ID: 1153331391

View in Genome Browser
Species Human (GRCh38)
Location 18:3879111-3879133
Sequence ACGCTCCTGCCAGTACCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153331391_1153331396 29 Left 1153331391 18:3879111-3879133 CCTGCAGGTACTGGCAGGAGCGT 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1153331396 18:3879163-3879185 GGCCTGGTCCATGTTCACCGAGG 0: 1
1: 0
2: 0
3: 11
4: 115
1153331391_1153331393 8 Left 1153331391 18:3879111-3879133 CCTGCAGGTACTGGCAGGAGCGT 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1153331393 18:3879142-3879164 ACACGACTCGGACTTCACCATGG 0: 1
1: 0
2: 0
3: 2
4: 44
1153331391_1153331394 13 Left 1153331391 18:3879111-3879133 CCTGCAGGTACTGGCAGGAGCGT 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1153331394 18:3879147-3879169 ACTCGGACTTCACCATGGCCTGG 0: 1
1: 0
2: 0
3: 16
4: 202
1153331391_1153331392 -4 Left 1153331391 18:3879111-3879133 CCTGCAGGTACTGGCAGGAGCGT 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1153331392 18:3879130-3879152 GCGTTCTTGCTGACACGACTCGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153331391 Original CRISPR ACGCTCCTGCCAGTACCTGC AGG (reversed) Exonic
901017120 1:6238214-6238236 GAGCTCCTGCCAGGACCTGCAGG - Intergenic
901031494 1:6309641-6309663 ACACTCCTGCAAATAACTGCCGG - Intronic
901503026 1:9665509-9665531 TCGCTCATGCCAGTACATGCCGG + Intronic
902546899 1:17195823-17195845 ACGGACCTTCCAGTTCCTGCTGG - Intergenic
903768109 1:25747588-25747610 TCGCTGCTGCCAGGAGCTGCAGG - Intronic
905925235 1:41745035-41745057 AAGCTCCAGCCAGAACCTGGGGG + Intronic
906130267 1:43451576-43451598 AGGCTCCTGCCAGGGCCTGAAGG + Exonic
906720133 1:47997901-47997923 TCGCTCCTGCCAGGATCTGCGGG - Intergenic
909067246 1:70950026-70950048 TAACTCCTGCCAGTACGTGCTGG - Intronic
912725726 1:112057461-112057483 ACGCTCCTGCCACTGCCTTCAGG + Intergenic
915809805 1:158895736-158895758 ACATTCCTTCCAGTAGCTGCAGG + Intergenic
920186324 1:204161551-204161573 AGCCTCCTACCAGTTCCTGCAGG - Intronic
921357212 1:214296293-214296315 ACGCTCCTGTCATTTCCTACTGG - Intronic
922598525 1:226832613-226832635 CCTCTCCTGCCTGTACCTGATGG - Intergenic
1063878746 10:10509164-10509186 ATGATCCTTCCAGTACCTGAAGG - Intergenic
1064273467 10:13885738-13885760 CCCCTCCTGCCAAGACCTGCAGG + Intronic
1065646078 10:27835137-27835159 ACGCTCCTCCAAGGGCCTGCTGG - Intronic
1066975954 10:42367853-42367875 ACGGGTCTGCCAGTCCCTGCAGG + Intergenic
1069359362 10:67624151-67624173 AAGCTCCTTCCAGTGTCTGCTGG - Intronic
1070570220 10:77635736-77635758 ACTCTCCGACCAGCACCTGCAGG + Intronic
1073106011 10:101032355-101032377 AAGCTCCTGCCCCTCCCTGCTGG + Exonic
1073429760 10:103478599-103478621 GCGCACCTGGCAGTACCTGTAGG + Intronic
1075680021 10:124325101-124325123 CCGCACCTGCCAGCAGCTGCGGG - Intergenic
1077545250 11:3166373-3166395 AGGCTCCTTCCAGCACCTGAAGG + Intronic
1082844197 11:57714024-57714046 AAGCTGCTTCCAGTATCTGCTGG + Intronic
1083184945 11:61012199-61012221 AAGCTCCTGCCAGGCCCCGCAGG + Intronic
1083316323 11:61816787-61816809 ACGCGCCTGACAGCCCCTGCTGG - Exonic
1083878826 11:65538389-65538411 GCTCTCCAGCCAGTGCCTGCCGG - Intronic
1083888491 11:65584258-65584280 CAGCTCCAGCCAGTCCCTGCTGG + Exonic
1085533579 11:77205455-77205477 CCGCTCCTCGCTGTACCTGCAGG - Exonic
1087778176 11:102275698-102275720 TGGCTACTGCCAGTACTTGCTGG + Intergenic
1089134357 11:116237507-116237529 AAGCTTCTCCCAGTACATGCTGG + Intergenic
1089311021 11:117558209-117558231 AAGCTGCTGCCAGCACCTACAGG + Intronic
1098989352 12:77047796-77047818 CTGCTCCTGCCAGCACCTTCCGG - Intronic
1103907368 12:124334653-124334675 ACTCTCCTGACAGAACCTTCTGG + Intronic
1104753451 12:131254407-131254429 ACTCTCCACCCAGAACCTGCAGG + Intergenic
1105767803 13:23578906-23578928 GCGCACCTGCGAGTCCCTGCCGG + Intronic
1106601385 13:31190225-31190247 AGACTCTTGCCAGTACATGCTGG + Intergenic
1116425245 14:44782748-44782770 ACACTTATGCCAGTATCTGCTGG - Intergenic
1118318581 14:64740434-64740456 TGGCTCCTCCCAGTACCTGTGGG - Intronic
1119023889 14:71137444-71137466 CTGCTTCTGCCAGTACATGCTGG + Intergenic
1119728890 14:76938632-76938654 CCCCTCCTGCCAGTCCCTGGAGG - Intergenic
1120881200 14:89416732-89416754 ACCCTCCCCCCAGGACCTGCGGG + Intronic
1121329290 14:93039999-93040021 GTGCTCCTGCCAGCCCCTGCTGG + Intronic
1122226187 14:100281514-100281536 ATGCACTTGCCAGGACCTGCTGG - Exonic
1124248950 15:28095136-28095158 ACGGGCGTGCCAGTACCAGCGGG - Intronic
1126780219 15:52133415-52133437 GCGCTCCGGCCAGTGCGTGCAGG - Exonic
1129282941 15:74500461-74500483 TGGCTCCTGCCAATACATGCTGG + Intergenic
1130990684 15:88873983-88874005 AGGCTCCTCCCAGTGCCCGCTGG - Exonic
1132526830 16:420847-420869 ATCCGCCTTCCAGTACCTGCCGG - Intergenic
1132544428 16:526926-526948 ACTCTCCTGCCAGCAGCTGCTGG - Intergenic
1136402561 16:30026535-30026557 AGGCTCCTGCCAGCACCAGCAGG + Intronic
1142196954 16:88743358-88743380 AAGCTCCTGCCAGCACGTGCCGG - Intronic
1144029698 17:11308412-11308434 ACGCTCCTGCCATTTCCAGGAGG - Intronic
1145269865 17:21399085-21399107 AGCCTCCTGCCAGCATCTGCAGG - Intronic
1146259217 17:31410820-31410842 CAGCTCCTGCCACTCCCTGCTGG + Intronic
1147330438 17:39696106-39696128 GCTCTCCTGCCAGGCCCTGCTGG + Intronic
1152603710 17:81278419-81278441 AAGGTCCTGCCAGCAGCTGCTGG + Intronic
1153331391 18:3879111-3879133 ACGCTCCTGCCAGTACCTGCAGG - Exonic
1154959294 18:21291806-21291828 ACGCCCCTGGCCGTACGTGCAGG + Intronic
1161269770 19:3383387-3383409 ACGCTCCTGCCAGGACCCCTGGG - Intronic
1163859351 19:19732993-19733015 ACGGATCTGTCAGTACCTGCAGG + Exonic
1166213491 19:41321693-41321715 ATGCTCCTCCCACTTCCTGCAGG - Intronic
1166921198 19:46230226-46230248 ACCCACCTGCCACTACCTCCTGG + Intronic
1167643169 19:50693134-50693156 ACGCAGCTGCCAGTAAATGCAGG - Intronic
1168043744 19:53779250-53779272 AGGCTCCTGCCACTACGTCCAGG + Intergenic
926328729 2:11807665-11807687 ATGCTCCGGGCAGTATCTGCGGG - Intronic
934502556 2:94871681-94871703 CCGCACCTCCAAGTACCTGCTGG + Exonic
937565447 2:123280485-123280507 ACACTCCTGACTGTGCCTGCAGG - Intergenic
940040022 2:149350493-149350515 ACTCTCCAGCCAACACCTGCAGG - Intronic
945472116 2:210239142-210239164 TCCCTCCTGCCAGTACATGTTGG + Intergenic
946431656 2:219629689-219629711 AGGCTGCAGCCAGTACCTGCTGG - Exonic
948536853 2:238652983-238653005 GCTCTCCTGCCGGGACCTGCAGG - Intergenic
1169263954 20:4156508-4156530 ACCCCCCTGCCAGTGCCTGGTGG + Intronic
1172449285 20:35010428-35010450 TCACTCCAGCCAGCACCTGCAGG + Intronic
1172916823 20:38449509-38449531 TCTCTCCTGCCAGCACCTTCTGG + Intergenic
1182359774 22:29739729-29739751 CCGCTGCTGCCAGGACTTGCTGG + Intronic
1182449488 22:30410495-30410517 ACCCTCCTGCCAGCCCATGCTGG - Intronic
1183875976 22:40781923-40781945 ACTCTTCTGCCAGTTCCGGCCGG + Intronic
1184301937 22:43566584-43566606 AAGCTCCTGCCAGCAGGTGCTGG + Intronic
949891106 3:8734282-8734304 ACGCTCCTGCCACTCACTCCTGG + Intronic
951127636 3:19002515-19002537 TCTCTCCTGCCAGTATCAGCAGG + Intergenic
953434162 3:42865453-42865475 CCGCTTCCGCCAGTACCTGAAGG + Exonic
953987848 3:47459209-47459231 GTGCTCCTACAAGTACCTGCTGG - Intronic
954817191 3:53292053-53292075 ACCCTCCTGCCATTACCTGAAGG + Exonic
957293432 3:78306669-78306691 AGGCTTCTGCCAGGACATGCAGG - Intergenic
959648746 3:108731183-108731205 AGGCTCCTTCCAGTCTCTGCTGG - Intergenic
961039342 3:123666290-123666312 ACTCTCCTGCGCGTACCTTCTGG + Exonic
961383358 3:126510041-126510063 TCACTCCAGCCAGTACCTCCGGG - Intronic
961469418 3:127101837-127101859 ACCCTGCTGTCAGCACCTGCGGG - Intergenic
966933124 3:184688567-184688589 ACTCTCCTGGCAGCTCCTGCAGG - Intergenic
972345437 4:38188761-38188783 ACGATTCTGACAGTTCCTGCAGG + Intergenic
977683103 4:99816737-99816759 ACACTCCTGCCAGTGCCTCCAGG + Intergenic
979965225 4:127068684-127068706 ACGGGTCTGCCAGTCCCTGCAGG + Intergenic
985530153 5:429406-429428 CCGCTCCTGCCACTTCCTCCTGG + Intronic
987099410 5:14578964-14578986 AAGCCCCTGCCAGTGCCCGCTGG - Intergenic
987284260 5:16440249-16440271 CCACTCCTGCTAGTACTTGCTGG + Intergenic
989564397 5:42887384-42887406 ATGCTCCTGCCTCTCCCTGCAGG + Intronic
992750700 5:79857917-79857939 CCGCTCCTTCCCGTATCTGCTGG - Intergenic
993315848 5:86405130-86405152 ACTCTCCTGCAAATAGCTGCAGG + Intergenic
993528647 5:88998778-88998800 TAGCTCCTGCCAGTACCTTGAGG + Intergenic
1004222561 6:13759202-13759224 ACGCTCTAGGCAGCACCTGCTGG - Intergenic
1005339730 6:24831857-24831879 AAGATCCTGCCAGACCCTGCTGG - Intronic
1007298008 6:40843063-40843085 ACGCACATGCAAGCACCTGCAGG + Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1011381030 6:86742410-86742432 TGGCTCCTGCCAGAACATGCTGG + Intergenic
1014810594 6:125881112-125881134 ACTCTCCTTCCAGTACCTTAAGG + Exonic
1015927452 6:138324148-138324170 AAGCCCCTGCCCTTACCTGCTGG - Exonic
1017362692 6:153594847-153594869 ACTCTCCTTCCATGACCTGCGGG + Intergenic
1022149511 7:27586819-27586841 ATTCTCCTGCCAGTCCCTGCAGG + Intronic
1025139145 7:56448256-56448278 ATGGACCTTCCAGTACCTGCAGG + Intergenic
1025239151 7:57256948-57256970 AGGGACCTTCCAGTACCTGCAGG + Intergenic
1027127677 7:75568424-75568446 ACACTCCTGCTGGTTCCTGCTGG - Intronic
1033638951 7:143242059-143242081 ACACTCCTGCCAGTAGCACCAGG - Intergenic
1033994148 7:147324932-147324954 ACACTTCTGCCATTACCTACAGG - Intronic
1036786795 8:11693015-11693037 AGGCTTCTGCCAGCGCCTGCGGG + Intronic
1038306922 8:26413340-26413362 GCCCTCCTGCCACTACCTGGAGG - Intronic
1039897961 8:41729777-41729799 AGGCTCCTGCCAGCCCCTGGGGG + Intronic
1044824563 8:96183859-96183881 ACACTCCTCCGAGTGCCTGCAGG + Intergenic
1045842615 8:106597347-106597369 AGGCTCCTTCCAGAACCTGCAGG + Intronic
1046293637 8:112194509-112194531 ACACTCCTGCCAGGGGCTGCAGG - Intergenic
1046320239 8:112564620-112564642 ATACTCCTGCCTGTAGCTGCTGG + Intronic
1049173934 8:141179926-141179948 TCCCTCCTGCCAGCCCCTGCGGG - Intronic
1049235858 8:141511942-141511964 AGGCTCCTGCCAGAACCTCTGGG + Intergenic
1049336992 8:142091918-142091940 AGGCTCTAGCCAGTACCTGGCGG + Intergenic
1049859738 8:144890315-144890337 AGACTCCTGCCAGTGCCGGCAGG - Exonic
1057465215 9:95307770-95307792 TCACTCCTGCCAGTTGCTGCTGG + Intronic
1060574326 9:124675896-124675918 ACGCTCTTGCCGGTACGTGTAGG + Intronic
1186727451 X:12372508-12372530 TGGCTCCTCCCAGGACCTGCTGG + Intronic
1187238276 X:17488407-17488429 CCTCTCCTGCCTGTAGCTGCAGG - Intronic