ID: 1153332450

View in Genome Browser
Species Human (GRCh38)
Location 18:3887793-3887815
Sequence ACTTTTACGCAAAAGTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153332450_1153332455 -3 Left 1153332450 18:3887793-3887815 CCATGGCACTTTTGCGTAAAAGT 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1153332455 18:3887813-3887835 AGTAAACAGAAAACGGCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 99
1153332450_1153332458 30 Left 1153332450 18:3887793-3887815 CCATGGCACTTTTGCGTAAAAGT 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1153332458 18:3887846-3887868 TGCCTGTGATCCCAGCACTTTGG 0: 1055
1: 93536
2: 232660
3: 241982
4: 218767
1153332450_1153332451 -10 Left 1153332450 18:3887793-3887815 CCATGGCACTTTTGCGTAAAAGT 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1153332451 18:3887806-3887828 GCGTAAAAGTAAACAGAAAACGG 0: 1
1: 0
2: 2
3: 30
4: 371
1153332450_1153332452 -6 Left 1153332450 18:3887793-3887815 CCATGGCACTTTTGCGTAAAAGT 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1153332452 18:3887810-3887832 AAAAGTAAACAGAAAACGGCCGG 0: 1
1: 0
2: 0
3: 80
4: 1190
1153332450_1153332454 -4 Left 1153332450 18:3887793-3887815 CCATGGCACTTTTGCGTAAAAGT 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1153332454 18:3887812-3887834 AAGTAAACAGAAAACGGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 126
1153332450_1153332456 3 Left 1153332450 18:3887793-3887815 CCATGGCACTTTTGCGTAAAAGT 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1153332456 18:3887819-3887841 CAGAAAACGGCCGGGGGCAGTGG 0: 1
1: 0
2: 18
3: 249
4: 2263
1153332450_1153332453 -5 Left 1153332450 18:3887793-3887815 CCATGGCACTTTTGCGTAAAAGT 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1153332453 18:3887811-3887833 AAAGTAAACAGAAAACGGCCGGG 0: 1
1: 0
2: 4
3: 52
4: 903

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153332450 Original CRISPR ACTTTTACGCAAAAGTGCCA TGG (reversed) Intronic
902115660 1:14118869-14118891 AATTTGACTCAAAACTGCCAAGG + Intergenic
906138546 1:43518770-43518792 GATTTTCCACAAAAGTGCCAAGG - Intergenic
908620309 1:65972168-65972190 ACTTCTATGCGAAAGTGCAAGGG - Intronic
908800243 1:67872458-67872480 ACTTCTACTCAAAATTTCCAGGG - Intergenic
910095143 1:83513330-83513352 CATTTTATGCAAAAGTACCAGGG + Intergenic
913023845 1:114814787-114814809 ACTTTTTCTCCAAAGTGTCAAGG - Intergenic
919109948 1:193206240-193206262 ACTTTTTAGCTAAAGTGCCCTGG + Intronic
921627133 1:217389134-217389156 ACTTTTCCTCAACAGTGCAAGGG - Intergenic
922141914 1:222895671-222895693 ATTTTTCAGCAAAGGTGCCAAGG + Intronic
922765299 1:228153225-228153247 ACTTTCACAGAAAAGGGCCAAGG + Intronic
1065224853 10:23533247-23533269 ACTTTTTCTCATAAGTCCCAGGG + Intergenic
1065313812 10:24442232-24442254 ATTTAGACACAAAAGTGCCATGG - Intronic
1066702131 10:38141468-38141490 GGTTTTCAGCAAAAGTGCCAAGG + Intergenic
1068846516 10:61682420-61682442 AATTTTAACCAAATGTGCCAAGG + Intronic
1071288141 10:84167590-84167612 TCTTTTAAGAAAAAGTGACAAGG - Intergenic
1077614268 11:3663943-3663965 ACTGATACACAAAACTGCCACGG - Intronic
1082210607 11:49496774-49496796 ACTTTTTTGCTAGAGTGCCAAGG + Intergenic
1091087712 11:132739004-132739026 GCTTTTACGCAAACGTGCTGGGG - Intronic
1091297920 11:134486716-134486738 GCTTTTAAGGAAAACTGCCAGGG + Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1093754516 12:22837615-22837637 ACTTTTATGCTACTGTGCCATGG + Intergenic
1093830545 12:23751824-23751846 TGTTTTTAGCAAAAGTGCCAGGG - Intronic
1094310741 12:29078729-29078751 TATTTTCAGCAAAAGTGCCAAGG + Intergenic
1095236295 12:39800167-39800189 ACCTTTCTGCAAAAATGCCAAGG - Intronic
1099620704 12:84999572-84999594 ACTTTAATGAAAAAATGCCAAGG - Intergenic
1100450894 12:94705601-94705623 ACTATTCCTCAAAACTGCCAAGG - Intergenic
1108545537 13:51489516-51489538 ATTTTAAAGGAAAAGTGCCATGG - Intergenic
1109907924 13:68870092-68870114 GTTTATAAGCAAAAGTGCCATGG - Intergenic
1110791087 13:79587701-79587723 AATTTTAAAAAAAAGTGCCAAGG - Intergenic
1112671192 13:101640990-101641012 ACCTTTAGTCATAAGTGCCATGG - Intronic
1116733068 14:48650197-48650219 ACTATTAAGCAAAATTACCAAGG + Intergenic
1117120298 14:52560624-52560646 TTTTTTCCCCAAAAGTGCCAAGG + Intronic
1119996472 14:79258910-79258932 TCTATTACTCAAAAGGGCCATGG - Intronic
1121260446 14:92562107-92562129 ACTGTTCCTCAAAACTGCCAAGG - Intronic
1132796287 16:1724891-1724913 ACTCTGAAGCAAAAGTGCTATGG - Intronic
1138834243 16:60413933-60413955 AAATTTACTCAAAAGTACCACGG + Intergenic
1146575525 17:33987702-33987724 ACTGTTAGGTGAAAGTGCCAAGG + Intronic
1146587101 17:34091711-34091733 ACTTTGATTCAATAGTGCCATGG - Intronic
1147365383 17:39955532-39955554 ACCTTGAAGCAAAACTGCCATGG + Intergenic
1149292020 17:55226414-55226436 ACTTTATCCCAAAAGTTCCAAGG - Intergenic
1153332450 18:3887793-3887815 ACTTTTACGCAAAAGTGCCATGG - Intronic
1158113684 18:53971198-53971220 TATTTTACGGAAAAATGCCATGG - Intergenic
925121148 2:1419475-1419497 ACTTTTAGGCAATAGAGGCAGGG - Intronic
927377933 2:22440206-22440228 ACTTTGAAGCCAAACTGCCAGGG - Intergenic
935500830 2:103836428-103836450 TCTTTTACCTAAAAGGGCCAAGG + Intergenic
937660499 2:124425066-124425088 ACGTTTCCACAAAAATGCCAAGG + Intronic
938872350 2:135492954-135492976 AATTTTTCACTAAAGTGCCAAGG + Intronic
938932004 2:136094873-136094895 ACCTTTCGGCAAAAGTGCAAAGG + Intergenic
941200443 2:162502015-162502037 ACCTTTTCACATAAGTGCCATGG - Intronic
944954053 2:204787235-204787257 ACTTTCACGGATGAGTGCCAAGG - Intronic
944962940 2:204896866-204896888 ACTTTTAGACAAAAGTTCAAAGG - Intronic
1177285703 21:19046416-19046438 AGTTTGAGGCAGAAGTGCCACGG - Intergenic
952853052 3:37744667-37744689 ACTTTTTCTGAAAAGAGCCATGG + Intronic
957530645 3:81437047-81437069 ACTTTTATGCTAAATAGCCAAGG + Intergenic
958263634 3:91411498-91411520 ATTTTTAAACAAAGGTGCCAGGG - Intergenic
960304704 3:116046696-116046718 ACTATTATGCACAACTGCCAAGG - Intronic
961161059 3:124726502-124726524 GCATTTACCCAAAAATGCCAAGG + Intergenic
966412268 3:179655990-179656012 ACTTTAATCCACAAGTGCCACGG + Intronic
967791671 3:193556207-193556229 ACTTTTAAGAAAGAGTGCCTGGG + Intronic
970411388 4:15811551-15811573 AATTTTAGACAAGAGTGCCAAGG - Intronic
974474801 4:62364849-62364871 ACTTTTATGCAAAATCGCCTTGG - Intergenic
977679675 4:99785145-99785167 AATTTTAGGCAAAATTGCCAGGG - Intergenic
982717171 4:158821363-158821385 ATTTTTAGGCAAAAGCCCCAAGG + Intronic
985391315 4:189493429-189493451 ATTTTTCCTCAAAAGGGCCATGG - Intergenic
997256404 5:132431699-132431721 ACTTTGCTGCAAAATTGCCAGGG - Intronic
998021291 5:138773517-138773539 ACCTTTAATCAAAAGTGCCAAGG - Intronic
998492792 5:142561616-142561638 ACTTTTAAGAGAATGTGCCATGG + Intergenic
1000520224 5:162285641-162285663 ACTTCAACGCAAATGTGCAAAGG - Intergenic
1007809887 6:44478262-44478284 ACTCTTAAGCAGAAATGCCAAGG + Intergenic
1008991797 6:57611484-57611506 ATTTTTAAACAAAGGTGCCAGGG + Intronic
1009180313 6:60509723-60509745 ATTTTTAAACAAAGGTGCCAGGG + Intergenic
1009240336 6:61178503-61178525 ATTTTTAAACAAAAGTGCCGAGG - Intergenic
1011272030 6:85589517-85589539 ACTTTGAAGAAACAGTGCCAGGG - Intronic
1012206222 6:96463723-96463745 ACTTTTTCTCAAAATTGCCTTGG + Intergenic
1014120243 6:117716451-117716473 AATTTTAGACAAAAGTGTCAAGG - Intergenic
1015193255 6:130495404-130495426 GATTTTGCACAAAAGTGCCAAGG - Intergenic
1016034406 6:139371764-139371786 ATTTCTCAGCAAAAGTGCCAAGG - Intergenic
1016075494 6:139789984-139790006 GATTTTTCACAAAAGTGCCAAGG - Intergenic
1020846046 7:13285263-13285285 ACTTTTACGAAAGAGAGCAATGG - Intergenic
1027149505 7:75722881-75722903 ACTTTTGTGCATGAGTGCCAGGG + Intronic
1031461661 7:122058167-122058189 AATTTTACATAAAAGTGCAAAGG - Intronic
1033508273 7:142028162-142028184 GCTTTGACTCAAAAGTGTCATGG + Intronic
1033789302 7:144772100-144772122 AATGTTACTCAAAACTGCCAAGG + Intronic
1033869988 7:145740966-145740988 ACTTTTATGCAAACGAGGCAAGG + Intergenic
1040460167 8:47639969-47639991 GCTTTTAAGCAATACTGCCATGG + Intronic
1042566657 8:70118252-70118274 ATTTTAACCCAAAAGTGCCAGGG - Intronic
1045493813 8:102691156-102691178 ACTTCTAAGCAACAGAGCCAAGG - Intergenic
1045827538 8:106417297-106417319 ACTATTATGCAAATGTGACATGG + Intronic
1047760511 8:127950681-127950703 ACTTTCACCCAAAAGGGCCTGGG + Intergenic
1055695719 9:78882183-78882205 ACATTTACACAAAAGAGACAGGG - Intergenic
1189956460 X:46279701-46279723 TCTTTTTCACAAAAATGCCAAGG - Intergenic
1199311343 X:146324601-146324623 ACTTTTACACAAAAGTTCATAGG + Intergenic