ID: 1153335386

View in Genome Browser
Species Human (GRCh38)
Location 18:3918692-3918714
Sequence CCTTCCTGGGGATCGTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153335378_1153335386 7 Left 1153335378 18:3918662-3918684 CCAGGGACTGGCATTCTGAGCAA No data
Right 1153335386 18:3918692-3918714 CCTTCCTGGGGATCGTGGGCAGG No data
1153335374_1153335386 25 Left 1153335374 18:3918644-3918666 CCTGTGTTATGGGTTGTTCCAGG No data
Right 1153335386 18:3918692-3918714 CCTTCCTGGGGATCGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153335386 Original CRISPR CCTTCCTGGGGATCGTGGGC AGG Intronic