ID: 1153331584

View in Genome Browser
Species Human (GRCh38)
Location 18:3880014-3880036
Sequence CCGAGTCGCAGGTGACCCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 52}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153331584 Original CRISPR CCGAGTCGCAGGTGACCCCG TGG Exonic
900139734 1:1134678-1134700 CACAGTAGCAGGTGGCCCCGTGG + Intergenic
900589879 1:3454801-3454823 CCGCGGCGCAGGTGAGCCTGGGG + Exonic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
912246244 1:107964788-107964810 CCGAGTCCCAGGTCACCCGGTGG + Exonic
920331569 1:205211778-205211800 GCAAGTCCCAGGAGACCCCGCGG - Intergenic
1068955230 10:62815200-62815222 CGGCGTCGCCGGTGCCCCCGCGG + Intronic
1069501469 10:68956615-68956637 CCAAGTCGCCGGGGACCACGTGG - Intronic
1069595005 10:69664793-69664815 CTGAGTGGCAGGTGACCCTCTGG + Intergenic
1071058911 10:81547370-81547392 CTGAGTCACAGCTGACCCCGAGG - Intergenic
1076096209 10:127736747-127736769 CCGAGTCCCGGGTAACCCAGGGG + Intergenic
1077160638 11:1110960-1110982 CCGAGGGTCAGGTGACCCTGGGG + Intergenic
1077265083 11:1644699-1644721 CAGAGTCACAGGGAACCCCGGGG + Intergenic
1084319787 11:68366929-68366951 CCGAGGCACTGGGGACCCCGCGG + Intronic
1088921940 11:114265895-114265917 CTGACTCGCAGATGACCCCAAGG - Intronic
1096598749 12:52714637-52714659 CCGAGCCGCAGGTCTTCCCGGGG + Intergenic
1104891828 12:132143946-132143968 CCGAGTCGCCGGCGCCCCAGAGG + Intronic
1113494085 13:110714120-110714142 CCGAGTCGCCGGGGACCTCCGGG + Intronic
1116681830 14:47981560-47981582 CCAAGTCACAGGTGATCCTGAGG - Intergenic
1118837052 14:69484904-69484926 CCGAGTCCCTGCTGACCCCGGGG + Exonic
1202868153 14_GL000225v1_random:136148-136170 CCGCGTCCCAGGTGAGTCCGTGG - Intergenic
1124190706 15:27574248-27574270 CCGGGTCGCAGGTGGCGCTGCGG + Intergenic
1128759201 15:70203979-70204001 CAGTGTCGCAGGGGGCCCCGAGG - Intergenic
1141668220 16:85477220-85477242 CTGAGTTGGAGCTGACCCCGGGG + Intergenic
1142374505 16:89700257-89700279 CCGACCAGCAGGTGTCCCCGGGG + Intronic
1143677307 17:8443916-8443938 CCGATTCGCAGAAGACCACGTGG + Intronic
1150292436 17:63989305-63989327 CCGAGGGGCAGGCCACCCCGAGG - Intergenic
1153331584 18:3880014-3880036 CCGAGTCGCAGGTGACCCCGTGG + Exonic
1160794973 19:941044-941066 CCGCGGCGGCGGTGACCCCGCGG - Intronic
1160900612 19:1426189-1426211 CCCAGTCCCAGGTCACCCAGAGG - Intronic
1161040583 19:2108947-2108969 CCGGGTGGCTGGTGGCCCCGAGG - Intronic
1161175909 19:2841953-2841975 CAGAGTCGCCCGAGACCCCGAGG + Intronic
926123334 2:10256463-10256485 CCAAGGCGCGGGTGACCCGGTGG + Intergenic
1176167711 20:63682705-63682727 CTGAGTCACAGGTGACCCTGGGG + Intronic
1179960496 21:44764802-44764824 CCAAGTCTCAGGTGGCCCCGTGG + Intergenic
1181083719 22:20429751-20429773 CCGGGTCGCACGTGTCCTCGTGG + Exonic
1181460819 22:23085006-23085028 CCTAGTGGCAGGTGGCCCCAAGG - Intronic
1183593604 22:38796330-38796352 CCGAGTCCAGGATGACCCCGGGG + Intergenic
950091859 3:10301363-10301385 CTGACTCGCAGGTGACCCTGTGG - Exonic
956753834 3:72366510-72366532 CCGGGTCCCAGGTGAACCCATGG - Intergenic
990978575 5:61580833-61580855 CCAAGTGGCAGGTGGCCCGGCGG - Intergenic
994967977 5:106698519-106698541 CCTAGTCGCAGGAAACACCGAGG + Intergenic
1004615139 6:17281784-17281806 CGGAGTGGCGGCTGACCCCGGGG + Intronic
1006447250 6:34086607-34086629 CAAACTCTCAGGTGACCCCGTGG + Intronic
1018856350 6:167678176-167678198 CGGAGTGGGAGGTGACCCCAGGG - Intergenic
1021969329 7:25951306-25951328 CCGGGGCGCACGTGACCCCGGGG - Intergenic
1030188985 7:106791939-106791961 CCAAGTTCCAGATGACCCCGAGG + Intergenic
1031025239 7:116672383-116672405 CCCGGCCGCAGGTGACCCGGAGG + Exonic
1032017849 7:128391292-128391314 CTGAGTCAGAGGTGACCCAGCGG - Intergenic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1036701497 8:11016375-11016397 CCGAGTCCCCGGCGTCCCCGCGG - Intronic
1044904956 8:96990807-96990829 CTGGGTAGCAGGTGACCCCTAGG + Intronic
1049621107 8:143598668-143598690 CCCGGGCGCAGGGGACCCCGGGG + Exonic
1056678603 9:88697538-88697560 CCAACCCGCAGGTGACCTCGAGG - Intergenic
1057076500 9:92140964-92140986 CTGGGTCCCATGTGACCCCGTGG + Intergenic
1061445475 9:130634934-130634956 CCGAGTCGCAGGGCAGCCTGTGG - Intronic
1203736625 Un_GL000216v2:144120-144142 CCGCGTCCCAGGTGAGTCCGTGG + Intergenic
1185552849 X:997849-997871 CAGAGAAGCAGGGGACCCCGCGG + Intergenic
1190927462 X:54922212-54922234 CCGAGTAACAGGTGAGCCTGAGG - Exonic
1198423983 X:136497024-136497046 CCGATCCGCCGGGGACCCCGCGG + Intergenic
1199846220 X:151694733-151694755 CTGAATGGCAGGTGAGCCCGGGG + Intergenic