ID: 1153335386 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:3918692-3918714 |
Sequence | CCTTCCTGGGGATCGTGGGC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1153335378_1153335386 | 7 | Left | 1153335378 | 18:3918662-3918684 | CCAGGGACTGGCATTCTGAGCAA | No data | ||
Right | 1153335386 | 18:3918692-3918714 | CCTTCCTGGGGATCGTGGGCAGG | No data | ||||
1153335374_1153335386 | 25 | Left | 1153335374 | 18:3918644-3918666 | CCTGTGTTATGGGTTGTTCCAGG | No data | ||
Right | 1153335386 | 18:3918692-3918714 | CCTTCCTGGGGATCGTGGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1153335386 | Original CRISPR | CCTTCCTGGGGATCGTGGGC AGG | Intronic | ||