643-195919665 CTTTAAAAAAGTAGACTTTTTGG - Intronic
944142174 2:196468475-196468497 GCTTTAAAAATCAGAATCCTAGG - Intronic
944428278 2:199606376-199606398 CTTAAACAAAGGAGAATTCTTGG + Intergenic
944642083 2:201737998-201738020 CTATTAAAATACAGAATTTTTGG + Intronic
944665102 2:201953280-201953302 TTGTTAAAATGCAGATTTCTGGG + Intergenic
944669102 2:201980649-201980671 TATTTGAACAGCAGAATTCTTGG + Intergenic
945303869 2:208240135-208240157 CTTCTGAAAGGCAGAATTATTGG - Intronic
945346669 2:208726072-208726094 CCTTGAACAAGCAGACTTCTGGG - Intronic
945372844 2:209041596-209041618 CTTTAAAAAAAAAAAATTCTGGG + Intergenic
945622292 2:212155537-212155559 TTGTTAAAATGCAGAATTATGGG - Intronic
945638815 2:212396078-212396100 CGCTTAAAAATCAGAATTTTTGG - Intronic
945687415 2:212988601-212988623 ATTTTAAAAAGTAGACTCCTAGG + Intergenic
945704168 2:213208638-213208660 TTTTTAAAAAACAAAATTATGGG - Intergenic
945721032 2:213418859-213418881 CTTTTAAAAGCCAGAATTCTGGG + Intronic
946160923 2:217835460-217835482 CATTTAAAATGCAGATTCCTGGG + Intronic
946500381 2:220240894-220240916 CTTTTAACTAGCAGAATTCATGG - Intergenic
947292050 2:228586338-228586360 CTTTGACAAAGCAGTATTGTGGG + Intergenic
947566813 2:231199328-231199350 TGTTTAAAAGGCAGATTTCTGGG + Intronic
948428617 2:237904037-237904059 CTCTTAAAAAGGAGAATGCTAGG - Intronic
948800597 2:240431728-240431750 CTTTTGATCAGCAGAAGTCTGGG - Intergenic
1168749781 20:274287-274309 CTTTCCAAAAGCAGAATTTAAGG - Intronic
1169527027 20:6440230-6440252 CTTTAAAAAAGCAGATTATTAGG + Intergenic
1169571906 20:6915410-6915432 CTTTTAAAAAGTATGATTTTGGG + Intergenic
1170175578 20:13465260-13465282 TTTTTAAAAAGCAGATGACTAGG + Intronic
1170318808 20:15071021-15071043 TTTTTCAAAAACAGAATTCCTGG - Intronic
1170649795 20:18228821-18228843 CTTTTAAAAAGAACAGTTTTAGG - Intergenic
1171152972 20:22844109-22844131 CTTTTAAAAAGGGGAAATTTGGG + Intergenic
1171204033 20:23265437-23265459 CTGTTAAAAACATGAATTCTCGG + Intergenic
1172034947 20:32003990-32004012 CTTTAAAAATGCAGATTTCCAGG - Intergenic
1172477557 20:35250251-35250273 CTTTTAAAATGTTTAATTCTTGG - Intronic
1172542290 20:35728085-35728107 CTCTTAAAAATAAGAATTGTAGG - Intronic
1172751362 20:37253431-37253453 CTGTTAAAATTCAGATTTCTGGG + Intronic
1173032973 20:39379292-39379314 CCCTTAAAAATCAGAATGCTGGG - Intergenic
1173417065 20:42866095-42866117 TTTTTAAAAAGCAGATTCCTGGG - Intronic
1173612023 20:44375943-44375965 CTTTTAAAAAATAGGATTCTAGG + Intronic
1174245455 20:49176088-49176110 CTTTTAAAAAGCATTATTGCCGG - Intronic
1174661772 20:52219954-52219976 TATTTAAAAGGCAGAATCCTTGG - Intergenic
1174988084 20:55478428-55478450 CTGTTAAAAAGGACAGTTCTGGG - Intergenic
1175395582 20:58657776-58657798 TTTTTAAATAGCAGAATGGTGGG + Intronic
1176739169 21:10583032-10583054 ATTTTTAAAAGCAGTATTATTGG - Intronic
1176788497 21:13289502-13289524 CTTTTAAAAAGCTAAATATTTGG - Intergenic
1177086801 21:16715268-16715290 CTTTTAGAAAGCAGAGTTCAAGG - Intergenic
1177213159 21:18095211-18095233 CTTTCAAAAAGCCAAATTTTTGG - Intronic
1177240531 21:18450509-18450531 ATTTTCAAAAGCCGAGTTCTGGG + Intronic
1177366032 21:20138220-20138242 TAGTTAAAAAACAGAATTCTGGG - Intergenic
1177527286 21:22310954-22310976 TTTTTAAAATGCAAAATACTTGG + Intergenic
1177962196 21:27681041-27681063 CTCTTAAAATCCAGAGTTCTAGG + Intergenic
1177987647 21:27997704-27997726 CTTTTAAAAAGCTAAATATTTGG - Intergenic
1178322207 21:31614314-31614336 CTTTTAAAAAACAAAAATGTAGG - Intergenic
1178626997 21:34226745-34226767 CTTTTAAAATGCAGATTCCAGGG + Intergenic
1178713809 21:34945252-34945274 TTTTGAAAAAGAAAAATTCTAGG - Intronic
1179769924 21:43606872-43606894 CTTTTAAAAATGAGCATTCTGGG + Intronic
1180131093 21:45827695-45827717 CTGTTAATAAGCAGAACTCAGGG + Intronic
1180217246 21:46333131-46333153 CTTTTTTAAAGTAGAATTCATGG + Intronic
1180420908 22:12814075-12814097 ATTTTAAAAAGCGTAATTGTAGG - Intergenic
1180534402 22:16384923-16384945 GGTTTAAAAAACACAATTCTGGG + Intergenic
1180580475 22:16831452-16831474 CTTTTCAGAAGCAGCATTCATGG + Intergenic
1181850138 22:25743926-25743948 GTTTTAAAATGCAGATTCCTGGG + Intronic
1181914567 22:26269276-26269298 TTTTTAAAAGGCAGATTTCTAGG - Intronic
1181922516 22:26331681-26331703 CTTTTTAAAACAAGAAGTCTGGG + Intronic
1182305121 22:29362658-29362680 CTTTTAAAAACCAGAAGACCTGG + Intronic
1182819746 22:33205357-33205379 CTTTTTAAAAGCTGAATTAGGGG - Intronic
1183313769 22:37126249-37126271 CTTGAAAAAAGCTGAATTATTGG - Exonic
1183998193 22:41652082-41652104 TTTTTAAAAAGCTAAATTCCAGG - Intronic
1184218451 22:43083052-43083074 TTTTTAAAAAGGAGTATTGTTGG - Intronic
1184314490 22:43674110-43674132 TTTTTAAAAAACAGAAGTATGGG + Intronic
1184355159 22:43974841-43974863 TTTTTAAAGAGCAGATTTTTAGG + Intronic
1184909733 22:47521934-47521956 TATTTAAAAATAAGAATTCTGGG - Intergenic
1203315241 22_KI270737v1_random:873-895 GGTTTAAAAAACACAATTCTGGG - Intergenic
949403714 3:3693124-3693146 CTTTTAAAAATTAGAAATCTAGG - Intergenic
950458733 3:13108378-13108400 ATTTCAAGAAGCAGAATTATGGG + Intergenic
950587050 3:13900482-13900504 CTTTTAAAAAGTAAAATCCAGGG - Intergenic
951035343 3:17926359-17926381 ATGTTAAAATGCAGATTTCTAGG + Intronic
951249815 3:20381823-20381845 CATTTAAAAAGGAGGGTTCTTGG + Intergenic
951277548 3:20707084-20707106 ATTTTCAAAAGCAAAATTCTAGG - Intergenic
951514316 3:23541653-23541675 CTTTTATAAAGTTGAATTTTTGG + Intronic
951681320 3:25297831-25297853 CTCTAAAAAAGTAGAAATCTAGG - Intronic
951768286 3:26225184-26225206 TATTTAAAATGCAGCATTCTGGG - Intergenic
953500348 3:43427076-43427098 GGTTTAAAAAGGAGATTTCTTGG + Intronic
953655034 3:44844344-44844366 TTTTTAAAATGCAGAATTCTGGG - Intronic
953966980 3:47315891-47315913 CTTTTGAAAACAAGAACTCTAGG + Intronic
954192745 3:48975861-48975883 CCCTTACAAAGCAAAATTCTCGG - Intronic
954641675 3:52103696-52103718 CTTTCAAAGAGCAGAAGTTTTGG - Intronic
954806754 3:53225088-53225110 TTGTTAAAATGCAGATTTCTGGG - Intronic
954904980 3:54053741-54053763 CTTTTCAAATCCAGAATACTGGG + Intergenic
955199283 3:56835474-56835496 CTTTTAAAAAGCCTAATGTTAGG - Intronic
956527566 3:70181671-70181693 GTTTTCAAAAGAAGAATTCAAGG - Intergenic
956878383 3:73486417-73486439 CTTTTAAGAATCATAATGCTTGG - Intronic
956989300 3:74744865-74744887 CTTCTAAAAAGCTTAATTGTAGG + Intergenic
956990760 3:74760928-74760950 TTTTTTGAAAGCAGATTTCTTGG + Intergenic
957400017 3:79699380-79699402 CATCTGAAAAGCAGATTTCTCGG + Intronic
957448890 3:80350409-80350431 TTTTTAAAAAGCACATTTCCAGG - Intergenic
957887809 3:86312946-86312968 CTCTAAAAAAGCAAAACTCTTGG + Intergenic
957899453 3:86469848-86469870 CTTAAAAGGAGCAGAATTCTGGG - Intergenic
958032082 3:88123585-88123607 TTTTTAAAAAACAGATTCCTAGG - Intronic
958113609 3:89184650-89184672 CTTTTCCAAGCCAGAATTCTTGG + Intronic
958482380 3:94659547-94659569 CATTTACAAAACAGAACTCTGGG + Intergenic
958527264 3:95279709-95279731 CTTTTAAAACACAGATTCCTGGG + Intergenic
958602173 3:96309867-96309889 TTTTTAAAAATCAGCCTTCTAGG - Intergenic
959134234 3:102396935-102396957 TTTCTAAAATGCAGATTTCTTGG + Intronic
959597519 3:108144186-108144208 ATATTAAAATGCAGATTTCTGGG - Intergenic
959641720 3:108645549-108645571 CTTTTGGAAAGCAGAGTTCAAGG + Intronic
959820295 3:110727451-110727473 GTATTAAACAGCATAATTCTAGG - Intergenic
960091308 3:113641643-113641665 CATTTAAAAACCACTATTCTAGG + Intergenic
960655463 3:119999007-119999029 GTTTATAAAAGTAGAATTCTAGG - Intronic
961055313 3:123783194-123783216 AGTGTCAAAAGCAGAATTCTTGG + Intronic
962293374 3:134156583-134156605 CTTTTAAAAAACAGTACTCCAGG + Intronic
962379016 3:134881788-134881810 TTTTAAAAAGTCAGAATTCTGGG - Intronic
962510444 3:136094331-136094353 CTTTTAAAATGTACAATTCAAGG - Intronic
962585948 3:136843021-136843043 ACTTTAAAAATCAGAGTTCTGGG + Intronic
962638042 3:137350953-137350975 CTTTCACAAATCACAATTCTGGG + Intergenic
962731725 3:138289800-138289822 TTTTTAAAGTGCAGATTTCTGGG + Intronic
962929742 3:140025352-140025374 CTTTGCAAGAGCAGAGTTCTGGG + Intronic
963022850 3:140888626-140888648 GTTTTAGAAAGCATAATTTTGGG - Intergenic
963454360 3:145524075-145524097 CTCTGAAAATGCAGAATTCCTGG + Intergenic
963463544 3:145648325-145648347 CTTTTAAAATGCTGACTTATAGG - Intergenic
963558632 3:146831303-146831325 CATTTAGAAAGCTTAATTCTAGG - Intergenic
963722659 3:148880630-148880652 CTTTTAAAAAAGTGAATTGTAGG - Intronic
963944107 3:151126471-151126493 CTCTTAAAAAGAATTATTCTAGG + Intronic
964050912 3:152392519-152392541 CTTTTAAAAAGTAGAAATTCTGG - Intronic
964123878 3:153216016-153216038 CTTTTATTAAGCAGCATTCCAGG + Intergenic
964139993 3:153386738-153386760 CTTTCAAAAAGCAAAAATGTTGG - Intergenic
964477227 3:157107954-157107976 CTGCTAAAAATCAGATTTCTTGG - Intergenic
964712237 3:159683349-159683371 CATTTAAAATGCAGATTCCTGGG - Intronic
965655414 3:170978163-170978185 CTTTTGCAAAGCAGAATTGGAGG + Intergenic
965772634 3:172196880-172196902 CTTTTTTAAAGAACAATTCTTGG + Intronic
965883295 3:173413299-173413321 ATTTTAAAAATGAGACTTCTCGG + Intronic
965905385 3:173699162-173699184 GTTTTAAAAAACAAAAATCTAGG + Intronic
966403226 3:179567627-179567649 CTTTTATTAACCAGAATGCTGGG - Intronic
966549389 3:181187420-181187442 TTTTTTAAATGCAGATTTCTGGG - Intergenic
966606944 3:181831102-181831124 CATTAAAAAAGAAGAAATCTTGG - Intergenic
966613063 3:181887445-181887467 TTTTTACAAAGCAGATTTCCAGG - Intergenic
967253360 3:187565490-187565512 TTTTTAAAAACCAGATTTCTTGG + Intergenic
967713329 3:192734868-192734890 CTTTTAAAAAGCAGGGTTTTTGG - Intronic
968016717 3:195341621-195341643 TTTTTAAAAACTAGAAATCTGGG - Intronic
968895347 4:3397640-3397662 CATGTCCAAAGCAGAATTCTTGG - Intronic
969295035 4:6264785-6264807 CTGTTAAAATGCAGATTCCTGGG + Intergenic
969934936 4:10671083-10671105 ATTTTAAAAAGCAGAATTTGAGG + Intronic
969967820 4:11014871-11014893 CTTTCACAATGCAGAATTGTTGG + Intergenic
970220501 4:13805528-13805550 GTTTAAAAATGCAGATTTCTAGG - Intergenic
970762374 4:19506581-19506603 CTTTTTAAAAGAAGAATTTTAGG + Intergenic
971212683 4:24634853-24634875 CTTTTAAAAAATCCAATTCTAGG - Intergenic
971541396 4:27821367-27821389 CTTTTAATCTGGAGAATTCTAGG - Intergenic
971617204 4:28807218-28807240 ATTTTAAAAACCAGGACTCTAGG + Intergenic
971830104 4:31681118-31681140 CTTATTTAAAGCAGAAATCTTGG - Intergenic
971939410 4:33195687-33195709 TTTTTAAAAATCAGAATAATAGG + Intergenic
971948075 4:33307053-33307075 CTTTTAACAACCAGATTTCAGGG + Intergenic
972369894 4:38413087-38413109 CATTTAAAATGCAGATTCCTGGG + Intergenic
973232606 4:47859540-47859562 ATTTTAAAAAGCAGAAATACCGG + Intronic
973257859 4:48130880-48130902 CTGTTAAAAGGCAGGTTTCTGGG - Intronic
973594747 4:52476169-52476191 CTTTTAAAATACTGAATTCTTGG - Intergenic
973813810 4:54599578-54599600 TTTTTAAAAAACAAAATTATGGG - Intergenic
973854288 4:54994942-54994964 ATCTGAAAAAGCAGAATTCAAGG - Intergenic
973998847 4:56489323-56489345 ATTTTCAAAAGCGGTATTCTGGG + Intronic
974798345 4:66782422-66782444 CTTTTTAAAAGCATAATTAAGGG + Intergenic
974907279 4:68074001-68074023 TTTTTAAAAATCAGATGTCTAGG - Exonic
975071088 4:70139184-70139206 TTTTTAAAAAGCATAATTTCAGG - Intronic
975322572 4:73025210-73025232 CTATCCAATAGCAGAATTCTTGG + Intergenic
975476726 4:74832088-74832110 TTTTAAAAATGCAAAATTCTGGG + Intergenic
976378893 4:84377044-84377066 CATTTAAAAATCTGCATTCTAGG - Intergenic
976522705 4:86047855-86047877 CATTTTAAAAGGAAAATTCTAGG + Intronic
976597444 4:86907258-86907280 TCTTTAAAATGCAGAATCCTGGG - Intronic
976689036 4:87848497-87848519 TTTTTAAAAAGCAAATTACTAGG - Intergenic
977058296 4:92221176-92221198 CTTATATAAACCAGTATTCTTGG + Intergenic
977314721 4:95431320-95431342 CTGTTAAAACTCAGATTTCTAGG + Intronic
977415114 4:96722497-96722519 ATTTTAAAAAGAAGATTTCACGG - Intergenic
978549420 4:109909260-109909282 CTTTTAAAAAACACCATTTTTGG - Intergenic
978941524 4:114441686-114441708 ATTTAAAAAAACAAAATTCTAGG - Intergenic
979121579 4:116909250-116909272 CTTTTTAAAAGTAGAATTAGTGG - Intergenic
979342819 4:119547803-119547825 TTTCTGAAAAGCAGAATTGTTGG - Intronic
979488964 4:121302485-121302507 ATGTTAAACAGCACAATTCTTGG + Intergenic
979493531 4:121358116-121358138 TTTTAAAAAAGCAAAAATCTGGG + Intronic
980381400 4:132023736-132023758 CTTTTAAATAGTATAACTCTAGG + Intergenic
980423019 4:132588521-132588543 TTTTTAAAAATCAGACTTGTAGG + Intergenic
980545521 4:134256644-134256666 CTTTTAAAAATCAATATTCTAGG + Intergenic
980708910 4:136538684-136538706 ATAGTAAAAAGCAGAATTCTAGG + Intergenic
980878055 4:138681949-138681971 CCTGGAAAATGCAGAATTCTGGG - Intergenic
981017770 4:139992130-139992152 CTTTTAACTAGCATAATTTTGGG + Intronic
981835637 4:149050177-149050199 CTTTAAAAAAGAAGAATTGGTGG - Intergenic
982006358 4:151066728-151066750 CTTTTAAAAAGAAATATTTTAGG - Intergenic
982254506 4:153439046-153439068 TTTTTAAAAATCGGGATTCTAGG + Intergenic
982379136 4:154729676-154729698 TATTTAAAAAGCAGATTCCTGGG - Intronic
983156918 4:164359873-164359895 CTGCTAAAAACCAGATTTCTGGG - Intronic
983233649 4:165154809-165154831 TTTTAAAAAATTAGAATTCTAGG + Intronic
983670870 4:170236453-170236475 CTATTAAATAGCAGCATTTTAGG + Intergenic
983714517 4:170762540-170762562 TTTTTAAAAAGAATAATTGTTGG + Intergenic
983866335 4:172771701-172771723 TTGTTAAATAGCAGATTTCTGGG + Intronic
983994177 4:174160618-174160640 TATTAAAAAAGCAGAATTTTGGG + Intergenic
984337227 4:178408073-178408095 CTTTTAAAAATCAAAAATCGAGG - Intergenic
984617915 4:181919454-181919476 GCTTTAAAAAGCTGAATTCAGGG - Intergenic
984629584 4:182046909-182046931 CATTAAAAAAGAAAAATTCTTGG - Intergenic
984681416 4:182614399-182614421 CTTTTAAAAAGGATGATTCTAGG - Intronic
985816009 5:2128575-2128597 GTTTTTAGAAGCAGAATTTTGGG + Intergenic
986541301 5:8847068-8847090 ATTTTATAGAGCAGAAATCTAGG + Intergenic
986875766 5:12106769-12106791 CAGGTTAAAAGCAGAATTCTGGG + Intergenic
987107751 5:14657250-14657272 TTTTTAAAAAACAGAATTAGAGG - Intergenic
987225477 5:15836056-15836078 CATTCAAAAAGTAGAATTCCTGG + Intronic
987257413 5:16170370-16170392 CTTTTATAAAAAAAAATTCTGGG + Intronic
987457761 5:18168045-18168067 CTTTTAAAAATAAATATTCTGGG - Intergenic
987646916 5:20685365-20685387 CTTTTATATAGCAGATTCCTGGG + Intergenic
987879339 5:23721689-23721711 TTTTTAAAAACTAGAATTTTGGG - Intergenic
988011738 5:25496568-25496590 CATTTAAAAAGCTGAATTAAGGG + Intergenic
988035968 5:25828125-25828147 CTTTTTAAAAATAGATTTCTTGG - Intergenic
988697094 5:33633188-33633210 CTTTTAAAAATAATAAGTCTTGG + Intronic
988726654 5:33933138-33933160 CTTTTAAAAATTTGAATTCTGGG - Intergenic
988812402 5:34798592-34798614 CTCTTAAGAAGCATAGTTCTTGG + Intronic
988821963 5:34896039-34896061 CTTTTCCAAATCAGGATTCTAGG + Intronic
988995080 5:36706926-36706948 CTTTTAAAATTCCGAATTTTGGG - Intergenic
989082381 5:37637039-37637061 GTTTTAAAATGAAGAATTTTAGG + Intronic
989628672 5:43458400-43458422 CTTTTTAAAAACATATTTCTAGG - Intronic
989696666 5:44209526-44209548 CTTTTGAATAAAAGAATTCTTGG - Intergenic
989740651 5:44767021-44767043 TGTTCAAAATGCAGAATTCTGGG - Intergenic
989754291 5:44934197-44934219 ATTTTAAAAAGATGAATTGTTGG - Intergenic
990985950 5:61641117-61641139 TATTTAAAATGCAGATTTCTGGG + Intronic
991094354 5:62723657-62723679 CTTTCAAAAAGAGGACTTCTAGG + Intergenic
991099370 5:62775820-62775842 CATTCCAAAAGCAGAATTCTGGG + Intergenic
991433066 5:66568390-66568412 CTGTTAAAATGCAGATTCCTAGG - Intergenic
991688984 5:69208065-69208087 ATTTTAATAAGCAGCATTTTAGG - Intronic
992010768 5:72525177-72525199 AGTTTAAAAAGCAGAGCTCTTGG + Intergenic
992017297 5:72588553-72588575 CTTTTAGAAAGCAGATGCCTTGG + Intergenic
992223786 5:74598675-74598697 CTTTTTAGAAGCAAAATTCTTGG - Intergenic
992384601 5:76271795-76271817 TTTTCAAAAAGCTGATTTCTTGG - Intronic
992635652 5:78723707-78723729 ATTTTAAGAATCAGAAATCTAGG + Intronic
992907739 5:81362810-81362832 TTTTTAAAATGCAGTTTTCTGGG - Intronic
993090363 5:83418567-83418589 GTTTTAAAAAGCAAAGATCTCGG - Intergenic
993557464 5:89358675-89358697 CTTTTAAAAAATTGAATTCATGG + Intergenic
993679715 5:90861205-90861227 TTTTTAAAAAACAGATTTCTTGG - Intronic
993740129 5:91528586-91528608 CTTTTCAAAGTCAGAAGTCTTGG + Intergenic
993835840 5:92818950-92818972 ATGTTAAAATGCAGATTTCTAGG + Intergenic
994059932 5:95463483-95463505 CCTTTAAAATGCAGAGTCCTAGG + Intergenic
994386618 5:99141052-99141074 ATATTAAAATGCAGATTTCTAGG + Intergenic
995576589 5:113542600-113542622 CTTTTAAAAAATAAAATTTTTGG - Intronic
995708073 5:115005824-115005846 CTTTTAAAAAAGAGAGTTATTGG - Intergenic
995859680 5:116628218-116628240 CTTCTAACAAGCAGAGATCTGGG + Intergenic
995987691 5:118199650-118199672 ATTTTAAAAAGCAAAACTCTAGG + Intergenic
996198876 5:120645092-120645114 CTTTTAAAATGCAGATTATTTGG + Intronic
996248075 5:121290105-121290127 TTTTTTAAAATTAGAATTCTTGG - Intergenic
996422763 5:123280380-123280402 CTTTGATAAATCAGTATTCTAGG + Intergenic
997074436 5:130655146-130655168 CTTTTATTCAGCTGAATTCTCGG + Intergenic
997147211 5:131448829-131448851 CTATTATAAAGAAGAATACTTGG - Intronic
997170759 5:131717828-131717850 CTTTTAAAAATCAGTATTTTTGG + Intronic
997342817 5:133159010-133159032 TTTTTAAAAAGGAAAATTATCGG + Intergenic
998318565 5:141207542-141207564 ATTTTAAAATGCAGACTTGTTGG + Intergenic
998503015 5:142649998-142650020 TTTTTAAAATGCAGATTCCTGGG + Intronic
998534841 5:142920034-142920056 CTTTAATGAAGCAGCATTCTTGG + Intronic
998560816 5:143170044-143170066 CATTTAAAAAACAAATTTCTGGG + Intronic
998678023 5:144431627-144431649 CTTTAATAATGCAGATTTCTTGG - Intronic
998792791 5:145783510-145783532 CTGTTAAAAATCAGAATTCTTGG + Intronic
999344217 5:150800897-150800919 CCTTAAAAATGCAGAATTCTTGG - Intergenic
999377156 5:151094722-151094744 CTTTGAAAAACCAGAGTGCTGGG - Intergenic
999409631 5:151339608-151339630 CTTTTAAAAAGAACTATTGTTGG - Intronic
999518909 5:152330292-152330314 TTTTTAAAATGCAGACTCCTGGG + Intergenic
999852605 5:155559184-155559206 CTTTCAAAATGTAGAATTTTAGG + Intergenic
1000396566 5:160781246-160781268 CCTTAGAAATGCAGAATTCTAGG - Intronic
1000467714 5:161600555-161600577 CTCTTAAAAAAAAAAATTCTAGG - Intronic
1000670031 5:164049934-164049956 CTTGTAAAAAACACAATTCTTGG - Intergenic
1000675595 5:164119138-164119160 ATTTTAGAAAGCAGCATTCAAGG - Intergenic
1000750406 5:165088634-165088656 AGTTTAAGAAGCAGCATTCTAGG + Intergenic
1000879367 5:166679756-166679778 CTTTTAAAATGCACAAGTCTAGG - Intergenic
1001038506 5:168315260-168315282 CTTGTAAAATGCAGATTCCTGGG + Intronic
1001424474 5:171614498-171614520 CTGTTAAAATGCAGAGTTCAGGG - Intergenic
1001571000 5:172730457-172730479 CTTGTTAAATGCAGAATCCTGGG - Intergenic
1001582775 5:172810438-172810460 CTTGCCCAAAGCAGAATTCTGGG + Intergenic
1001692255 5:173641896-173641918 CTGCTAAAAGGCAGATTTCTGGG + Intergenic
1002851731 6:1002876-1002898 TTTTTAAAAAGAAAAAATCTAGG - Intergenic
1002977698 6:2099833-2099855 CTTTTAAAAATCATACTTTTTGG - Intronic
1003314402 6:4998914-4998936 TTTTTAAAAACTAGAATTTTGGG + Intronic
1003349726 6:5304835-5304857 TTTTTAAAAGTCCGAATTCTAGG - Intronic
1003393204 6:5731151-5731173 CTTTTAAAAAGCCCAACTCCCGG - Intronic
1003513621 6:6801518-6801540 CATTTAAAAAGCAGAAATAAAGG + Intergenic
1004157006 6:13178549-13178571 CTATTAAAAAACAGATTGCTGGG - Intronic
1004558337 6:16721848-16721870 CTTTTGAGAAACAGAATTCTTGG + Intronic
1004635480 6:17463668-17463690 TTATTAAAAAGCAGAATCTTGGG - Intronic
1004879607 6:19994831-19994853 CTTTTTAAAAGCTGCTTTCTAGG - Intergenic
1005139739 6:22614946-22614968 CTTTTACAAAGCAGAAAGGTGGG - Intergenic
1005343302 6:24863999-24864021 CATTTAAAAAACATTATTCTAGG + Intronic
1005516022 6:26555012-26555034 TGTTTAAAACGCAGAAATCTGGG - Intergenic
1005709348 6:28488810-28488832 CTTTTAAAAAGTAAATTTTTAGG - Intergenic
1005920045 6:30393152-30393174 CTTTTATAAACCACAATTCAAGG - Intergenic
1006808029 6:36801320-36801342 CTTTTAAAATGCAGATTCCCAGG - Intronic
1007318053 6:41005547-41005569 CTATTAAAAAACCAAATTCTGGG - Intergenic
1007426486 6:41749389-41749411 CTTTAATATAGCAGAATTCATGG + Intronic
1008270904 6:49488182-49488204 CTTTCAAAAAAGAGACTTCTTGG - Intronic
1008585927 6:52948871-52948893 CTTCTAAAAAGCAAAAATCTAGG + Intergenic
1008788987 6:55205625-55205647 TTTTTTAATAGCAGAAGTCTTGG - Intronic
1009160840 6:60279897-60279919 CTTTTTAAAAGCAAAAGGCTGGG - Intergenic
1009840738 6:69070653-69070675 TTATTAAAATGCAGATTTCTAGG + Intronic
1010261001 6:73816744-73816766 CTTTTCAAAATTAGAATTTTAGG - Intronic
1010318714 6:74481801-74481823 CTTTTTCAAAGCAGATTTATTGG - Intergenic
1010409904 6:75549512-75549534 CATTTAAAAAGCAGTATTTGGGG - Intergenic
1010912422 6:81575598-81575620 TTTTTATGAAGCAGAATTCCAGG + Intronic
1011134810 6:84088738-84088760 CTCTTAAAATGCAGATTCCTGGG - Intronic
1011515925 6:88153011-88153033 ATTTTTTAAAGCAGAATTCTAGG - Intronic
1011532597 6:88339669-88339691 TTTTTAAAAAACAGATTTCTTGG + Intergenic
1012201973 6:96417955-96417977 CTTTTAAAAATGAAGATTCTAGG + Intergenic
1012217777 6:96609486-96609508 CTTTTAAAAAGTAGAATTCATGG + Intronic
1012289964 6:97441641-97441663 CTTTGCAAAAACAGAGTTCTAGG + Intergenic
1012385060 6:98671186-98671208 TTTTTATAAAGCCAAATTCTTGG + Intergenic
1012533881 6:100272098-100272120 TTTTTAAAAATCATAATTCTGGG + Intergenic
1012556012 6:100512408-100512430 CTTTTAAAGTGCAGATTCCTTGG - Intronic
1013136965 6:107291664-107291686 ATTTTTAAAAACAGAATTCTAGG - Intronic
1013287266 6:108692370-108692392 GTTTGAAAAGGCAGAATTTTAGG - Intergenic
1013710864 6:112896503-112896525 GATTTAAAAAGTAGAATTTTTGG + Intergenic
1014120040 6:117714250-117714272 TTTTTAAAATAGAGAATTCTTGG - Intergenic
1014231439 6:118907118-118907140 CTTTTAGAAAACAGAAGTATAGG + Intronic
1014415764 6:121181911-121181933 AGTTTAAAAAGCAGATTTCATGG + Intronic
1014510306 6:122312886-122312908 ATTTTAAAAAGTTGTATTCTGGG - Intergenic
1014528332 6:122528297-122528319 CTTTTAGAAAGCAGATAGCTGGG + Intronic
1014983887 6:127978797-127978819 CTTTGAAATTACAGAATTCTTGG + Intronic
1015102476 6:129497533-129497555 CTCTTAAAAAGCTAAATTCTGGG - Intronic
1015116796 6:129658845-129658867 ATCTTAAAAAGCACAATTGTGGG + Intronic
1015682096 6:135819768-135819790 ACTTTAAAAAGCAAAATCCTAGG - Intergenic
1016090466 6:139971832-139971854 ATTCTAAGAAGCAGAATACTTGG + Intergenic
1016126852 6:140414287-140414309 TTTTTAAAAAGCATATTTATTGG + Intergenic
1016671756 6:146717578-146717600 CTTTCAAAAATCAGAATTTAAGG + Exonic
1016755651 6:147682630-147682652 ATTTTAAAAATCAAAATTATAGG + Intronic
1016883488 6:148934829-148934851 TTTTAAAAATGCAGATTTCTGGG - Intronic
1017084954 6:150705334-150705356 CTTTTAAAAAATAAAATCCTGGG + Intronic
1017109351 6:150917912-150917934 AATTTAAAAATCAGAATACTTGG + Intronic
1017205299 6:151798587-151798609 CTTTTAAAAGGCTGATTTTTAGG + Intronic
1017569916 6:155732873-155732895 CTTTAAAAAGACAGAAATCTAGG - Intergenic
1017917913 6:158846941-158846963 TTTTTAAAAAGAAGAAGTCTGGG + Intergenic
1017952642 6:159149224-159149246 CATTTAAGAAATAGAATTCTGGG + Intergenic
1018076708 6:160222841-160222863 TTTTTAAAAAGCAGAAGATTTGG - Intronic
1018678510 6:166243515-166243537 TTGTTAAAAAGCAGACTGCTGGG + Intergenic
1020147239 7:5654050-5654072 CTTTTAAAAAAAATCATTCTGGG + Intronic
1020189282 7:5982671-5982693 CTTTAAAAAAGAAGAGATCTAGG - Intronic
1020293637 7:6741983-6742005 CTTTAAAAAAGAAGAGATCTAGG + Intergenic
1020700414 7:11474966-11474988 ATTTCAATAAGCAGAATTCTGGG + Intronic
1020813531 7:12875167-12875189 CTCTTTAAGAGCAGAGTTCTGGG - Intergenic
1020823955 7:13003429-13003451 CCTTTAAAAAGAGAAATTCTGGG - Intergenic
1020854912 7:13407340-13407362 CTTTGAACAAGTAGAAATCTTGG - Intergenic
1021028541 7:15700504-15700526 TATTTAAAAAGAAGAATTCAGGG + Intergenic
1021064660 7:16158654-16158676 CTTTTGAAAAGTAAAATTTTGGG - Intronic
1021070505 7:16232833-16232855 CTTTTAAAAAGCAGAAAATATGG + Intronic
1021271914 7:18599229-18599251 TATTTAAAAAGCAGAAACCTAGG - Intronic
1021436967 7:20629460-20629482 CCTTTAAAAAGAAGAAATCAAGG + Intronic
1021558887 7:21948927-21948949 CTTTTACAAAGCAAAAATCGTGG - Intergenic
1021959011 7:25853779-25853801 ATTTTAAAATGCATAATTATAGG + Intergenic
1021982719 7:26070389-26070411 CTTTCAAAAAGCATATTTCCTGG + Intergenic
1022578387 7:31521955-31521977 CTTATAAAAAGAAAAATTCCTGG - Intronic
1022641349 7:32186952-32186974 TTTCTAAAAAGCAGAATTCAAGG - Intronic
1022886377 7:34650672-34650694 CTTTAAAAAATCTGAATGCTTGG - Intergenic
1023054084 7:36278050-36278072 CTGTTAAAATGCAGACTTCTAGG + Intronic
1023483935 7:40664434-40664456 CTTTTAAAAATCATAATGCCAGG + Intronic
1023568194 7:41544616-41544638 CTTTAAAAACGCAAAATCCTGGG - Intergenic
1023648064 7:42340138-42340160 CTGTAAAATAGCAGATTTCTGGG - Intergenic
1024038217 7:45526580-45526602 CTGTTAAAAAACAGATTGCTGGG + Intergenic
1024113527 7:46171206-46171228 CTGTAAAACAGCAGAATTATAGG + Intergenic
1024579634 7:50791790-50791812 CTCTTAAAAATCAAAACTCTAGG - Intronic
1024996344 7:55275613-55275635 CTTTTAAAATACAGATTTCTGGG + Intergenic
1026181416 7:68044488-68044510 ATTTGAAAAAGCAGAACTCAAGG + Intergenic
1026505538 7:70979697-70979719 CTTTTAAGAAAGAGCATTCTGGG + Intergenic
1026779023 7:73251312-73251334 CTTTTAAAAAGAAGTATTTTAGG + Intergenic
1027019883 7:74804716-74804738 CTTTTAAAAAGAAGTATTTTAGG + Intronic
1027068143 7:75141225-75141247 CTTTTAAAAAGAAGTATTTTAGG - Intronic
1027171153 7:75873602-75873624 CATTTAAAAAGCAACATTCTTGG + Intronic
1027337723 7:77171685-77171707 CTTCTAAAAAGCAGCCATCTTGG + Intronic
1027564200 7:79769424-79769446 GTTTAAAAAAGCAGATTTCTAGG + Intergenic
1027944899 7:84732292-84732314 GTTTTACAAAACAGACTTCTAGG - Intergenic
1028153320 7:87400952-87400974 ATTTTAAAAAACAGATTCCTGGG + Intergenic
1028241566 7:88427299-88427321 TTTTCAAAAAACAGACTTCTTGG + Intergenic
1028607346 7:92669704-92669726 CTTTTAAAAATAAGAATTCCTGG + Intronic
1029035471 7:97515798-97515820 CTATAAAAATGCAGAATTATAGG - Intergenic
1029470919 7:100753520-100753542 CTTTTAAAGTGTACAATTCTAGG + Intronic
1029778011 7:102699119-102699141 CTTCTAAAAAGCAGCTATCTTGG - Intergenic
1029999190 7:105040569-105040591 CTTTTAAAATGAATAATTTTTGG + Intronic
1030082232 7:105788093-105788115 TTTTTAACAAGGAGGATTCTTGG + Intronic
1030198257 7:106875047-106875069 CATTTAAAATGTAGAATTCAGGG + Intronic
1030285149 7:107818358-107818380 CATTTAAAAATCAGATTGCTTGG - Intergenic
1031163786 7:118202107-118202129 CTATTTAATAACAGAATTCTGGG + Intergenic
1031305442 7:120120306-120120328 TTTTTTAAAAACAGAATTTTGGG + Intergenic
1031865949 7:127039426-127039448 CTTTTAACATCCAGAATTTTGGG + Intronic
1031919409 7:127589780-127589802 CTCTTTAGAAGCAGGATTCTGGG + Intronic
1032193324 7:129776567-129776589 CTATTAAAATGCAGATTTCCAGG - Intergenic
1032593696 7:133217695-133217717 ATTTTAAAAAACAGAATTCAAGG - Intergenic
1032634766 7:133694335-133694357 CTTTAAAAATGCAGATTTCAGGG - Intronic
1032931126 7:136672634-136672656 ATATTAAAAAACAGAAATCTTGG - Intergenic
1033014224 7:137655496-137655518 CTTTTATAAAGAATAACTCTGGG - Intronic
1033326278 7:140381196-140381218 TTTTTAAAGAGAAGAATTCTTGG - Intronic
1033829137 7:145231386-145231408 TTTTTAAAAAACAGAACCCTGGG - Intergenic
1034025566 7:147699712-147699734 ATTTTAAAATGAACAATTCTGGG + Intronic
1034368342 7:150571298-150571320 CGTTTGATAACCAGAATTCTGGG - Intronic
1034788572 7:153947401-153947423 CCTCTACAAAGCAGAATGCTGGG - Intronic
1035979054 8:4348421-4348443 TTTTTAAAAATCAGAATATTAGG + Intronic
1036564279 8:9925024-9925046 CTTTTAAGCAGCTGAATTCCAGG + Intergenic
1036973870 8:13386731-13386753 CTTTTAAATCACAGAATTCTAGG + Intronic
1037604372 8:20425135-20425157 CATATAAAAAGCTGAAATCTAGG - Intergenic
1037648910 8:20819021-20819043 CTATTGAAAAGCAAATTTCTTGG + Intergenic
1038300529 8:26342889-26342911 TATTTAAAATGCAGATTTCTGGG + Intronic
1039078968 8:33717508-33717530 CTTTTAAAATGCAACATTCATGG - Intergenic
1039588716 8:38728906-38728928 GTATTAAATGGCAGAATTCTAGG + Intronic
1039695607 8:39907167-39907189 CTTTTAAAAAGTAGAAGAGTAGG + Intronic
1039854820 8:41403082-41403104 CTGTTAAAATGCAGACTCCTGGG + Intergenic
1039926574 8:41939051-41939073 ATTTTAAAAAGCAGTAGTATTGG + Intronic
1040804949 8:51384458-51384480 CTTTTAATAAAAAGTATTCTGGG - Intronic
1040920036 8:52605920-52605942 CATTAAAAAACAAGAATTCTAGG - Intergenic
1041562618 8:59237184-59237206 ATTTTAACAAGCAGAAATCTAGG - Intergenic
1041650342 8:60296095-60296117 CTTTTAAAAATTATGATTCTTGG - Intergenic
1041806379 8:61854267-61854289 CCTTGAAAAAGTAGAAATCTAGG - Intergenic
1041901862 8:62991362-62991384 TCTTTAAAAACCAGAATTGTTGG + Intronic
1042233343 8:66581886-66581908 CATTTAAAAAGAAAAAGTCTGGG - Intronic
1042377210 8:68065470-68065492 TTTTTAAAAAGAACAATTTTTGG + Intronic
1042455946 8:69002821-69002843 CCTTTAAAAAGCAATTTTCTTGG - Intergenic
1042770548 8:72375771-72375793 ATTTTATAAAGAAGAATTTTTGG + Intergenic
1042872912 8:73414248-73414270 ATTTGAAAAAGCAGGAGTCTGGG + Intergenic
1043701929 8:83300258-83300280 GTTTTTAAAAGCAGATTTCTGGG + Intergenic
1044244556 8:89927657-89927679 CGTTTACAAAGCAGAATTTGGGG + Exonic
1044531854 8:93316404-93316426 CTTATAAAATGCAGATTTCCAGG - Intergenic
1045140204 8:99272001-99272023 CTTGTTAAATGCAGAATTCTGGG + Intronic
1045437325 8:102176760-102176782 GTTTTAAAAATCAGAAATCTAGG - Intergenic
1045604809 8:103760529-103760551 CTCTAAAAAGGCAGAATTCAAGG - Intronic
1045632413 8:104140962-104140984 ATTTTAAAAATCATAATTTTTGG + Intronic
1045896187 8:107220379-107220401 GTTTTAAAAAGTGGAATTATTGG - Intergenic
1046077716 8:109333228-109333250 ATTTTAAAATGCAGATCTCTGGG + Intronic
1046369821 8:113287898-113287920 CTTTTAATAATAAGAATTCTAGG - Intronic
1046380801 8:113447595-113447617 TTGTTAAAATGCAGATTTCTAGG - Intergenic
1046396902 8:113651556-113651578 CTTTTAGAAAGCAGGAGTATGGG + Intergenic
1046496848 8:115025115-115025137 ATTTTACAAAATAGAATTCTGGG + Intergenic
1046742258 8:117842051-117842073 TTGTTAAAACACAGAATTCTGGG - Intronic
1046758779 8:117998586-117998608 CTTAAAAAATGCAGAATTTTAGG - Intronic
1046848260 8:118943201-118943223 CTTTTAGAAAGTACAATCCTGGG - Intronic
1047073318 8:121372231-121372253 CTGTTAAAAACCTGAATCCTTGG + Intergenic
1047218751 8:122901399-122901421 TTATTAAAATGCAGATTTCTGGG - Intronic
1047451492 8:124968956-124968978 CTGTTAAAAAAAAGAATACTGGG + Intergenic
1047467475 8:125131756-125131778 TGTTTAAAATGCAGATTTCTGGG - Intronic
1047684160 8:127287038-127287060 CTTTTAAAAATCAAAATTAGTGG - Intergenic
1047790440 8:128198239-128198261 CTGTTAAAACTCAGATTTCTGGG - Intergenic
1047990402 8:130280304-130280326 CTTTTAAAAACTTGTATTCTAGG - Intronic
1048604586 8:135954507-135954529 TTTTTAAAAAGCAGAAATAGTGG - Intergenic
1048702260 8:137105239-137105261 CATTTAAACTGCAGAATTTTTGG - Intergenic
1048937179 8:139367066-139367088 CTTTTCAGATGCAGAATGCTAGG + Intergenic
1049052748 8:140211601-140211623 CTTTTAAAATAAAGAATTGTGGG - Intronic
1049931680 9:463352-463374 TTTTCAAAATGCAGATTTCTGGG - Intronic
1049952133 9:655570-655592 ATTTAAAAAAGCAGCATTTTGGG - Intronic
1050186746 9:2982766-2982788 CTTTTAAAACACAGATTGCTGGG - Intergenic
1050353474 9:4761894-4761916 GTTTTAAAATGCAGACTCCTAGG - Intergenic
1050463351 9:5895648-5895670 TTGTTAAAATGCAGATTTCTAGG + Intronic
1051026753 9:12622317-12622339 TTTTTAAATAGCAGAACTGTTGG + Intergenic
1051757391 9:20418399-20418421 GTATTAAAATTCAGAATTCTGGG + Intronic
1051816258 9:21109396-21109418 ATTTTAAAAAGAATAATTCCAGG + Intergenic
1051838360 9:21365857-21365879 AATCTAAAACGCAGAATTCTTGG - Intergenic
1051845346 9:21445884-21445906 AATATAAAAAGCAGAATTCTTGG + Intergenic
1051895815 9:21987896-21987918 TATTTAAAATGCAGATTTCTGGG + Intronic
1052166268 9:25333042-25333064 CTCTTAAAATGCAGATTCCTGGG + Intergenic
1052710989 9:32055225-32055247 ATTGTAAAAAGCAGAATTTTAGG - Intergenic
1052722822 9:32193031-32193053 CTTTTATAAAGTAGAGTTGTAGG - Intergenic
1052873839 9:33536994-33537016 ATTTTAAAAAGCAAAATTACAGG + Intronic
1053153888 9:35760684-35760706 CTTGTAAAAATCAGATCTCTGGG - Intergenic
1053179286 9:35954294-35954316 ATTTTAAAAATCACAGTTCTGGG - Intergenic
1053479891 9:38408436-38408458 ATTTTAAAAAAGAGAATGCTAGG + Intergenic
1053502206 9:38607355-38607377 ATTTTAAAAAGCAAAATTACAGG - Intergenic
1053595731 9:39559279-39559301 CTTTTAAAAAGCAGCATTTCTGG + Intergenic
1053853699 9:42315906-42315928 CTTTTAAAAAGCAGCATTTCTGG + Intergenic
1054570525 9:66805725-66805747 CTTTTAAAAAGCAGCATTTCTGG - Intergenic
1054704095 9:68445223-68445245 CTTGTAAAATGCAGATTTCAGGG + Intronic
1054969485 9:71068740-71068762 CTTTGAAAATGCAGATTCCTAGG - Intronic
1055219578 9:73912651-73912673 TTTTTAAAAAATATAATTCTGGG + Intergenic
1055908564 9:81320966-81320988 CTTTTGAAAAACAGATTCCTGGG + Intergenic
1056070161 9:82977996-82978018 ATTTTCAAATGCAAAATTCTAGG - Intergenic
1056326864 9:85487308-85487330 CTTTTAAAAAACAAAATTTATGG - Intergenic
1056404984 9:86264992-86265014 CATTCCAAAAGCATAATTCTGGG + Exonic
1056478410 9:86976105-86976127 CATTTCAAAAGCAAAATTATTGG - Intergenic
1057877570 9:98769429-98769451 CCTATAAAAAGCAAAAATCTAGG + Intronic
1057954133 9:99394040-99394062 TCTCTAAAAATCAGAATTCTAGG + Intergenic
1058001660 9:99872110-99872132 CTTCTAAAATGCAGATTGCTGGG - Intergenic
1058008076 9:99940779-99940801 TTTCTAAAAAGTAAAATTCTAGG - Intronic
1059700579 9:116772064-116772086 CTTTTAAACATCAGAATCCTAGG + Intronic
1060449152 9:123720926-123720948 CATTTAAAAAGCAGAATGCTAGG + Intronic
1061102378 9:128502072-128502094 ATTTTAAAAAGAAAAATTGTTGG - Intergenic
1061173652 9:128978069-128978091 CTTTTTAAACCCAGAGTTCTTGG + Intronic
1061175282 9:128991870-128991892 CTTGATAAAAGCAGAATTCCTGG + Intronic
1061336080 9:129937223-129937245 ATTTTCAGAAGCAGAATTTTTGG - Intronic
1062294044 9:135814320-135814342 TTATTAAAAAGCAGAATTTCTGG + Intronic
1062714594 9:138001460-138001482 CTTTTAAATAACAGCATTATTGG - Intronic
1203555762 Un_KI270743v1:206599-206621 ATTTTAAAAAGCGTAATTGTAGG - Intergenic
1186522463 X:10218322-10218344 CTTTTAAAAAGATGCATTTTCGG + Intronic
1186893453 X:13982986-13983008 TTTTTAAAAAACAGCATTATGGG + Intergenic
1186926673 X:14340774-14340796 CTGTTAAAACACAGATTTCTGGG - Intergenic
1187265606 X:17729913-17729935 CCTATAAAAAGTAGAATTCCAGG - Intronic
1187302546 X:18065067-18065089 CTTTTAAAATGCAGATTTTAGGG - Intergenic
1187493424 X:19774066-19774088 GCTTGAAAAGGCAGAATTCTGGG + Intronic
1187495013 X:19788101-19788123 CTTATAAAAAGGAGAACTTTGGG + Intronic
1188272859 X:28163283-28163305 GTTTTAAAAAGCATGTTTCTTGG + Intergenic
1188314807 X:28659880-28659902 CTTTTTAAAGGCAGATTCCTGGG - Intronic
1188343867 X:29039980-29040002 TTTTTAAAATGCAGATATCTGGG + Intronic
1188513630 X:30962295-30962317 CTTTTCAAATGAAGAATTGTTGG + Intronic
1188735631 X:33711226-33711248 CTTTTGAAAATCAGCAATCTGGG + Intergenic
1189467465 X:41288282-41288304 TTTTTAAAAAACAGAATGCCTGG + Intergenic
1189629120 X:42933318-42933340 CTTTTTAAAAGCAAAAGTCTAGG + Intergenic
1189727872 X:43986649-43986671 CATTTACAAAGCAGAATTCTTGG - Intergenic
1189731235 X:44023066-44023088 CTTTTAGTAAGCAGAAGTCAAGG - Intergenic
1189801723 X:44697691-44697713 CTTTTAAAAAAAACATTTCTAGG + Intergenic
1190076515 X:47321248-47321270 CTTTTAAAGAGAAGAAGGCTGGG - Intergenic
1190409648 X:50123717-50123739 TTTTTTAAAAAAAGAATTCTGGG - Intergenic
1191972787 X:66835929-66835951 CTTTTTAAAAACAAAATTTTTGG - Intergenic
1192603888 X:72493457-72493479 GTTTTAAAATGCAGATTGCTGGG - Intronic
1192608947 X:72548294-72548316 ATTTTAAAATGTAGATTTCTGGG - Intronic
1193316582 X:80072116-80072138 TTTCTAAAAAACAAAATTCTAGG - Intergenic
1193633428 X:83918389-83918411 TTTTTAAAAAGCAGAAATTTGGG + Intergenic
1193894357 X:87093863-87093885 CTTTTAAAAAGCAGACATACAGG - Intergenic
1194229968 X:91309227-91309249 CTTTGAAATAGCACAAATCTGGG - Intergenic
1194801850 X:98283571-98283593 TTTTTAAAAATCCGAAGTCTAGG - Intergenic
1194829298 X:98600964-98600986 TTTTTAAAAAGAAAACTTCTAGG + Intergenic
1194888670 X:99350582-99350604 CTTTTAAACAGCAGATTTTGTGG + Intergenic
1195088233 X:101433913-101433935 TTTTTAAAAAGAAGATATCTTGG + Intronic
1195320878 X:103721169-103721191 TTGTTAAAATGCAGATTTCTAGG + Intronic
1195785071 X:108510471-108510493 GCCTTAAAAAGCACAATTCTTGG - Intronic
1196178369 X:112664939-112664961 CTTTTAAAATGCATATTCCTGGG - Intronic
1196305897 X:114102797-114102819 CTTTTAAAAAGAGGAACTATAGG + Intergenic
1196408058 X:115386456-115386478 CTTTAAAAAAGTACACTTCTGGG - Intergenic
1196464216 X:115956981-115957003 TTTTTAAAAAACAAAATTGTGGG + Intergenic
1196624785 X:117865887-117865909 TTTTTACAAAGGAGAATGCTTGG - Intergenic
1196987066 X:121285821-121285843 TTTTTAAAAAACAGTAATCTTGG - Intergenic
1197012149 X:121578826-121578848 TTTTTAAAATGCAGATTTCTGGG + Intergenic
1197027094 X:121765970-121765992 CTTTAAAAAAAGAAAATTCTGGG + Intergenic
1197374101 X:125661120-125661142 ATTTAAAAAAATAGAATTCTAGG - Intergenic
1197503913 X:127278215-127278237 CTTTTAAAATACAGAATCTTGGG + Intergenic
1197700310 X:129594746-129594768 TTGTTAAAAAGCAGATTCCTAGG + Intergenic
1198045857 X:132901896-132901918 CTGTTACAAAGCAATATTCTGGG - Intronic
1198176104 X:134156541-134156563 CAGTTAAAAAGCAGCATTTTGGG + Intergenic
1198525868 X:137500110-137500132 CATTTAAAAAGCAGAGCTCTTGG - Intergenic
1198641307 X:138759135-138759157 AATTAAAAAAGCAGATTTCTGGG + Intronic
1199562367 X:149177730-149177752 CTTTTAAAAAGCTAACTTTTGGG + Intergenic
1199727133 X:150594785-150594807 CTTTTAAATACCACAGTTCTAGG - Intronic
1200296218 X:154923534-154923556 GTTTTAAAAAGAAGAGTTTTTGG + Intronic
1201335296 Y:12874208-12874230 CTTTTCAAAAGCAGATCTCACGG + Intergenic