ID: 1153336232

View in Genome Browser
Species Human (GRCh38)
Location 18:3928556-3928578
Sequence GAAGCACTTGGAACCATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1705
Summary {0: 1, 1: 7, 2: 26, 3: 160, 4: 1511}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153336232_1153336235 20 Left 1153336232 18:3928556-3928578 CCAGGCATGGTTCCAAGTGCTTC 0: 1
1: 7
2: 26
3: 160
4: 1511
Right 1153336235 18:3928599-3928621 TCTTGACAACACCTTAAAGTAGG 0: 1
1: 0
2: 0
3: 16
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153336232 Original CRISPR GAAGCACTTGGAACCATGCC TGG (reversed) Intronic
900167926 1:1251494-1251516 CAAGCACATGCCACCATGCCCGG + Intergenic
900905127 1:5551728-5551750 GTAGCACTTGGAACAATTCCAGG - Intergenic
900983146 1:6058006-6058028 TAGGCACTTGCCACCATGCCTGG - Intronic
901027706 1:6287482-6287504 GAAGCAGGTGGCACAATGCCTGG + Intronic
901387266 1:8919092-8919114 CAAGCACGTGCCACCATGCCTGG - Intergenic
901545079 1:9950231-9950253 CAGGCACCTGCAACCATGCCCGG + Intronic
901569940 1:10152121-10152143 CAGGCACCTGCAACCATGCCCGG - Intronic
902040415 1:13488412-13488434 CAGGCACTTGCCACCATGCCTGG + Intronic
902096683 1:13951384-13951406 AAAGCACTTAGACCCATGCCTGG + Intergenic
902202220 1:14842211-14842233 CCAGCACTTTAAACCATGCCTGG + Intronic
902234044 1:15046579-15046601 GAAGCATTTGGCACCGGGCCTGG + Intronic
902269121 1:15290364-15290386 GGAACTCTGGGAACCATGCCTGG - Intronic
902308679 1:15563704-15563726 GAGGCACCTGCCACCATGCCTGG - Intronic
902654001 1:17855020-17855042 CAGGCACTTGCTACCATGCCTGG + Intergenic
902794806 1:18794156-18794178 GAAGAGCTTGGAACAGTGCCCGG - Intergenic
902880122 1:19366543-19366565 CAAGCACCTGCCACCATGCCTGG - Intronic
903079015 1:20794224-20794246 GAGGCACGTGCCACCATGCCTGG + Intergenic
903123121 1:21229324-21229346 CAAGCACTCGTGACCATGCCTGG + Intronic
903129526 1:21269674-21269696 TCAGCACTTTGAACCATCCCAGG + Intronic
903240265 1:21978098-21978120 GATACACTTAGAACAATGCCTGG - Intronic
903244013 1:22002732-22002754 GATACACTTAGAACAATGCCTGG - Intronic
903264095 1:22146378-22146400 AAAGCACTTGGAACAGTGGCTGG - Intergenic
903344317 1:22674699-22674721 GAAGCATTTAGAACAGTGCCTGG + Intergenic
903427413 1:23264499-23264521 CAGGCACTTGCCACCATGCCTGG - Intergenic
903434564 1:23336951-23336973 AAAGCACTTAGAATAATGCCTGG - Intronic
903733604 1:25516145-25516167 CTGGCACTTGGAATCATGCCTGG + Intergenic
903744575 1:25577862-25577884 AGAGCACTTGGAACAGTGCCTGG + Intergenic
903868678 1:26416758-26416780 GAGGCACCTGCCACCATGCCCGG + Intronic
903890580 1:26567672-26567694 GAAGCACTAGAGACCAGGCCAGG - Intronic
904001383 1:27340959-27340981 CAAGCACCTGCCACCATGCCCGG + Intergenic
904139905 1:28344583-28344605 CAGGCACCTGCAACCATGCCCGG - Intergenic
904782174 1:32958571-32958593 CAGGCACCTGCAACCATGCCTGG - Intronic
904909971 1:33927440-33927462 GAAGCATTTTGCACAATGCCTGG - Intronic
904954835 1:34274272-34274294 AAAGCACTTGAAACTGTGCCTGG - Intergenic
904960122 1:34326032-34326054 AAAGCACTTAGAACTATCCCTGG - Intergenic
904973049 1:34434158-34434180 GAAGCACTTAGAACAGTGTCTGG + Intergenic
905237412 1:36559692-36559714 AAAGCACTTAGAATCAAGCCTGG - Intergenic
905356637 1:37389424-37389446 AAAGCACTTAGAACAGTGCCCGG - Intergenic
905483292 1:38276295-38276317 GAAGCACTTAGAAGGATACCTGG + Intergenic
905614589 1:39386572-39386594 CAAGCACGTGCCACCATGCCTGG + Intronic
905844650 1:41218702-41218724 AAAGCACTTAATACCATGCCTGG - Intronic
905853613 1:41292495-41292517 AAAGCACTTAGAACAATGCCTGG + Intergenic
905860533 1:41347940-41347962 CAGGCACTTGCCACCATGCCTGG + Intergenic
905928808 1:41771805-41771827 CAAGCACATGCCACCATGCCCGG + Intronic
905970707 1:42140152-42140174 AAAGCTCTTGGAACCATGTCTGG + Intergenic
905987554 1:42300633-42300655 CAAGCACATGCCACCATGCCCGG - Intronic
906159394 1:43636650-43636672 TAAGCACATGCCACCATGCCTGG + Intergenic
906224757 1:44112545-44112567 CAGGCACTTGCCACCATGCCTGG + Intergenic
906468541 1:46106916-46106938 CAAGCACGTGCAACCACGCCTGG + Intronic
906632866 1:47387205-47387227 CAAGCACTAGTCACCATGCCTGG - Intergenic
906712562 1:47941913-47941935 GAAGTTCTTGGAACAATGCCTGG + Intronic
906883961 1:49624266-49624288 AAAGCATTTAGCACCATGCCTGG + Intronic
906937163 1:50224540-50224562 CAAGCACATGCCACCATGCCTGG + Intergenic
906938639 1:50236399-50236421 CAAGCACTTAGAACAATGCTTGG + Intergenic
907100905 1:51834455-51834477 CAGGCACTTGCCACCATGCCTGG + Intronic
907174237 1:52502993-52503015 AAAGCACTTGGCACGGTGCCAGG - Intronic
907474750 1:54698289-54698311 AAAGCACTTAGAACAGTGCCTGG + Intronic
907660375 1:56386914-56386936 AAAGCATTTAGAACAATGCCTGG + Intergenic
907737374 1:57127799-57127821 GACGTACTTAGCACCATGCCTGG + Intronic
907813159 1:57892411-57892433 AAAGCACTTAGAACAGTGCCTGG - Intronic
907853808 1:58281843-58281865 AAAGCACTTAGAACAATGACTGG + Intronic
907918385 1:58891283-58891305 GAAGGACCTGGCACCATGACTGG - Intergenic
908184926 1:61643312-61643334 GAGGCACCTGCCACCATGCCCGG + Intergenic
908237167 1:62157686-62157708 GAGGCACCTGCCACCATGCCCGG - Intronic
908308776 1:62854418-62854440 CAGGCACTTGCCACCATGCCCGG + Intronic
908545253 1:65155810-65155832 TAGGCACTTGCCACCATGCCTGG + Intronic
908623002 1:66006988-66007010 CAAGCACTTGCCACTATGCCTGG - Intronic
908757276 1:67480445-67480467 AAAGTACTTAGAACAATGCCTGG - Intergenic
908822316 1:68101250-68101272 AAAGCACCTAGCACCATGCCTGG + Intronic
909065257 1:70928488-70928510 TAAGCACATGCCACCATGCCTGG - Intronic
909514900 1:76496356-76496378 GAAGCACTTGAACCCATACCGGG + Intronic
909812402 1:79946672-79946694 CAGGCACTTGCCACCATGCCTGG - Intergenic
909905874 1:81193907-81193929 AAAGCATTTAGAACTATGCCAGG + Intergenic
909954906 1:81767727-81767749 CAGGCACTTGCCACCATGCCTGG - Intronic
910131146 1:83907987-83908009 GTAGCACTTAGCACAATGCCTGG - Intronic
910241265 1:85088571-85088593 AAAGCACTTAGAAGAATGCCTGG - Intronic
910364045 1:86445037-86445059 CAGGCACTTGCCACCATGCCTGG + Intronic
910402755 1:86853814-86853836 CAAGCACCTGCCACCATGCCCGG + Intergenic
910754482 1:90672819-90672841 CAAGCACATGCCACCATGCCTGG + Intergenic
911264304 1:95725296-95725318 AAAGCTCTTGGCACCATGCCTGG + Intergenic
911352607 1:96772978-96773000 CAGGCACCTGGCACCATGCCTGG - Intronic
911442930 1:97951668-97951690 GAAACACTTAGAACAATGCCTGG - Intergenic
911721660 1:101197893-101197915 GAAGCACTTAGAAGAGTGCCTGG - Intergenic
911800050 1:102125121-102125143 TAAGCACATGCCACCATGCCTGG + Intergenic
912047192 1:105473527-105473549 GAGGCACGTGCCACCATGCCCGG + Intergenic
912186763 1:107286410-107286432 GAAGAAATAGGAACCATGCAAGG + Intronic
912267321 1:108171753-108171775 GAAATACTTAGAACAATGCCTGG - Intronic
912558144 1:110530966-110530988 AAAACACTTAGAACAATGCCTGG + Intergenic
912711885 1:111955959-111955981 TAACCACTTGGAACTGTGCCTGG - Intronic
912945950 1:114084307-114084329 AAAGCACTTAGAACAATGCCTGG + Intergenic
913163682 1:116167097-116167119 AAAGCACTTGGAACAATATCTGG + Intergenic
913458399 1:119057645-119057667 CAGGCACCTGCAACCATGCCTGG - Intronic
913678240 1:121163074-121163096 GAAGCACTTGGAACAATGCCTGG + Intergenic
914030080 1:143950714-143950736 GAAGCACTTGGAACAATGCCTGG + Intronic
914159369 1:145117237-145117259 GAAGCACTTGGAACAATGCCTGG - Intergenic
914902474 1:151718222-151718244 AAAGCACTTGGCACAAAGCCTGG - Intronic
915576553 1:156782733-156782755 AAAGCACTTAGAACAGTGCCTGG - Intronic
915915704 1:159939368-159939390 CAAGCACGTGTCACCATGCCTGG + Intronic
915996859 1:160572509-160572531 AAAGCACTTAGCACAATGCCTGG + Intronic
916105371 1:161426151-161426173 CAAGCACGTGCCACCATGCCCGG + Intergenic
916125163 1:161563748-161563770 AAAGCACTTAGCACCATGTCTGG + Intergenic
916135053 1:161645094-161645116 AAAGCACTTAGCACCATGTCTGG + Intronic
916170842 1:162000454-162000476 AAAGCACTTAGAACAGTGCCTGG - Intronic
916294466 1:163202280-163202302 GAAGCACTCAGAACCATGTCTGG - Intronic
916513440 1:165493919-165493941 AAAGCACTTAGAACAGTGCCTGG - Intergenic
916621983 1:166509094-166509116 AAAGAGCTTGGAACAATGCCTGG + Intergenic
916627381 1:166572787-166572809 GGAACAATTGGATCCATGCCAGG + Intergenic
916828827 1:168470086-168470108 GAAGTACTTAGAACATTGCCTGG + Intergenic
917312690 1:173693155-173693177 CAGGCACTTGCCACCATGCCTGG - Intergenic
917332270 1:173893699-173893721 GAAGCACATAGAACTGTGCCTGG - Exonic
917756726 1:178108435-178108457 AAAGCACTTAGAACTGTGCCAGG - Intronic
918005825 1:180541317-180541339 GAAGCACTTAGAACAATGCCTGG + Intergenic
918011612 1:180592182-180592204 CAGGCACATGGCACCATGCCTGG - Intergenic
918277384 1:182966670-182966692 CAGGCACTGGCAACCATGCCTGG + Intergenic
918326989 1:183419189-183419211 CAAGCACTCGCCACCATGCCCGG - Intergenic
918568484 1:185958619-185958641 AAAACACTTAGAACAATGCCTGG - Intronic
918599800 1:186342986-186343008 GAAGCATTTAGAAGCATGTCTGG - Intronic
918666844 1:187161989-187162011 AAAGCACTTAAAACCATGCCTGG - Intergenic
918691898 1:187491284-187491306 AAAGCAATTGGAAAAATGCCTGG + Intergenic
919021764 1:192114859-192114881 GAGGCACATGCCACCATGCCTGG - Intergenic
919460009 1:197865325-197865347 GAGGCACCTGCCACCATGCCCGG - Intergenic
919716045 1:200777795-200777817 CAGGCACTTGCCACCATGCCCGG - Intronic
919800811 1:201353649-201353671 GAAGCCCTGGGAACAGTGCCAGG + Intergenic
919818677 1:201458754-201458776 GAGGCACATGCCACCATGCCTGG - Intergenic
920321542 1:205127359-205127381 GAGGCACATGCCACCATGCCTGG - Intergenic
920399088 1:205666037-205666059 GAGGCACCTGCCACCATGCCTGG - Intronic
920465547 1:206181598-206181620 GAAGCACTTGGAACAATGCCTGG + Intergenic
920569075 1:207002755-207002777 GAAGCAAATGGAGCAATGCCTGG + Intergenic
920712309 1:208306945-208306967 GAAGCAATTATTACCATGCCTGG - Intergenic
920823260 1:209401094-209401116 TGAGCCCTTGGGACCATGCCTGG - Intergenic
920849749 1:209620748-209620770 AAAGCACTTGGAACAGTGCCTGG + Intronic
920868862 1:209776317-209776339 AAAGCACTTAGCACAATGCCTGG + Intronic
920938744 1:210460420-210460442 CAAGCACCTAGAACCATGCTTGG + Intronic
921093246 1:211863221-211863243 TAGGCACTTGCCACCATGCCTGG + Intergenic
921214723 1:212927282-212927304 GAAGCACGGGGAACAATGTCTGG + Intergenic
921358756 1:214311264-214311286 GAAGCACTCAGAACGGTGCCCGG - Intronic
921405934 1:214779539-214779561 CAGGCACGTGCAACCATGCCTGG + Intergenic
921746344 1:218744108-218744130 CAAGCATATGGAACTATGCCAGG - Intergenic
921783882 1:219202816-219202838 TAGGCACTTGCCACCATGCCTGG + Intronic
922276582 1:224084582-224084604 AAAGTACTTAGAACCATGCCTGG - Intergenic
922353796 1:224757362-224757384 TAAGCACCTGCAACCATGTCTGG + Intergenic
922581228 1:226699587-226699609 AAACCACTTAGAACAATGCCTGG + Intronic
922604417 1:226880671-226880693 GAAGAACTTCAAACAATGCCTGG - Intronic
922849060 1:228716424-228716446 TCAGTACTTGGAATCATGCCTGG - Intergenic
923185291 1:231566985-231567007 CAAGCACATGCCACCATGCCTGG + Intronic
923342029 1:233015729-233015751 GAAGCACATGCCACAATGCCTGG - Intronic
923563378 1:235058693-235058715 CAAGCACCTGCCACCATGCCCGG + Intergenic
923611003 1:235493633-235493655 CAGGCACTTGCCACCATGCCCGG - Intronic
924192161 1:241565583-241565605 GATGCACGTGTCACCATGCCTGG - Intronic
924303677 1:242665389-242665411 AAAGCAATTGGAACAGTGCCTGG - Intergenic
924356132 1:243178184-243178206 CAAGCACTTGCCACCACGCCCGG - Intronic
924574041 1:245262958-245262980 AAAGCACTTAGAACCATACCTGG + Intronic
1063640337 10:7823491-7823513 TAAGCACATGCCACCATGCCTGG - Intronic
1063667023 10:8068607-8068629 TAAGCACCTGCCACCATGCCCGG - Intronic
1063996480 10:11624841-11624863 TAGGCACTTGCCACCATGCCTGG - Intergenic
1063999522 10:11651866-11651888 CAGGCACCTGCAACCATGCCCGG - Intergenic
1064115467 10:12573795-12573817 CAAGCACGTGCCACCATGCCTGG + Intronic
1064226336 10:13489074-13489096 GGAGCACTTAGAACAAGGCCTGG - Intronic
1064353315 10:14596493-14596515 AAAGAACTTGACACCATGCCTGG + Intronic
1064492269 10:15872050-15872072 GAAGAACTTGAGCCCATGCCAGG + Intergenic
1064690609 10:17913776-17913798 CAGGCACTTGTCACCATGCCCGG - Intergenic
1064703465 10:18046252-18046274 GAAGCACTTAGCACTGTGCCTGG + Intergenic
1064765143 10:18663149-18663171 CAAGCACCTGCCACCATGCCTGG + Intronic
1064870411 10:19930818-19930840 CAAGCACCTGCAACCAGGCCTGG - Intronic
1065060260 10:21893483-21893505 ACAGCACTTGCCACCATGCCCGG - Intronic
1065137833 10:22690125-22690147 TAAACCCTTAGAACCATGCCTGG - Intronic
1065508140 10:26450234-26450256 AAAGCACTTAGAATAATGCCTGG + Intronic
1065525576 10:26616775-26616797 CAAGCACATGTCACCATGCCTGG + Intergenic
1065550697 10:26865880-26865902 CAGGCACCTGGCACCATGCCCGG - Intergenic
1065591653 10:27268492-27268514 CAAGCACGTGCCACCATGCCTGG + Intergenic
1065617895 10:27547393-27547415 CTAGGACTTAGAACCATGCCTGG - Intergenic
1065659358 10:27989704-27989726 AAAGCACGTGCCACCATGCCTGG - Intronic
1065820212 10:29518243-29518265 CAAGCACTTACTACCATGCCTGG - Intronic
1065916702 10:30359120-30359142 CAAGCACCTGCCACCATGCCCGG - Intronic
1066127143 10:32352454-32352476 AAAGCACTTAGAATCATCCCTGG + Intronic
1066399739 10:35064506-35064528 CAAGTGCTAGGAACCATGCCTGG - Intronic
1066995861 10:42562471-42562493 CAAGCACCTGCCACCATGCCTGG + Intergenic
1067005345 10:42655485-42655507 GAGGCACCTGCGACCATGCCCGG - Intergenic
1067289466 10:44930756-44930778 AAAGCACTTAGGACCATGCTTGG - Intronic
1067315108 10:45154119-45154141 CAGGCACTTGCCACCATGCCTGG + Intergenic
1067402399 10:45988805-45988827 GTAGCAGCTGGAACCATGACAGG + Exonic
1067423902 10:46186663-46186685 CAAGCACTCGCCACCATGCCTGG - Intergenic
1067735195 10:48845178-48845200 GAAGAACTTGGAATGATGCTTGG - Intronic
1067870749 10:49958438-49958460 GTAGCAGCTGGAACCATGACAGG + Exonic
1068515961 10:58025852-58025874 AAAGCACTTAGAATGATGCCTGG + Intergenic
1068606539 10:59011379-59011401 GAAGCACTTAGCACAATGCCTGG + Intergenic
1068823872 10:61411017-61411039 TAAGCACTTGTGACCATGACTGG - Intronic
1068920017 10:62473651-62473673 AAAGCTCTTAGAACCATGCCTGG + Intronic
1069004719 10:63304994-63305016 CAGGCACATGGCACCATGCCTGG - Intronic
1069093922 10:64235441-64235463 CAGGCACTTGTCACCATGCCTGG + Intergenic
1069419847 10:68237479-68237501 AAAGCACTTAGATCTATGCCTGG + Intergenic
1069558585 10:69413871-69413893 GAAGCCCTTAGCACCATGCCTGG - Intronic
1069567052 10:69470620-69470642 GTAGCACTTGCCACCATGCCTGG - Intronic
1069602282 10:69715757-69715779 CAAGCACTTGGAATCATGCTGGG + Intergenic
1069705305 10:70455777-70455799 GAAGCACTCAGCACCATGCCTGG - Intergenic
1069729809 10:70603247-70603269 GAAGTGCTTGGAACTGTGCCTGG + Intergenic
1069843386 10:71354178-71354200 GAAGCACTCAGAAGCCTGCCTGG - Intronic
1069912529 10:71768121-71768143 CAAGCACTTAGAATGATGCCTGG - Intronic
1069928457 10:71867149-71867171 CAGGCACTTGCCACCATGCCCGG - Intergenic
1069952275 10:72027223-72027245 CAGGCACTTGCCACCATGCCTGG - Intergenic
1069993759 10:72330203-72330225 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1070004801 10:72413052-72413074 CAAGCACATGCCACCATGCCTGG - Intronic
1070209017 10:74295317-74295339 CAAGCACGTGCCACCATGCCCGG - Intronic
1070391711 10:75976642-75976664 GAAGGGCTTGGGACAATGCCTGG - Intronic
1070482159 10:76893229-76893251 GAAGCACTTAGAAACATGCTTGG + Intronic
1070510603 10:77157297-77157319 CAGGCACTTGCCACCATGCCCGG - Intronic
1070876957 10:79823638-79823660 CAAGCACCTGCCACCATGCCTGG + Intergenic
1071328219 10:84537200-84537222 AAAGCGCTTAGAACAATGCCTGG - Intergenic
1071511543 10:86265383-86265405 AAAGCACTTGGCACAGTGCCTGG - Intronic
1071533395 10:86406691-86406713 CAGGCACTTGACACCATGCCCGG - Intergenic
1071711061 10:88050009-88050031 CAAGCACGTGCCACCATGCCTGG - Intergenic
1071791184 10:88955985-88956007 GAAGCACCTAGAACACTGCCTGG + Intronic
1071948166 10:90671719-90671741 GAGGCACCTGCCACCATGCCCGG - Intergenic
1072092016 10:92137856-92137878 CAGGCACTTGCCACCATGCCCGG - Intronic
1072144514 10:92622470-92622492 CAAGCACCTGCCACCATGCCTGG - Intronic
1072652454 10:97306276-97306298 CAGGCACTTGCCACCATGCCTGG + Intergenic
1072734369 10:97869160-97869182 GAAGGACTTGGAGCCATGCCTGG + Exonic
1072808763 10:98443888-98443910 CAGGCACTTGCCACCATGCCTGG - Intronic
1072830418 10:98651912-98651934 CAGGCACCTGCAACCATGCCTGG + Intronic
1073109691 10:101054120-101054142 CAGGCACTTGCCACCATGCCCGG - Intergenic
1073222005 10:101882640-101882662 CAAGCACATGCCACCATGCCCGG + Intronic
1073368772 10:102967863-102967885 CAGGCACTTGCCACCATGCCTGG - Intronic
1073611447 10:104947763-104947785 CAGGCACGTGGCACCATGCCTGG + Intronic
1073791080 10:106941139-106941161 AAAGCACTTGAAGCCATGCCTGG + Intronic
1074171210 10:110939358-110939380 TAAGCACGTGCCACCATGCCTGG + Intronic
1074257859 10:111821392-111821414 GAAGCACTTAGAAGAGTGCCTGG + Intergenic
1074307110 10:112289124-112289146 GAAGCACTTAGCACAGTGCCTGG + Intronic
1074316563 10:112366786-112366808 CAAGCACCTGCCACCATGCCTGG - Intergenic
1074363030 10:112838097-112838119 GAAGCACTCAGTACCAGGCCAGG - Intergenic
1074371976 10:112907532-112907554 GAAGTACTTGGCACAGTGCCTGG - Intergenic
1074423658 10:113331603-113331625 AAAACACTTAGAACCATGCCTGG - Intergenic
1074493188 10:113956913-113956935 CAAGCACATGCCACCATGCCTGG + Intergenic
1074628631 10:115223136-115223158 CAAGCACATGCCACCATGCCTGG - Intronic
1074752172 10:116597258-116597280 GTAGCACTTAGCACAATGCCTGG - Intronic
1074765924 10:116700015-116700037 AAAGCTCTTAGAGCCATGCCTGG - Intronic
1075253075 10:120899638-120899660 CAAGCACCTGCCACCATGCCTGG - Intronic
1075270168 10:121042624-121042646 GAAGGACTTAGAACAGTGCCTGG + Intergenic
1075338210 10:121624103-121624125 GAAGTACTTGCCACCACGCCTGG - Intergenic
1076393125 10:130118791-130118813 CAGGCACTTGCCACCATGCCCGG + Intergenic
1076651817 10:131994850-131994872 TGAGCACCTAGAACCATGCCTGG + Intergenic
1076904030 10:133353430-133353452 GAAGCACCTGGTGCCAAGCCCGG + Intergenic
1077004449 11:345944-345966 AAAGCACTTAGTACCATGCTTGG - Intergenic
1077291812 11:1799667-1799689 CAGGCACTTGCCACCATGCCTGG - Intergenic
1077669999 11:4148443-4148465 AAAACACTTGGAACCATGTCTGG - Intergenic
1077841683 11:5982501-5982523 GAAGCACATGGAGCCATGCTGGG + Intergenic
1077897028 11:6460823-6460845 GAAGCACTTAGAATCATGCCTGG - Intronic
1078204190 11:9213662-9213684 CAAGCACCTGCCACCATGCCTGG - Intronic
1078519466 11:12051658-12051680 AAAGCACTTTGAACAGTGCCTGG + Intergenic
1078557665 11:12343263-12343285 CAAGCACCTGCCACCATGCCTGG - Intronic
1078599538 11:12717963-12717985 GAAGGGCTTAGAACCATGTCTGG + Intronic
1078662942 11:13301759-13301781 AAAGCTCTTAGAACCATGCCTGG - Intronic
1078699222 11:13665152-13665174 GAGGCACCTGCCACCATGCCTGG - Intergenic
1078792121 11:14554778-14554800 GAAGTACTTAGAACAATGCCTGG - Intronic
1078848922 11:15146091-15146113 GAAGCATTTAGAACAGTGCCTGG + Intronic
1078943331 11:16033727-16033749 CAAGCACCTGCCACCATGCCCGG - Intronic
1078986013 11:16598610-16598632 GTAGCATTTGCAACCATGCCTGG + Intronic
1079050813 11:17157315-17157337 CAAGCACTTGCCACCACGCCTGG - Intronic
1079434833 11:20437730-20437752 CAAGCACTCGCCACCATGCCCGG + Intronic
1079475009 11:20820989-20821011 CAAGCACTTTGAACAATGCATGG + Intronic
1079505165 11:21145066-21145088 AAAGCGCTTGGAAAAATGCCAGG + Intronic
1079896089 11:26120009-26120031 GAAGCATTTAGAAAAATGCCTGG + Intergenic
1080407426 11:31991915-31991937 AAAGCACTTGGAACAGTGCCTGG - Intronic
1080531472 11:33180735-33180757 CAAGCACATGCCACCATGCCTGG + Intergenic
1080710932 11:34747483-34747505 GAAGCACTTAGAGCAGTGCCTGG - Intergenic
1080713608 11:34774694-34774716 AAAGTGATTGGAACCATGCCAGG - Intergenic
1080775621 11:35383654-35383676 GAAGCATTTAAAACAATGCCTGG + Intronic
1080901951 11:36502901-36502923 AAAGCACTTAGAACAGTGCCAGG + Intronic
1080984705 11:37447806-37447828 AAAGCACTTTGAACAATGCCTGG - Intergenic
1081119012 11:39241291-39241313 CAAGCACTTGCCACCACGCCCGG + Intergenic
1081178486 11:39958504-39958526 GAGGCACTTGCCACCACGCCTGG - Intergenic
1081184049 11:40020479-40020501 CAGGCACTTGCCACCATGCCCGG - Intergenic
1081417825 11:42836848-42836870 AAAGCATTTAGAACCATGCCTGG + Intergenic
1081496504 11:43616529-43616551 GAAGCACTTAGAACAATGCCTGG - Intronic
1081509922 11:43760037-43760059 GAGGCACGTGCCACCATGCCTGG + Intronic
1081583375 11:44367413-44367435 GAGGCACATGCCACCATGCCTGG + Intergenic
1081628832 11:44673528-44673550 CAAGCACATGCCACCATGCCTGG - Intergenic
1082952499 11:58832320-58832342 GAAACACTTGGAATGCTGCCTGG + Intergenic
1083177727 11:60962117-60962139 CAGGCACGTGCAACCATGCCTGG - Intergenic
1083537828 11:63488000-63488022 GAGGCACCTGCCACCATGCCCGG - Intronic
1083649549 11:64193642-64193664 CAAGCACATGCCACCATGCCTGG - Intronic
1083956346 11:65985440-65985462 CAGGCACTAAGAACCATGCCCGG - Intergenic
1083971019 11:66075381-66075403 TAGGCACTTGCCACCATGCCAGG + Intronic
1084046665 11:66572678-66572700 CAGGCACTTGCCACCATGCCCGG + Intergenic
1084233232 11:67768504-67768526 CAAGCACCTGCCACCATGCCTGG - Intergenic
1084577073 11:69995966-69995988 CAAGCACATGTCACCATGCCTGG - Intergenic
1084759548 11:71260697-71260719 CAAGCACTTGCCACCATGCACGG - Intergenic
1085035056 11:73294785-73294807 CAAACACTTGGCCCCATGCCAGG + Intronic
1085129679 11:74027481-74027503 AAAGTACTTGGAACAGTGCCTGG + Intronic
1085132698 11:74055086-74055108 GAAACACGTGGTGCCATGCCTGG - Intronic
1085279860 11:75322959-75322981 AAAGAACTTGGAACAATACCTGG + Intronic
1085304833 11:75479441-75479463 AAAGCACTTGGAACAATGCCTGG - Intronic
1085400894 11:76234875-76234897 GAAGCACGGGAAACCGTGCCAGG + Intergenic
1085609879 11:77937599-77937621 GAAGCACGTGTCACCATGCCCGG - Intronic
1085718663 11:78894849-78894871 CAGGCACGTGGCACCATGCCTGG - Intronic
1085743529 11:79096217-79096239 GAAGCACCTAGCACCATGCTGGG + Intronic
1085761743 11:79247272-79247294 CAGGCACTTGCCACCATGCCCGG - Intronic
1086110366 11:83192638-83192660 AAAGCACTTAGTACAATGCCAGG + Intergenic
1086658991 11:89391614-89391636 CAGGCACATGGCACCATGCCTGG - Intronic
1086738161 11:90332991-90333013 CAAGCACCTGCCACCATGCCCGG + Intergenic
1087191801 11:95262481-95262503 GAAGCACTTAGAACCATGCCCGG + Intergenic
1087352384 11:97048284-97048306 CAAGCACATGCCACCATGCCTGG + Intergenic
1087611372 11:100438001-100438023 AAGGCACTTGGAATAATGCCTGG - Intergenic
1087658828 11:100961404-100961426 AAAGCACTTAGAAGCATGCTAGG + Intronic
1088390111 11:109305067-109305089 TAGGCACTTGCCACCATGCCTGG + Intergenic
1088528117 11:110778521-110778543 TCAGCACTTAGAACCAGGCCTGG - Intergenic
1088554047 11:111043615-111043637 GAGGCACATGCCACCATGCCTGG + Intergenic
1089190313 11:116648811-116648833 CAAGGACATGGAACCAGGCCAGG + Intergenic
1089595499 11:119576588-119576610 GAAGCATTTGGCACAATGGCTGG + Intergenic
1089622945 11:119732580-119732602 GAAGTGCATGGAACAATGCCTGG + Intergenic
1089712113 11:120323043-120323065 GTAGTGCTTGGAACAATGCCTGG + Intergenic
1090025322 11:123162757-123162779 CAGGCACTTGCCACCATGCCTGG - Intronic
1090260194 11:125313967-125313989 AAAGCACTGGGCACAATGCCAGG + Intronic
1090331677 11:125937563-125937585 CAGGCACGTGGCACCATGCCTGG + Intergenic
1090343998 11:126052678-126052700 CAAGCACCTGCCACCATGCCCGG - Intronic
1090391957 11:126394565-126394587 CAAGCACATGCCACCATGCCCGG + Intronic
1090405537 11:126473934-126473956 CAAGCACGTGGTACCATGCCCGG + Intronic
1090682314 11:129074634-129074656 CAAGCACCTGCCACCATGCCTGG + Intronic
1090755196 11:129784439-129784461 CAGGCACTTGACACCATGCCTGG - Intergenic
1090783535 11:130028448-130028470 CAAGCACGTGCCACCATGCCTGG + Intergenic
1090804277 11:130193077-130193099 AAAGCACCGAGAACCATGCCAGG + Intronic
1090983115 11:131741020-131741042 CAGGCACTTGCCACCATGCCCGG - Intronic
1091039930 11:132267671-132267693 GAGGCACCTGCCACCATGCCCGG - Intronic
1091337115 11:134780558-134780580 AAAGCACTTAGAACCTTGTCTGG + Intergenic
1091462798 12:658139-658161 CAAGCACCTGCCACCATGCCTGG + Intronic
1091642614 12:2248939-2248961 GAAGCACCTGGCACCGTGCCTGG + Intronic
1091952261 12:4604121-4604143 AAAGTACTTGGAATCGTGCCTGG + Intronic
1092116025 12:6006634-6006656 CAAGCACGTGCCACCATGCCTGG - Intronic
1092155152 12:6277454-6277476 GGAGCACTTGGAACAGTACCTGG + Intergenic
1092293383 12:7179048-7179070 CAGGCACTTGCCACCATGCCTGG + Intergenic
1092496824 12:9004617-9004639 CAAGCACATGCCACCATGCCTGG + Intronic
1092970462 12:13689328-13689350 GAAGCACTTGGAAAGGTGCCTGG + Intronic
1093247635 12:16759814-16759836 CAAGCACATGACACCATGCCTGG + Intergenic
1093384804 12:18539314-18539336 AAAGCACTTAGCACAATGCCTGG - Intronic
1093787938 12:23214452-23214474 TAGGCACTTGCCACCATGCCTGG + Intergenic
1093809041 12:23470611-23470633 TAGGCACCTGTAACCATGCCTGG + Intergenic
1093878560 12:24377802-24377824 CAAACACTTAGAACCATCCCTGG + Intergenic
1093906193 12:24694607-24694629 AGAGCACTTGGAACAATGTCTGG - Intergenic
1093936271 12:25004079-25004101 GAAGAGCTTAGTACCATGCCTGG + Intergenic
1094015429 12:25857551-25857573 CAGGCACATGCAACCATGCCTGG - Intergenic
1094105451 12:26806681-26806703 CAGGCACTTGCCACCATGCCTGG + Intronic
1094110713 12:26859438-26859460 CAGGCACATGGCACCATGCCTGG + Intergenic
1094117758 12:26936346-26936368 GAAGCACTTTGAAATATGTCTGG + Intronic
1094324200 12:29219029-29219051 CAAGCACATGAGACCATGCCTGG + Intronic
1094454967 12:30621792-30621814 CAGGCACATGGCACCATGCCAGG - Intergenic
1094474770 12:30832764-30832786 GAAGCACTCAGCACAATGCCCGG - Intergenic
1095150104 12:38784023-38784045 AAAGCACCAGGAACCAAGCCTGG + Intronic
1095197200 12:39334056-39334078 GAGGCACGTGCCACCATGCCTGG - Intronic
1095239516 12:39840172-39840194 CAGGCACGTGCAACCATGCCTGG + Intronic
1095260109 12:40088038-40088060 GAAACTCTTGGAACAGTGCCTGG - Intronic
1095364363 12:41384875-41384897 TAAACACTTGGAATCCTGCCTGG + Intronic
1095506645 12:42905639-42905661 TAAGCACTTGGAAGAATGCTAGG + Intergenic
1095508991 12:42928872-42928894 ACAGAACTTAGAACCATGCCTGG - Intergenic
1095796752 12:46227508-46227530 AAAACACTTGGAATAATGCCTGG + Intronic
1095812952 12:46390595-46390617 GAAGCACTTAGAACCATGCCTGG + Intergenic
1095891654 12:47240395-47240417 CAGGCACTTGCCACCATGCCTGG - Intergenic
1096047854 12:48580122-48580144 CAAGCACTTGCCACCACGCCTGG - Intergenic
1096052950 12:48627432-48627454 CAAGCACATGCCACCATGCCTGG - Intergenic
1096306546 12:50482685-50482707 GGAGCACATGCCACCATGCCTGG + Intergenic
1096449248 12:51723345-51723367 GAGGCACATGCCACCATGCCTGG - Intronic
1096473490 12:51894126-51894148 GCAGCACTTGGCATCATACCTGG + Intergenic
1097073495 12:56374612-56374634 CAGGCACTTGCCACCATGCCTGG - Intergenic
1097109627 12:56648637-56648659 GAAGCATTGAGAACAATGCCTGG + Intergenic
1097125967 12:56775358-56775380 GAAGCGGTTGCCACCATGCCTGG + Intronic
1097262821 12:57729031-57729053 CAGGCACTTGCCACCATGCCCGG - Intronic
1097388278 12:58977661-58977683 TAAGCACTTGGAGGCTTGCCTGG + Intergenic
1097566871 12:61281169-61281191 GAAGCACTTGGCATGGTGCCTGG + Intergenic
1097613910 12:61861091-61861113 GAGGCACATGCCACCATGCCTGG + Intronic
1097641135 12:62183524-62183546 CAGGCACTTGCCACCATGCCCGG + Intronic
1097916247 12:65023176-65023198 AAAGCACTTGGAACAGAGCCTGG + Intergenic
1097942518 12:65327263-65327285 GAGGGACTTGGCACTATGCCAGG + Intronic
1097995439 12:65882711-65882733 AAAGCACTTGGCACAATGCCTGG + Intronic
1098109598 12:67108054-67108076 CTAGAACTTGGCACCATGCCAGG - Intergenic
1098192487 12:67964910-67964932 GAAGCACCTGAGACAATGCCTGG + Intergenic
1098541815 12:71665200-71665222 AAAGCACTTTGAACAATGCCTGG + Intronic
1099055866 12:77839928-77839950 CAAGCACTTGCCACCACGCCTGG - Intronic
1099214796 12:79840262-79840284 GAAGCTCTTGGCTCAATGCCTGG + Intronic
1099234477 12:80067620-80067642 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1099847610 12:88047976-88047998 CCAGCACCTGGAAACATGCCAGG - Intronic
1100405194 12:94266788-94266810 AAAGCACTTAGAACATTGCCAGG + Intronic
1100601847 12:96118469-96118491 AAAGCACTTAAAACAATGCCTGG - Intergenic
1100727707 12:97426598-97426620 AAAGCACTTGGAATGGTGCCTGG - Intergenic
1100797158 12:98194580-98194602 AGAGCACTTAGCACCATGCCTGG + Intergenic
1101006806 12:100409326-100409348 CAGGCACATGCAACCATGCCTGG + Intronic
1101096476 12:101346983-101347005 GAAGCACTTGAAATAGTGCCTGG - Intronic
1101145453 12:101836634-101836656 CAAGCACCTGCCACCATGCCTGG + Intergenic
1101366441 12:104075599-104075621 GAGGCACATGCAGCCATGCCTGG + Intronic
1101570314 12:105947593-105947615 ACAGCACTTTGAACCATGCAAGG + Intergenic
1101599673 12:106198115-106198137 GAATCATTTGGAAAAATGCCTGG - Intergenic
1101726787 12:107394726-107394748 AAAGCATTTAGAACAATGCCTGG + Intronic
1101977538 12:109374425-109374447 GAAGCACTTGGGGCAGTGCCTGG + Intronic
1101978594 12:109385035-109385057 AAAGCACATGGAACCCTGCCAGG - Intronic
1102018553 12:109665003-109665025 CAGGCACTTGCCACCATGCCCGG + Intergenic
1102288514 12:111679732-111679754 CAAGCACCTGCCACCATGCCCGG - Intronic
1102465037 12:113124727-113124749 AAAGCGCTTAGCACCATGCCTGG + Intronic
1102473881 12:113176038-113176060 AAAGTACTTGGAACCCTCCCTGG - Intronic
1102559349 12:113751148-113751170 CAGGCACCTGGCACCATGCCTGG + Intergenic
1102592100 12:113964351-113964373 AAAGCACCTGGAACAGTGCCTGG + Intronic
1102657157 12:114491705-114491727 GAAGCATTTGTTACCATACCAGG - Intergenic
1102816651 12:115871275-115871297 CCAGCACTTGCCACCATGCCAGG - Intergenic
1103256513 12:119546145-119546167 GAAGCACTTAGAACAATGCGTGG - Intergenic
1103263789 12:119612134-119612156 CAGGCACGTGGCACCATGCCCGG + Intronic
1103287143 12:119812086-119812108 CAAGCACCTGCCACCATGCCTGG + Intronic
1103294389 12:119873962-119873984 AAAGCACTTAGCACCTTGCCTGG - Intronic
1103359435 12:120345209-120345231 CAAGCACCTGCCACCATGCCTGG - Intronic
1103385017 12:120525240-120525262 CAGGCACTTGCCACCATGCCTGG + Intronic
1103533036 12:121615728-121615750 CAAGCACCTGCCACCATGCCTGG + Intergenic
1103579147 12:121901489-121901511 TAGGCACATGTAACCATGCCTGG + Intronic
1103621673 12:122190718-122190740 CAGGCACTTGCCACCATGCCTGG - Intronic
1103625253 12:122213940-122213962 GAAGCGCCTGCCACCATGCCTGG - Intronic
1103921218 12:124400200-124400222 GAAGCACCTAGAACAGTGCCTGG - Intronic
1103961778 12:124613488-124613510 AAAACACTTGGCCCCATGCCTGG - Intergenic
1103979967 12:124730726-124730748 GAAGCACTGGGCACTGTGCCAGG + Intergenic
1104004545 12:124882834-124882856 GAAGCACTTGCCACCGTGCCTGG - Intergenic
1104026637 12:125032313-125032335 CAAGCACTTGCCACCACGCCCGG - Intergenic
1104096716 12:125565033-125565055 AAAACACTTGGAACAATGCCTGG - Intronic
1104275723 12:127325658-127325680 GAAGCACTTAAAATCATACCTGG - Intergenic
1104445702 12:128831631-128831653 CAAGCACCTGCCACCATGCCCGG - Intergenic
1104750918 12:131237800-131237822 TAAGCACTTGCCACCATGCCTGG - Intergenic
1105020334 12:132812043-132812065 AAAGCACGTGCCACCATGCCCGG - Intronic
1105586435 13:21748855-21748877 TAAGCACATGCCACCATGCCTGG + Intergenic
1105964948 13:25375229-25375251 CTAGCACCTAGAACCATGCCGGG - Intronic
1106116892 13:26825442-26825464 CAAGCACATGCAACCATGCCTGG - Intergenic
1106291986 13:28372222-28372244 CAGGCACTTGACACCATGCCTGG + Intronic
1106298571 13:28440795-28440817 AAAGCACTTAGAATGATGCCTGG + Intronic
1106306350 13:28514699-28514721 CAAGCACCTGCCACCATGCCTGG + Intergenic
1106544071 13:30715301-30715323 AAAGCACTTGGTCCCGTGCCTGG + Intronic
1106724947 13:32474549-32474571 CAAGCACATGCCACCATGCCCGG - Intronic
1106738613 13:32614438-32614460 TAGGCACCTGCAACCATGCCTGG + Intronic
1106742216 13:32656737-32656759 CAAGCACATGCCACCATGCCTGG + Intronic
1106924465 13:34599851-34599873 AAAGCCCTTAGATCCATGCCTGG - Intergenic
1106943968 13:34805028-34805050 TAAACACTTGGAACGAGGCCTGG - Intergenic
1107069393 13:36254416-36254438 CAGGCACCTGCAACCATGCCAGG + Intronic
1107139059 13:36978027-36978049 CAGGCACGTGGCACCATGCCCGG + Intronic
1107232202 13:38123731-38123753 CAAGCACCTGCCACCATGCCTGG + Intergenic
1107395617 13:40013713-40013735 GAAACACTTAGCACCGTGCCTGG + Intergenic
1107494570 13:40913326-40913348 CAAGCACATGCCACCATGCCCGG - Intergenic
1107626502 13:42291393-42291415 CAGGCACGTGGCACCATGCCAGG + Intronic
1108209208 13:48121362-48121384 AAAGCACTTGGAACAGAGCCTGG - Intergenic
1108343261 13:49518558-49518580 AAAGCACTTAGAACTATGCCTGG - Intronic
1108452130 13:50577293-50577315 CAAGCACCTGCCACCATGCCTGG + Intronic
1108649238 13:52459463-52459485 CAAGCATTTGCCACCATGCCTGG + Intronic
1108754761 13:53486466-53486488 CAAGCACGTGCCACCATGCCTGG + Intergenic
1108861657 13:54867896-54867918 GAGGCACATGCTACCATGCCTGG - Intergenic
1109113975 13:58357540-58357562 CAGGCACTTGCCACCATGCCCGG + Intergenic
1109159562 13:58955779-58955801 GCTGAACTAGGAACCATGCCGGG - Intergenic
1109197996 13:59400330-59400352 CAAGCACATGGCACCATGCCTGG - Intergenic
1109694605 13:65937453-65937475 TAAGCATTTGGAACCATGCCTGG - Intergenic
1110135178 13:72059096-72059118 GAAGCATGTGCCACCATGCCTGG + Intergenic
1110755227 13:79165447-79165469 CAAGCACCTGCAGCCATGCCTGG - Intergenic
1110799293 13:79676240-79676262 GGAGCAGGAGGAACCATGCCTGG - Intergenic
1110877900 13:80533399-80533421 CAGGCACATGGCACCATGCCTGG + Intergenic
1110975935 13:81834238-81834260 CAAGCACGTGCCACCATGCCTGG + Intergenic
1111212309 13:85095282-85095304 GAAGCACTTAGGACAATGTCTGG + Intergenic
1111395545 13:87664127-87664149 CAAGCACGTGCCACCATGCCTGG - Intergenic
1111481945 13:88840520-88840542 CAGGCACTTGCCACCATGCCTGG - Intergenic
1111608819 13:90576862-90576884 TAAGCACTTGCCACCATACCTGG - Intergenic
1111800951 13:92980032-92980054 CAGGCACCTGCAACCATGCCCGG - Intergenic
1112123894 13:96443385-96443407 CAGGCACTTGCCACCATGCCCGG - Intronic
1112375719 13:98838330-98838352 GAAGCTCTTGGAACAGTGCCTGG + Intronic
1112483118 13:99795509-99795531 CAAGCACATGCCACCATGCCTGG - Intronic
1113856659 13:113450035-113450057 GAAGCAGCTGGAACAATGCCTGG + Intronic
1114005678 14:18310908-18310930 CAGGCACTTGCCACCATGCCTGG - Intergenic
1114168386 14:20245634-20245656 AGAGCACTTAGAACTATGCCTGG + Intergenic
1114326936 14:21598915-21598937 GAGGCACCTGCCACCATGCCTGG + Intergenic
1114373844 14:22121911-22121933 CAGGCACTTGCCACCATGCCCGG + Intergenic
1114622751 14:24106957-24106979 AAAGCACTCAGAACTATGCCTGG + Intronic
1114660831 14:24342896-24342918 CAAGCACATGCCACCATGCCTGG - Intergenic
1114886543 14:26858910-26858932 CAAGCACGTGCAACCACGCCCGG + Intergenic
1115053994 14:29099978-29100000 GAAGCACTTGGAACAGTGCCTGG - Intergenic
1115241682 14:31256265-31256287 CAGGCACTTGCCACCATGCCCGG + Intergenic
1115546639 14:34470232-34470254 CAGGCACTTGCCACCATGCCTGG - Intergenic
1115559868 14:34573430-34573452 CAGGCACTTGCCACCATGCCTGG - Intronic
1115614704 14:35083603-35083625 CAAGCACCTGCTACCATGCCCGG - Intronic
1115639039 14:35320243-35320265 CAGGCACCTGGCACCATGCCCGG + Intergenic
1115693358 14:35869701-35869723 CAAGCACGTGCCACCATGCCTGG - Intronic
1115782315 14:36783372-36783394 GAAGCAGTTAGTACCATGCATGG + Intronic
1116558933 14:46351958-46351980 GAGGCACATGCCACCATGCCTGG + Intergenic
1116807592 14:49508956-49508978 CAGGCACTTGCCACCATGCCTGG - Intergenic
1116823010 14:49644020-49644042 TAGGCACTTGCCACCATGCCTGG + Intronic
1117139484 14:52773478-52773500 GAGGCACATGCCACCATGCCTGG + Exonic
1117511298 14:56454283-56454305 AAAGTGCTTAGAACCATGCCTGG + Intergenic
1117524298 14:56581633-56581655 AAAGCACTTGGAACAGTGCCTGG - Intronic
1117741482 14:58823615-58823637 CAAGCACTTCGAACAGTGCCTGG + Intergenic
1117772965 14:59152802-59152824 GAAGCACCTGCCACCACGCCTGG - Intergenic
1117838843 14:59836298-59836320 AAAGCCCTTGGCAGCATGCCTGG - Intronic
1118453981 14:65928999-65929021 GAAGCACTTAGAACAGTGCCTGG - Intergenic
1118638544 14:67770683-67770705 AAAGCACTTAGTATCATGCCTGG + Intronic
1118718175 14:68575120-68575142 GAAGGGCTTGGCACAATGCCTGG - Intronic
1119293505 14:73514923-73514945 CAAGCACATGCCACCATGCCCGG - Intronic
1119404513 14:74389289-74389311 CAGGCACGTGGCACCATGCCCGG + Intergenic
1119427365 14:74544447-74544469 AAAGCACTTAGCACCGTGCCTGG + Intronic
1119529395 14:75349048-75349070 CAGGCACTTGCCACCATGCCCGG + Intergenic
1119636021 14:76274095-76274117 AAAGAACTTGGAAACATGCCAGG - Intergenic
1119646701 14:76353533-76353555 AAAGCACTTAGAACAGTGCCTGG - Intronic
1119653134 14:76397625-76397647 GAAGCACGAGCCACCATGCCTGG - Intronic
1119728402 14:76936123-76936145 CAAGCACCTGCCACCATGCCTGG + Intergenic
1119775706 14:77247341-77247363 CAAGCACATGCCACCATGCCTGG + Intronic
1119870227 14:78010819-78010841 GAAGCACTTGGAACAGTGCCTGG + Intergenic
1120051347 14:79870524-79870546 TAGGCACTTGCCACCATGCCCGG + Intergenic
1120237279 14:81906447-81906469 AAAGCACTTAGCACAATGCCTGG + Intergenic
1120308305 14:82798462-82798484 AAATCACTGGGCACCATGCCTGG - Intergenic
1120761195 14:88286994-88287016 AAAGCACTTGGAATAGTGCCTGG - Intronic
1120814933 14:88846162-88846184 CAAGCACGTGCCACCATGCCTGG - Intronic
1121044086 14:90775283-90775305 AAAGCACTTAGCACAATGCCCGG - Intronic
1121451780 14:94012604-94012626 TAAGCACCTGCTACCATGCCTGG + Intergenic
1121522554 14:94596280-94596302 TCAGCACTTGGAACAGTGCCAGG - Intronic
1121648772 14:95540030-95540052 CAGGCACCTGGCACCATGCCTGG + Intronic
1121802871 14:96789569-96789591 AAAGTACTTGGGACCATGCTTGG + Intergenic
1121907604 14:97761350-97761372 TAGGCACGTGAAACCATGCCTGG - Intronic
1122221862 14:100244421-100244443 GTAGCACGTGCCACCATGCCTGG + Intronic
1122222666 14:100250860-100250882 AAAGCACATGCCACCATGCCTGG - Intronic
1122491544 14:102119629-102119651 CAAGCACGTGCCACCATGCCTGG + Intronic
1122761816 14:104034331-104034353 CAAGCACCTGCCACCATGCCTGG + Intronic
1122927953 14:104917755-104917777 GAAGCACCTGCCACCATGCCCGG + Intergenic
1122992689 14:105245216-105245238 CAGGCACTTGCCACCATGCCCGG - Intronic
1123683924 15:22784103-22784125 CAAGCACATGTCACCATGCCTGG + Intronic
1124088671 15:26577368-26577390 CAAGCACATGCCACCATGCCTGG - Intronic
1124099675 15:26681827-26681849 GAGGCACGTGCCACCATGCCTGG - Intronic
1124643872 15:31420833-31420855 CAAGCACCTGCCACCATGCCCGG + Intronic
1124809219 15:32917533-32917555 AAAACACTTAGAACAATGCCTGG - Intronic
1125097183 15:35868381-35868403 GAAGCACATGGAACAATGTTTGG - Intergenic
1125224880 15:37384569-37384591 AAAGTACTTAGAACAATGCCTGG + Intergenic
1125278614 15:38020499-38020521 GAAGCACTTGGTACCACCCAAGG + Intergenic
1125874236 15:43130112-43130134 CAAGCACGTGCCACCATGCCTGG + Intronic
1125888072 15:43243842-43243864 GCAGTGCTTGGCACCATGCCTGG - Intronic
1126038864 15:44571638-44571660 CAGGCACCTGCAACCATGCCCGG + Intronic
1126118980 15:45234397-45234419 CAAGCACCTGCCACCATGCCTGG + Intergenic
1126352642 15:47760746-47760768 GTAGCAGTTTGACCCATGCCTGG + Intronic
1126373003 15:47966597-47966619 GAAGCACTTGGAACAGAACCTGG + Intergenic
1126822215 15:52515511-52515533 GAAGCACTTAGAATAATGCCTGG - Intronic
1127010218 15:54617556-54617578 GAAGCACTTAGCACAATGCCTGG + Intronic
1127044879 15:55015057-55015079 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1127086404 15:55428094-55428116 CAAGCACCTGCCACCATGCCCGG + Intronic
1127195733 15:56583568-56583590 GTAGCACCTGCCACCATGCCCGG - Intergenic
1127228866 15:56966977-56966999 CAAGCACCTGCCACCATGCCTGG - Intronic
1127414036 15:58739372-58739394 CAAGCACCTGCCACCATGCCTGG - Intronic
1127573905 15:60271823-60271845 CAAGCACGTGCCACCATGCCTGG + Intergenic
1127586149 15:60380204-60380226 GAAGCATTTAGCACGATGCCTGG - Intronic
1127811659 15:62570257-62570279 GACACACTTGGAACCAAGCCAGG - Intronic
1127994530 15:64145504-64145526 CAAGCACGTGCCACCATGCCCGG + Intronic
1128168648 15:65490560-65490582 AAAGCACTTAGAACAAAGCCTGG + Intronic
1128221493 15:65971853-65971875 GAGGAAATAGGAACCATGCCTGG + Intronic
1128266531 15:66271852-66271874 CAAGGGCTTGGAACAATGCCTGG - Intergenic
1128297887 15:66540408-66540430 CAGGCACATGCAACCATGCCCGG - Intronic
1128754853 15:70174896-70174918 GTAGCACCTGCCACCATGCCTGG + Intergenic
1128829433 15:70753643-70753665 CTAGCACTTAGAACAATGCCTGG + Intronic
1128915930 15:71562475-71562497 GAACCACTTTGAATAATGCCTGG - Intronic
1128967655 15:72076160-72076182 CAGGCACATGGCACCATGCCTGG - Intronic
1129195185 15:73960279-73960301 GAGGCACGTGTCACCATGCCTGG + Intergenic
1129204923 15:74031765-74031787 GAAGCACTTAGCACTGTGCCTGG + Intronic
1129238095 15:74235658-74235680 AAAGCACTTAGGACCCTGCCTGG + Intergenic
1129358062 15:75005865-75005887 CAAGCACGTGCTACCATGCCTGG + Intronic
1129585125 15:76854827-76854849 CAGGCACCTGCAACCATGCCTGG - Intronic
1129667558 15:77588038-77588060 GAAGCACCCGGAACCTTGCTTGG - Intergenic
1129773610 15:78218582-78218604 AAAGCAATTGGAACAGTGCCTGG - Intronic
1130046096 15:80446049-80446071 AAAGCACTTAGAATGATGCCTGG - Intronic
1130266231 15:82406858-82406880 CAGGCACATGCAACCATGCCCGG + Intergenic
1130270902 15:82446307-82446329 GAAGCGCCTGCCACCATGCCCGG - Intergenic
1130463242 15:84173630-84173652 GAAGCGCCTGCCACCATGCCCGG - Intronic
1130489432 15:84421158-84421180 GAAGCGCCTGCCACCATGCCCGG + Intergenic
1130501023 15:84499920-84499942 GAAGCGCCTGCCACCATGCCCGG + Intergenic
1130505779 15:84540019-84540041 CAGGCACGTGCAACCATGCCCGG - Intergenic
1131161056 15:90105083-90105105 CAAGAACATGCAACCATGCCCGG + Intergenic
1131163481 15:90125477-90125499 CAGGCACATGGCACCATGCCAGG - Intergenic
1131315601 15:91334052-91334074 CAAGCACATGCCACCATGCCTGG - Intergenic
1131527774 15:93166346-93166368 AAAGCACTTAGGACAATGCCAGG - Intergenic
1132147940 15:99439476-99439498 CCAGCACTTAGAACAATGCCTGG - Intergenic
1132271991 15:100534397-100534419 AAAGCACTTAGAACAATACCTGG + Intronic
1132272029 15:100534839-100534861 AAAGCACTTAGAACAATACCTGG - Intronic
1132388512 15:101420501-101420523 CAAGCACATGCCACCATGCCCGG + Intronic
1133082753 16:3336502-3336524 CAGGCACTTGCCACCATGCCTGG + Intergenic
1133093946 16:3428047-3428069 CAGGCACTTGCCACCATGCCTGG - Intronic
1133154845 16:3866016-3866038 GGAGCACTGGGAACCATTCCAGG - Intronic
1133213723 16:4277804-4277826 CAGGCACTTGCCACCATGCCCGG - Intergenic
1133282172 16:4672979-4673001 CAAGCACGTGCCACCATGCCCGG + Intronic
1133404323 16:5510690-5510712 AAAGCTCTTGGAACCAAGCTTGG + Intergenic
1133811265 16:9162763-9162785 GAAGCATCTGGAACAATGCCTGG + Intergenic
1133837074 16:9376947-9376969 GAGGCAGGTGGCACCATGCCTGG + Intergenic
1133935423 16:10265257-10265279 GAGGCACCTGCCACCATGCCTGG - Intergenic
1134003538 16:10801597-10801619 GAAGCACATGCTACCATGCCTGG + Intronic
1134020600 16:10918755-10918777 TAAGCACTTGTCACAATGCCAGG + Intronic
1134021051 16:10922004-10922026 TAAGTACTTGGCACAATGCCAGG + Intronic
1134100143 16:11446290-11446312 CAAGCACATGCCACCATGCCTGG + Intronic
1134171014 16:11969827-11969849 GAAGCACTTAGAACAGTCCCTGG - Intronic
1134340852 16:13344376-13344398 GCAGCACTTGGAACCATTCCTGG - Intergenic
1134391269 16:13822468-13822490 AAAGCACTTGGAACAGTACCTGG - Intergenic
1134413563 16:14023740-14023762 AAAGCACTTAGAACTGTGCCTGG + Intergenic
1134599041 16:15518974-15518996 CCAGCATTTGGAACAATGCCTGG + Intronic
1135017346 16:18934981-18935003 CAGGCACTTGCCACCATGCCCGG + Intergenic
1135026723 16:19004505-19004527 CAGGCACTTGCCACCATGCCTGG + Intronic
1135078305 16:19412698-19412720 GAAACACTCGGAACAGTGCCTGG + Intronic
1135196340 16:20398132-20398154 GAAGCACTTAGGACAGTGCCAGG + Intronic
1135397337 16:22141341-22141363 AAAGCACTTAGCACAATGCCAGG + Intronic
1135435489 16:22424399-22424421 GAAGCGCTTGGCACCATTCCGGG - Intronic
1135530201 16:23246494-23246516 GAGGCACTTGCCACCATGCCTGG - Intergenic
1135731879 16:24901470-24901492 TAAGCACATGCCACCATGCCTGG - Intronic
1135750121 16:25051446-25051468 CAAGCATTTGGAATAATGCCTGG + Intergenic
1135759354 16:25124532-25124554 CAAGCATTTGGAATAATGCCTGG + Intronic
1135976659 16:27112990-27113012 CAGGCACTTGCCACCATGCCCGG + Intergenic
1136100279 16:27989595-27989617 CAAGCATTTGCCACCATGCCTGG - Intronic
1136338370 16:29625823-29625845 CAAGCACCTGCCACCATGCCTGG - Intergenic
1136381171 16:29896644-29896666 GAAACAATTGGAACACTGCCTGG + Intronic
1136391010 16:29964178-29964200 CAGGCACGTGCAACCATGCCCGG - Intronic
1136453257 16:30366360-30366382 CAAGCACGTGCCACCATGCCTGG - Intronic
1136595528 16:31246645-31246667 TAATCACTTAGAACCATGTCTGG + Intergenic
1136613917 16:31383897-31383919 CAAGCACATGCCACCATGCCTGG - Intergenic
1136616057 16:31399279-31399301 AAAGCACTTGGAACCCTGCCTGG + Intronic
1137368021 16:47877607-47877629 TCAGCACCTAGAACCATGCCTGG + Intergenic
1137599682 16:49748154-49748176 GAAGCACCTAGAACAGTGCCTGG + Intronic
1137799333 16:51247939-51247961 GAAGCACTGAGAATAATGCCTGG + Intergenic
1137800548 16:51258644-51258666 TAAGCACTTGCCACCAAGCCCGG + Intergenic
1137833466 16:51567517-51567539 GAGGCACATGCCACCATGCCTGG + Intergenic
1138463288 16:57166832-57166854 GAAGCACTTAACACAATGCCTGG + Intronic
1138509702 16:57501286-57501308 CAAGCACATGCCACCATGCCTGG - Intergenic
1138546684 16:57723583-57723605 CAAGCACATGCCACCATGCCTGG - Intronic
1138916660 16:61472320-61472342 CAAGCACCTGCCACCATGCCTGG + Intergenic
1139094672 16:63691156-63691178 CAAGCACCTGCCACCATGCCCGG - Intergenic
1139463364 16:67140671-67140693 CATGCAGCTGGAACCATGCCTGG + Intronic
1139488545 16:67272969-67272991 GAGGCACATGCCACCATGCCTGG + Intergenic
1139742749 16:69049572-69049594 CAGGCACTTGCCACCATGCCTGG + Intronic
1139859040 16:70005574-70005596 GAGGCACATGCCACCATGCCTGG - Intergenic
1140190898 16:72815263-72815285 TAAGCACTTGCCACCACGCCTGG - Intronic
1140253167 16:73312631-73312653 GAAGCATTTGGCACCATTCCTGG - Intergenic
1140437219 16:74957356-74957378 CAGGCACAAGGAACCATGCCCGG + Intronic
1141017608 16:80465300-80465322 GAGGCACTAGGAACGATGTCTGG - Intergenic
1141084391 16:81081383-81081405 GAGGCACATGCCACCATGCCAGG + Intergenic
1141101623 16:81201724-81201746 AAAGCACTTAGAACAGTGCCTGG + Intergenic
1141329714 16:83099464-83099486 CAGGCACCTGGCACCATGCCTGG + Intronic
1141553155 16:84819675-84819697 GAAGCGCTTGGCACCGCGCCAGG + Intergenic
1141951302 16:87341511-87341533 GAGGCACCTGCCACCATGCCTGG - Intronic
1142044689 16:87918204-87918226 GAAGCACTTGGCACCATTCTGGG - Intronic
1142391642 16:89804892-89804914 CAGGCACGTGGCACCATGCCCGG - Intronic
1142545708 17:701181-701203 CAAGCACATGCCACCATGCCTGG - Intronic
1142566073 17:841152-841174 GAAGGGCTTGGAAACATCCCTGG + Intronic
1142719739 17:1768057-1768079 CAAGCACTTGCCACCACGCCTGG - Intronic
1142778820 17:2164278-2164300 CAAGCACCTGCCACCATGCCCGG - Intronic
1142789693 17:2254475-2254497 GAAGCACGTGCCACCAAGCCCGG + Intronic
1143136207 17:4713997-4714019 GAAACACTTGGAACAGTGCTGGG + Intronic
1143187942 17:5021854-5021876 GGAGTACTTAGAACCATGGCCGG - Intronic
1143349147 17:6274659-6274681 AAAGCACTTGACACAATGCCTGG - Intergenic
1144031666 17:11328537-11328559 AAAGTACTTGGAACAGTGCCTGG + Intronic
1144168095 17:12632192-12632214 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1144180870 17:12751592-12751614 AAAGCACTTGGAATAGTGCCTGG - Intronic
1144820814 17:18072783-18072805 GAGGCACCTGCCACCATGCCTGG + Intergenic
1144957145 17:19024429-19024451 GGAGCCCCTGGGACCATGCCAGG - Intronic
1145281835 17:21473646-21473668 GAAGACCTTAGAACAATGCCTGG - Intergenic
1145304492 17:21665894-21665916 GAAGTACTTCGCACAATGCCTGG - Intergenic
1145395612 17:22491973-22491995 GAAGACCTTAGAACAATGCCTGG + Intergenic
1145740845 17:27273132-27273154 CAAGCACATGCCACCATGCCTGG - Intergenic
1145892737 17:28428937-28428959 CAGGCACTTGCCACCATGCCCGG - Intergenic
1145945826 17:28773653-28773675 CAAGCACATGCCACCATGCCCGG - Intronic
1146023337 17:29297833-29297855 CAGGCACATGGCACCATGCCTGG + Intergenic
1146041886 17:29463426-29463448 CAAGCACATGCCACCATGCCCGG - Intronic
1146042577 17:29470980-29471002 CAGGCACCTGCAACCATGCCTGG - Intronic
1146192096 17:30778270-30778292 CAAGCACCTGCCACCATGCCTGG - Intronic
1146250918 17:31343400-31343422 CAAGCACGTGCCACCATGCCTGG - Intronic
1146280522 17:31541457-31541479 AAAGCACTTGGAACACTGCCTGG - Intergenic
1146282389 17:31553138-31553160 CAGGCACTTGCCACCATGCCCGG + Intergenic
1146337265 17:31985010-31985032 CAAGCACCTGCCACCATGCCTGG - Intronic
1146483862 17:33227665-33227687 AAAGCTCTTAGAACAATGCCTGG - Intronic
1146524401 17:33553687-33553709 AAAGCACATAGTACCATGCCTGG - Intronic
1146701418 17:34963807-34963829 AAAGCACTTAGAACCATGCCTGG - Intronic
1146772647 17:35582871-35582893 AAAGCACTTAGAACTATGGCTGG - Intronic
1146961843 17:36987128-36987150 CAGGCACTTGCCACCATGCCTGG + Intronic
1147296969 17:39491752-39491774 GAGGCACCTGCCACCATGCCTGG + Intronic
1147483028 17:40785362-40785384 CAAGCACATGCCACCATGCCTGG + Intergenic
1147554646 17:41469067-41469089 CAAGCACTCAGCACCATGCCTGG - Intergenic
1147747545 17:42704396-42704418 CAAGCACCTGCCACCATGCCCGG - Intronic
1148060680 17:44834135-44834157 CAGGCACATGCAACCATGCCTGG - Intergenic
1148235896 17:45968847-45968869 AAAGCACTTTGTACCATGCCTGG - Intronic
1148431315 17:47646161-47646183 GAAGTACATGCCACCATGCCCGG + Intergenic
1148652266 17:49258872-49258894 GAGGCACATGCCACCATGCCTGG + Intergenic
1149006052 17:51806569-51806591 CTAGCACTTGGCACTATGCCTGG + Intronic
1149375874 17:56043375-56043397 GAAGCACTTAGAACAGAGCCTGG - Intergenic
1149702578 17:58667740-58667762 CAGGCACTTGCCACCATGCCCGG - Intronic
1149704412 17:58682398-58682420 CAAGCACATGCCACCATGCCCGG + Intronic
1149707808 17:58711601-58711623 GAGGCACATGCCACCATGCCCGG + Intronic
1149819468 17:59761043-59761065 TAGGCACTTGCCACCATGCCCGG + Intronic
1149912911 17:60582644-60582666 CAGGCACTTGCCACCATGCCTGG + Intronic
1150036936 17:61811807-61811829 GAGGCACATGCCACCATGCCTGG - Intronic
1150097531 17:62390586-62390608 AAAGCACTTGGAGCAATACCTGG + Intronic
1150419988 17:65025037-65025059 CAGGCACTTGCTACCATGCCTGG + Intronic
1150506439 17:65703366-65703388 TAGGCACCTGCAACCATGCCTGG - Intronic
1150511077 17:65753742-65753764 AAAGCACTTAGAACAGTGCCTGG - Intronic
1150556751 17:66261593-66261615 AAAGCACTTAGCACGATGCCTGG - Intergenic
1150569670 17:66374868-66374890 CAGGCACTTGCCACCATGCCTGG + Intronic
1150721658 17:67618914-67618936 CAAGCACCTGCCACCATGCCCGG - Intronic
1150932004 17:69595356-69595378 GAAGCACCTTGCACAATGCCTGG - Intergenic
1150972875 17:70049774-70049796 CAAGCACATGCGACCATGCCCGG - Intergenic
1151324213 17:73368867-73368889 CAGGCACTTGCCACCATGCCCGG - Intronic
1151353869 17:73547007-73547029 GAAGCACCTGGATCAGTGCCTGG - Intronic
1151474325 17:74337172-74337194 CAAGCCCTTGGCACCATGCCTGG + Intronic
1151777701 17:76218500-76218522 CAAGCACATGCCACCATGCCTGG - Intronic
1151794727 17:76336293-76336315 CAGGCACCTGCAACCATGCCCGG - Intronic
1151813121 17:76456764-76456786 GAAGTACCTGGTACAATGCCTGG - Intronic
1151825341 17:76520916-76520938 TAGGCACGTGGCACCATGCCCGG - Intergenic
1152805079 17:82351873-82351895 GAAGAACTGAGAACCATGGCTGG - Intergenic
1152827444 17:82476282-82476304 CAGGCACTTGCCACCATGCCCGG + Intronic
1153203220 18:2668323-2668345 TAAGTACTTGGTACAATGCCTGG - Intronic
1153336232 18:3928556-3928578 GAAGCACTTGGAACCATGCCTGG - Intronic
1153342258 18:3987509-3987531 AAAGCACTTGGAACGATGCCTGG - Intronic
1153393563 18:4591513-4591535 CAGGCACTTGCCACCATGCCTGG - Intergenic
1153409650 18:4779285-4779307 CAAGCACTTGCCATCATGCCAGG - Intergenic
1153456852 18:5292430-5292452 AAAGCACATAGAACAATGCCTGG - Intronic
1153462373 18:5350550-5350572 CAAGCACATGCCACCATGCCTGG + Intergenic
1153602807 18:6798334-6798356 CAAGCACCTGCCACCATGCCCGG + Intronic
1153806583 18:8713798-8713820 CAAGCACATGCCACCATGCCTGG - Intronic
1153840423 18:9002568-9002590 CAAGCACGTGTCACCATGCCTGG - Intergenic
1153873136 18:9339421-9339443 CAGGCACGTGGCACCATGCCTGG + Intronic
1153880125 18:9415172-9415194 CAAGCACGTGCCACCATGCCTGG + Intergenic
1153900233 18:9612169-9612191 GAAGCACTTGGAACAATTCCTGG - Intronic
1154972765 18:21427360-21427382 CAAGCACATGCCACCATGCCCGG - Intronic
1154999605 18:21673746-21673768 GAGGCACCTGCCACCATGCCTGG + Intronic
1155038686 18:22046761-22046783 GAAGCACTGAGAACAGTGCCTGG - Intergenic
1155215160 18:23636714-23636736 CAGGCACATGCAACCATGCCTGG + Intronic
1155290642 18:24338213-24338235 CAAGCACTTGCCACCATGCCTGG + Intronic
1155297167 18:24396074-24396096 CAAGCACATGCCACCATGCCCGG - Intronic
1155334035 18:24746898-24746920 CTAGCACCTGGAACCGTGCCTGG - Intergenic
1155452227 18:25975426-25975448 GAGGCACTCGCCACCATGCCTGG + Intergenic
1155530936 18:26765758-26765780 GAAGGACTTGGAACAGTGCTTGG - Intergenic
1155983081 18:32200957-32200979 GCTCCACTTGGAACCATGCCAGG - Intronic
1156232325 18:35165699-35165721 CAAGCACCTGCAACCATGCCTGG - Intergenic
1156233200 18:35174972-35174994 GAAACACTTAGAACAGTGCCTGG - Intergenic
1156319022 18:36000673-36000695 GGAGCACTTGGAACAATGTTTGG - Intronic
1156332781 18:36140268-36140290 CAAGCACATGCCACCATGCCTGG + Intronic
1156345509 18:36253521-36253543 CAGGCACTTGCCACCATGCCCGG - Intronic
1156470011 18:37371577-37371599 GAAGCCCTTTGAGCAATGCCAGG + Intronic
1156621744 18:38860229-38860251 CAGGCACCTGCAACCATGCCCGG + Intergenic
1157353422 18:46911906-46911928 CAGGCACCTGCAACCATGCCTGG - Intronic
1157413007 18:47479599-47479621 GAAGTGCTTGGCACCATGCTTGG + Intergenic
1157548143 18:48562180-48562202 AAAGCACTTGGTACAGTGCCAGG - Intronic
1157656466 18:49394322-49394344 AAAGCACTTAGAACAGTGCCTGG + Intronic
1157656991 18:49400081-49400103 CAAGCACTTGCCACCACGCCTGG + Intronic
1157946290 18:51984369-51984391 GAAGCACATGGACCCATGAAGGG + Intergenic
1158397188 18:57088507-57088529 GAGGCACCTGCCACCATGCCTGG - Intergenic
1158618143 18:59006367-59006389 CAAGCACCTGCCACCATGCCTGG - Intergenic
1159003072 18:62990232-62990254 TAGGCACGTGGCACCATGCCCGG + Intergenic
1160037755 18:75317197-75317219 GAAGCACTTGGGGCCAGGGCTGG - Intergenic
1160203097 18:76811229-76811251 AAAGCACTTGCCACCACGCCTGG + Intronic
1160298115 18:77656026-77656048 AAAGCACGTGCCACCATGCCTGG + Intergenic
1160413019 18:78687766-78687788 CAACCACTCGGAAACATGCCTGG + Intergenic
1161109213 19:2459877-2459899 CAGGCACTTGCCACCATGCCCGG + Intergenic
1161193203 19:2971090-2971112 TAGGCACTTGCCACCATGCCCGG - Intergenic
1161540264 19:4846554-4846576 CAGGCACTTGCCACCATGCCTGG - Intronic
1161623626 19:5312739-5312761 AAAAGACTTTGAACCATGCCTGG - Intronic
1161799321 19:6407359-6407381 TAAGCATGTGGCACCATGCCCGG + Intergenic
1162353397 19:10165533-10165555 GAGGCACATGCCACCATGCCCGG + Intronic
1162358394 19:10201763-10201785 CAGGCACTTGCCACCATGCCCGG + Intronic
1162406292 19:10476318-10476340 GAAGCATCTGCCACCATGCCAGG + Intergenic
1162533617 19:11250455-11250477 CAAGCACCTGCCACCATGCCTGG + Intronic
1162844974 19:13385370-13385392 CAGGCACTTGCCACCATGCCTGG + Intronic
1163013218 19:14438525-14438547 CAAGCACGTGCCACCATGCCTGG + Intronic
1163024080 19:14499600-14499622 GAAGTTCTTGGAATGATGCCTGG - Intergenic
1163479515 19:17546670-17546692 GCAGCTCCTGGAACCATGGCGGG - Exonic
1163487751 19:17598810-17598832 CAAGCACTTGCCACCATGCCCGG + Intergenic
1163796319 19:19340188-19340210 CAGGCACCTGGCACCATGCCTGG - Intronic
1163994311 19:21028826-21028848 CAGGCACTTGCCACCATGCCTGG + Intronic
1164536819 19:29092287-29092309 CAAGCACGTGCCACCATGCCTGG + Intergenic
1164829659 19:31310814-31310836 AAAGCACTTAGCACCATGCCTGG + Intronic
1164964410 19:32469356-32469378 GAGGCACCTGCCACCATGCCTGG - Intronic
1164985873 19:32648121-32648143 CAAGCACTCGCCACCATGCCCGG - Intronic
1165103317 19:33453169-33453191 GAAGCACGTGCCACCATGCCTGG - Intronic
1165286856 19:34849865-34849887 TAGGCACATGGCACCATGCCCGG + Intergenic
1165478870 19:36049689-36049711 AAAGCACTTAGAACAGTGCCTGG + Intronic
1165507375 19:36242580-36242602 GAGGCACGTGCCACCATGCCTGG - Intronic
1165584694 19:36903746-36903768 GAGGCACCTGCCACCATGCCCGG - Intronic
1165602955 19:37073596-37073618 GAGGCACCTGTCACCATGCCCGG - Intronic
1166102521 19:40579257-40579279 CAAGCACTCGCCACCATGCCCGG + Intronic
1166164093 19:40974656-40974678 AAAGCACTTAGAACAATGGCTGG + Intergenic
1166186748 19:41144680-41144702 AAAGCACTTAGAACAATGGCTGG - Intergenic
1166712760 19:44947924-44947946 CAAGCACCTGCCACCATGCCCGG - Intronic
1167086617 19:47314267-47314289 GAAGCACATGGAATAGTGCCGGG + Intronic
1167308572 19:48722840-48722862 AAAGTACTTGGAACACTGCCTGG + Intronic
1167444881 19:49531770-49531792 AAAGCACTTAGGACAATGCCTGG - Intronic
1167548678 19:50144608-50144630 CAAGCACCTGCCACCATGCCTGG + Intergenic
1167561684 19:50229841-50229863 GAAGCACCCTGAACAATGCCTGG - Intronic
1167632878 19:50636789-50636811 GAAGAACTTAGAACAATGCTGGG - Intronic
1167637442 19:50662989-50663011 AAAGCACTTAGAACAATGCCTGG - Intronic
1167683776 19:50942779-50942801 CCAGCACATGGAACCATTCCTGG + Intergenic
1167684184 19:50945396-50945418 ACAGCACCTGGAACCATTCCTGG + Intronic
1167739603 19:51316634-51316656 CAAGCACATGCCACCATGCCCGG + Intronic
1167747739 19:51362605-51362627 TAAGCCCTTGGAACAGTGCCTGG - Intronic
1167809487 19:51815922-51815944 TAGGTACCTGGAACCATGCCTGG - Intronic
1167879650 19:52445337-52445359 CAAGCACATGCCACCATGCCTGG + Intronic
1168043067 19:53774388-53774410 TAGGCACTTGCCACCATGCCCGG - Intergenic
1168223097 19:54975261-54975283 CAGGCACTTGCCACCATGCCTGG + Intronic
1168263833 19:55210274-55210296 GAAAGTCTTGGAACAATGCCTGG + Intergenic
1168531848 19:57136519-57136541 CAGGCACTTGCCACCATGCCCGG - Intronic
1168548913 19:57277394-57277416 CAGGCGCTTGCAACCATGCCCGG - Intergenic
1168619891 19:57869800-57869822 GAAGCATGTGCCACCATGCCCGG - Intronic
1168652946 19:58104557-58104579 CAGGCACTTGCCACCATGCCTGG - Intronic
924999289 2:392343-392365 GAAGCTCTTGGCATCATGCGTGG + Intergenic
925012847 2:498643-498665 GAAGACCTGGAAACCATGCCAGG + Intergenic
925667239 2:6272296-6272318 TAAGCACGTGCCACCATGCCTGG - Intergenic
926026101 2:9545953-9545975 CAAGCACATGCCACCATGCCTGG - Intronic
926331729 2:11831296-11831318 CAGGCACGTGGCACCATGCCTGG - Intergenic
926716652 2:15929396-15929418 CAAGCACCTGCCACCATGCCCGG - Intergenic
926849538 2:17179951-17179973 CAGGCACCTGGCACCATGCCCGG + Intergenic
926944432 2:18171403-18171425 GAAGCACTTGAAACAATGCCTGG + Intronic
927093569 2:19730386-19730408 AAAGCACTTAGAACAATGACTGG - Intergenic
927507300 2:23622792-23622814 AAAGGACTTAGAACCATGCCTGG - Intronic
927641528 2:24848648-24848670 CAAGCACTTAGAACAGTGCCTGG + Intronic
927749177 2:25651181-25651203 AAAGCACTTGGCACAGTGCCTGG - Intronic
927850276 2:26494518-26494540 GAAGCATTTAGGAGCATGCCTGG + Intronic
928123956 2:28603454-28603476 AAAGCACTTGAAACAATGCCTGG - Intronic
928311499 2:30214351-30214373 AAAGTACTTGGGACAATGCCTGG - Intergenic
928555244 2:32416976-32416998 CAGGCACGTGGCACCATGCCCGG + Intronic
928561377 2:32490093-32490115 GAAGCACAAGGCACCATGTCCGG - Exonic
928641405 2:33303490-33303512 CAAGCACCTGCCACCATGCCCGG + Intronic
928656447 2:33456879-33456901 AAAGCACTTAGCACAATGCCTGG - Intronic
929049438 2:37823456-37823478 GAGGCACATGCCACCATGCCCGG + Intergenic
929173559 2:38955640-38955662 CAGGCACTTGCCACCATGCCTGG + Intronic
929626174 2:43409872-43409894 CAAGCACATGCCACCATGCCTGG - Intronic
929732358 2:44509450-44509472 CAAGCACATGCCACCATGCCTGG + Intronic
929845555 2:45521823-45521845 GAGGCACGTGCCACCATGCCTGG - Intronic
929870879 2:45758292-45758314 AAAGTATTTAGAACCATGCCTGG + Intronic
930075062 2:47399793-47399815 GAATCACTTGAAACCAGGGCGGG + Intergenic
930108923 2:47661668-47661690 GAGGCACGTGCCACCATGCCTGG + Intergenic
930164744 2:48194060-48194082 CAAGCATTTAGAACAATGCCTGG - Intergenic
930232556 2:48857833-48857855 GAAGCACCTAGAACAGTGCCAGG + Intergenic
930434375 2:51321886-51321908 GAAGCACTTAGAACAGTCCCTGG - Intergenic
930436305 2:51348037-51348059 CAGGCACTTGCCACCATGCCAGG - Intergenic
930828649 2:55719419-55719441 CAAGCACTTGCCATCATGCCTGG - Intergenic
931051455 2:58419597-58419619 GAAGCACTTTGAACAGTTCCTGG - Intergenic
931079796 2:58755767-58755789 GAAGTGGTTAGAACCATGCCTGG + Intergenic
931096676 2:58948324-58948346 CAAGCACCTGCCACCATGCCAGG + Intergenic
931550722 2:63443151-63443173 TCAGCACTTGGAACAGTGCCTGG - Intronic
931778172 2:65557438-65557460 CAGGCACTTGTCACCATGCCAGG + Intergenic
931845725 2:66201894-66201916 GAGGCACGTGCTACCATGCCTGG + Intergenic
931878363 2:66539653-66539675 GAAGCATTTGGAACAGCGCCTGG + Intronic
932137173 2:69241846-69241868 GAAGGGCTTGGAACAGTGCCTGG - Intronic
932181555 2:69651226-69651248 TAGGCACATGGAACCATGCCTGG - Intronic
932275387 2:70448135-70448157 GACACACGTGGAACCAAGCCAGG - Exonic
932376149 2:71237831-71237853 CAAGCATGTGGCACCATGCCTGG - Intergenic
932399628 2:71470932-71470954 CAGGCACCTGCAACCATGCCTGG + Intronic
932587735 2:73042647-73042669 CAGGCACTCGGCACCATGCCTGG - Intronic
932670414 2:73733120-73733142 AAAGCACTTGGAACAATGCTAGG + Intronic
933696051 2:85218396-85218418 TAAGCACATGCCACCATGCCTGG + Intronic
933721386 2:85399630-85399652 TAAGCACTTGCCACCATGCCTGG + Intronic
933765932 2:85709814-85709836 GAAGCATTTGGAACAGTGCCTGG - Intergenic
933804762 2:85990176-85990198 CAAGCACCTGCCACCATGCCCGG + Intergenic
933873137 2:86589716-86589738 CAAGCACATGCCACCATGCCTGG + Intronic
934958728 2:98648355-98648377 CAGGCACTTGGCACCAGGCCTGG - Intronic
935163897 2:100552928-100552950 CAGGCACTTGCCACCATGCCTGG + Intergenic
935340137 2:102052397-102052419 TAAGCACCTAGAACAATGCCAGG + Intergenic
935615362 2:105074522-105074544 GAAGCACTTAGAACTATGCCTGG - Intronic
935685205 2:105676993-105677015 CAGGCACATGGCACCATGCCTGG + Intergenic
936035255 2:109105994-109106016 CAAGCACGTGCCACCATGCCCGG + Intergenic
936097199 2:109539584-109539606 CAAGCACGTGCCACCATGCCAGG + Intergenic
936100320 2:109572045-109572067 GAAGCATTTAGTACAATGCCTGG - Intronic
936286691 2:111186709-111186731 GAAGCAGAGGGAACCATGCTAGG - Intergenic
936684736 2:114814812-114814834 GAAGGACTGAGAACCATGACAGG - Intronic
936737378 2:115462870-115462892 GAAGCACATGCCACCATGCCCGG + Intronic
936832629 2:116667164-116667186 CAGGCACTTGCCACCATGCCTGG + Intergenic
937159012 2:119742505-119742527 GAAGCACATACTACCATGCCTGG + Intergenic
937742505 2:125373256-125373278 AAAGTACTTGGAATAATGCCTGG - Intergenic
938369440 2:130760195-130760217 GAAGAAGTAGGCACCATGCCAGG - Intronic
938606955 2:132904143-132904165 CAAGCACTCGCCACCATGCCTGG - Intronic
938733248 2:134162758-134162780 GAAGCACTTAGCATCATGTCTGG - Intronic
938736144 2:134188493-134188515 GAAGGTCTTAGAACCATGTCTGG + Intronic
938868487 2:135449677-135449699 AAAGCACTTGGCACAGTGCCTGG - Intronic
938929090 2:136070372-136070394 CAAGCACGTGCCACCATGCCCGG - Intergenic
938986853 2:136584905-136584927 GAAGCACTTAGCACAATGACTGG + Intergenic
939199492 2:139017019-139017041 GAGGCACGTGCCACCATGCCTGG - Intergenic
939435258 2:142167886-142167908 GAAAAACTTGGAACAGTGCCTGG - Intergenic
939495197 2:142919927-142919949 CAGGCACTTGCCACCATGCCAGG - Intronic
939536656 2:143439571-143439593 CAAGCACTTGGAACAGTGCCTGG - Intronic
939572065 2:143852268-143852290 GAAGCCTTTAGAACCGTGCCTGG + Intergenic
940213013 2:151275123-151275145 CAGGCACTTGCCACCATGCCTGG + Intronic
940509739 2:154598350-154598372 TAGGCACTTGTCACCATGCCTGG + Intergenic
940539032 2:154986948-154986970 AAAGCACTTAGAACAATGCCTGG + Intergenic
940573033 2:155465833-155465855 CAGGCACTTGCCACCATGCCTGG + Intergenic
940651824 2:156448248-156448270 CAAGCACCTGCCACCATGCCCGG + Intronic
940835504 2:158516802-158516824 CAGGCACTTGCCACCATGCCTGG + Intronic
940880512 2:158942434-158942456 CAGGCACATGGCACCATGCCTGG - Intergenic
941299087 2:163778457-163778479 GCAGCACTTGGAACAGTGCCTGG + Intergenic
941466256 2:165831070-165831092 AAAGCACTTGGAACGACTCCTGG - Intergenic
941476722 2:165958498-165958520 GCAGCACTTGGAACCAGTCAAGG - Intergenic
941954717 2:171192535-171192557 CAGGCACGTGCAACCATGCCCGG - Intronic
942276015 2:174324560-174324582 AAAGCACTTGGCAGAATGCCTGG + Intergenic
942342358 2:174961446-174961468 CAGGCACCTGCAACCATGCCCGG - Intronic
942397997 2:175572530-175572552 GAAGCACTTAGCACAATTCCAGG + Intergenic
942531826 2:176918595-176918617 CAGGCACTTGCCACCATGCCTGG - Intergenic
942599817 2:177629275-177629297 GATGCACTGGGAAGCATGCCTGG - Exonic
942783236 2:179671046-179671068 GAAGCACTTGCAACAGTGACTGG + Intronic
943243599 2:185419247-185419269 CAGGCACTTGCTACCATGCCCGG + Intergenic
943553384 2:189370009-189370031 AAAGCACATAGAACAATGCCTGG - Intergenic
943746958 2:191472067-191472089 AAAGTACTTGGAACAGTGCCAGG - Intergenic
944108795 2:196108676-196108698 CAAGCACTTAGAACAATGCTTGG + Intergenic
944241387 2:197488723-197488745 CAGGCACTTGCCACCATGCCTGG - Intronic
944468597 2:200029369-200029391 GAACCACGTGGAAGCATCCCAGG - Intergenic
944513049 2:200483548-200483570 AAAGCATTTGGAATAATGCCTGG + Intergenic
944712590 2:202348377-202348399 GAAGTACTTAGAACAATACCTGG + Intergenic
944910547 2:204306465-204306487 GAGGCACCTGCCACCATGCCCGG + Intergenic
945146998 2:206748663-206748685 GAAGCAGGTGGAACCAGGACAGG - Intronic
945244276 2:207703605-207703627 CAGGCACCTGCAACCATGCCTGG - Intergenic
945359125 2:208874969-208874991 AAAGCTCTTGGAACAATGTCTGG - Intergenic
945665769 2:212740150-212740172 TAAGCACGTGCCACCATGCCTGG + Intergenic
945709839 2:213282126-213282148 AAAGCACTTATAACCATGTCTGG - Intergenic
946035568 2:216739644-216739666 GAAGCACTTAGGACAGTGCCTGG - Intergenic
946849339 2:223889848-223889870 GAAACACTTGGCACATTGCCTGG - Intronic
947409202 2:229817735-229817757 CAGGCACCTGCAACCATGCCCGG + Intronic
947420156 2:229934795-229934817 CAGGCACTTGCAACCATGCCCGG + Intronic
947685641 2:232081930-232081952 CAAGCACATGCCACCATGCCTGG + Intronic
947759666 2:232594674-232594696 CAAGCACATGCCACCATGCCTGG + Intergenic
947813142 2:233017222-233017244 AAAGCACTTAGAACAGTGCCTGG - Intergenic
947954479 2:234176570-234176592 CAAGCACGTGCCACCATGCCTGG + Intergenic
948131356 2:235602842-235602864 CAAGCACTTGCCACCACGCCTGG + Intronic
948399204 2:237670834-237670856 CAAGCACATGGAAGCGTGCCAGG + Intronic
948533021 2:238625337-238625359 GAGGCACCTGCCACCATGCCCGG + Intergenic
948974502 2:241455880-241455902 CAAGCACCTGCCACCATGCCCGG + Intronic
949066257 2:241992404-241992426 CAAGCACATGCCACCATGCCTGG + Intergenic
1168770382 20:410701-410723 GAAACACTTTGCACAATGCCTGG + Intronic
1168802044 20:649903-649925 AAAGCACTTCAAACCATGCTTGG + Intronic
1169026591 20:2376680-2376702 AAAGCACTTAGAACACTGCCTGG - Intergenic
1169177449 20:3530404-3530426 TAGGCACTTGCCACCATGCCTGG + Intronic
1169391536 20:5195157-5195179 TAAGCATTTAGTACCATGCCTGG + Exonic
1169457686 20:5766659-5766681 GAAGCTCTTAGCACAATGCCTGG + Intronic
1169566068 20:6854940-6854962 CAGGCACTTGCCACCATGCCCGG + Intergenic
1169688561 20:8304735-8304757 GGAGCACTTAGAACACTGCCTGG - Intronic
1169877096 20:10309938-10309960 GAAGCACTTAGCACAATGCCTGG - Intergenic
1170094475 20:12630769-12630791 GAAGCATCTTGCACCATGCCTGG + Intergenic
1170234991 20:14093220-14093242 CAAGCACGTGCCACCATGCCTGG + Intronic
1170344375 20:15367168-15367190 CAAGCACGTGCCACCATGCCCGG + Intronic
1170573568 20:17646577-17646599 AACGTGCTTGGAACCATGCCTGG + Intronic
1170606049 20:17875779-17875801 TAGGCACTTGCCACCATGCCAGG + Intergenic
1170671463 20:18438074-18438096 GAAGCACCTGCCACCATGCCTGG - Intronic
1170829995 20:19832017-19832039 GAAGCCCTTGGAACACTGCCAGG - Intergenic
1170971246 20:21118564-21118586 GATGCACTTGGAATCATGCCTGG - Intergenic
1171988326 20:31676238-31676260 GAAGCACTTAGCACCATGCCTGG - Intronic
1171993164 20:31712423-31712445 AAAGCACTTTGAACAATGGCTGG + Intronic
1172068875 20:32241655-32241677 TAGGCACTTGCCACCATGCCTGG - Intergenic
1172081369 20:32343655-32343677 GAAGCATTGGGAACAGTGCCTGG + Intergenic
1172255982 20:33518089-33518111 CAGGCACGTGCAACCATGCCTGG + Intronic
1172263355 20:33588802-33588824 CAGGCACTTGCCACCATGCCTGG - Intronic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
1172681103 20:36715969-36715991 GTAGCTCTTGCCACCATGCCTGG - Intronic
1172705613 20:36880234-36880256 CAAGCACTTGCCACCACGCCCGG + Intronic
1172714512 20:36952653-36952675 AAAGCCCTTAGAACCGTGCCTGG - Intergenic
1172816435 20:37690808-37690830 AAAGCACTTGGCACAGTGCCTGG - Intergenic
1172840428 20:37899942-37899964 AAAGCACTTAGAACAATGCCAGG - Intergenic
1173099658 20:40073860-40073882 GAAGCACTTGGAATGTTGGCAGG - Intergenic
1173297069 20:41769203-41769225 AAAGCACTTGGCTCCATGCCTGG + Intergenic
1173458970 20:43226561-43226583 GAAGCCCTTGGAACAAAGCCTGG - Intergenic
1173585337 20:44177897-44177919 GAAGCACTGAGCATCATGCCTGG - Intronic
1173692032 20:44967879-44967901 AAAGCACTTAGAACAGTGCCTGG - Intronic
1173890592 20:46506484-46506506 GTAGCACATGCCACCATGCCTGG - Intronic
1173899129 20:46574181-46574203 GAAGCACTTCAAACAATGGCTGG + Intronic
1173899475 20:46576644-46576666 GACACACTTAGACCCATGCCTGG + Intronic
1174109827 20:48191211-48191233 AATGCACTTGGAACTGTGCCTGG - Intergenic
1174109872 20:48191580-48191602 AAAGCACTTAGCACAATGCCAGG - Intergenic
1174146072 20:48453563-48453585 CTAGTACCTGGAACCATGCCTGG + Intergenic
1174195767 20:48771747-48771769 AAAGCACTTGGAACCGTGTCCGG - Intronic
1174280828 20:49437958-49437980 AAAGCACTTAGAACAGTGCCTGG + Intronic
1174323065 20:49757592-49757614 GAGGCACTTGGAACATTGCCGGG - Intergenic
1174423673 20:50416979-50417001 GAAGCGCTCAGAAGCATGCCTGG - Intergenic
1174430257 20:50463106-50463128 TAGGCACTTGCCACCATGCCTGG + Intergenic
1174480183 20:50825732-50825754 CAAGCACCTGCCACCATGCCTGG - Intronic
1174642673 20:52058153-52058175 CAAGCACGTGCCACCATGCCTGG + Intronic
1174810624 20:53642398-53642420 CAAGCACATGACACCATGCCCGG + Intergenic
1175043504 20:56079005-56079027 GAAGCATTTAGAACAATGCCTGG + Intergenic
1175080800 20:56418836-56418858 GAAGCATTTAGAACAGTGCCTGG - Intronic
1175228277 20:57457952-57457974 GGAGCACTTAGAACAATGCCTGG - Intergenic
1175332814 20:58176664-58176686 AAAGCACTTAGAGCAATGCCTGG - Intergenic
1175565302 20:59970665-59970687 CAGGCACCTGCAACCATGCCTGG - Intronic
1175579239 20:60086439-60086461 AAAGAACATGGAACCAGGCCTGG - Intergenic
1175880262 20:62253932-62253954 TAGGCACTTGTCACCATGCCTGG + Intronic
1176340888 21:5694785-5694807 GAAAAACTTAGAAACATGCCAGG - Intergenic
1176473142 21:7126938-7126960 GAAAAACTTAGAAACATGCCAGG - Intergenic
1176503939 21:7629671-7629693 GAAAAACTTAGAAACATGCCAGG + Intergenic
1176613528 21:9008576-9008598 GCAGCCCTTTGAACCAAGCCTGG - Intergenic
1176696290 21:9981444-9981466 AAAGCACCTGCCACCATGCCTGG + Intergenic
1176813588 21:13572623-13572645 CAGGCACCTGCAACCATGCCCGG - Intergenic
1177017068 21:15804708-15804730 CAAGCACTTAGAACAGTGCCTGG + Intronic
1177068366 21:16468589-16468611 TAGGCACATGGCACCATGCCTGG - Intergenic
1177110912 21:17027223-17027245 GAAGCACTTGGAACCAGGCTTGG + Intergenic
1177267367 21:18801909-18801931 CAGGCACTTGTCACCATGCCTGG + Intergenic
1177474875 21:21607167-21607189 GAGGCACATGCCACCATGCCCGG + Intergenic
1178107059 21:29331799-29331821 GAAGAACTTAGAACAATGCCTGG + Intronic
1178431615 21:32522780-32522802 CAGGCACCTGGCACCATGCCAGG - Intergenic
1178499097 21:33110923-33110945 AAAGGACTTAGAACCCTGCCTGG - Intergenic
1179166684 21:38940800-38940822 GAAGCACTTAGAATAGTGCCTGG - Intergenic
1179232547 21:39518230-39518252 CAAGCACACGCAACCATGCCTGG - Intergenic
1179286853 21:39984940-39984962 AAAGCACTTGGTATGATGCCTGG - Intergenic
1179660668 21:42872792-42872814 CAGGCACTTGCCACCATGCCCGG - Intronic
1179834633 21:44022249-44022271 CAGGCACATGGCACCATGCCTGG + Intronic
1180208433 21:46278006-46278028 GAGGCACATGCCACCATGCCCGG - Intronic
1180430188 22:15241714-15241736 CAGGCACTTGCCACCATGCCTGG - Intergenic
1180684805 22:17657652-17657674 GAGGCACGTGCCACCATGCCTGG + Intronic
1180712420 22:17848402-17848424 GAAACATTCGGAACCATGTCTGG + Intronic
1180845401 22:18978545-18978567 GAAGCACTTAGAACGGTGCCTGG + Intergenic
1180926164 22:19556396-19556418 GCATCCCTGGGAACCATGCCTGG - Intergenic
1181005524 22:20011598-20011620 GAAGAACTGGGGACCAAGCCAGG + Intronic
1181292638 22:21808888-21808910 TAGGCACTTGCCACCATGCCTGG - Intronic
1181674585 22:24443481-24443503 CAGGCACTTGCCACCATGCCTGG + Intergenic
1181742836 22:24935093-24935115 AAAGCACTTTGCACCATGTCTGG - Exonic
1182196735 22:28526897-28526919 CAAGCACTTGCCACCATGCCTGG + Intronic
1182214082 22:28701352-28701374 CAAGCACATGCCACCATGCCTGG + Intronic
1182877155 22:33702112-33702134 AAAGCACTAGGAACAATGCTTGG + Intronic
1182927266 22:34137259-34137281 GAGGCACCTGCCACCATGCCTGG + Intergenic
1182948400 22:34347576-34347598 CAAGCACCTGCCACCATGCCTGG + Intergenic
1183009535 22:34933356-34933378 GGAGCACTTAGAACAGTGCCTGG - Intergenic
1183030354 22:35099325-35099347 CTAGCACTTGGAACAAGGCCTGG - Intergenic
1183055235 22:35300855-35300877 GAAATACTTAGAACAATGCCTGG + Intronic
1183146412 22:35996460-35996482 CAGGCACTTGCCACCATGCCTGG - Intronic
1183147245 22:36004651-36004673 CAGGCACTTGCCACCATGCCTGG - Intronic
1183204837 22:36411642-36411664 AAAGCACTTGGCACAAAGCCAGG + Intergenic
1183340404 22:37277314-37277336 CAAGCACCTGCAACCACGCCTGG - Intergenic
1183366771 22:37411056-37411078 GAAGCACTTGGTGCTACGCCTGG - Intronic
1183451835 22:37900477-37900499 CAGGCATTTGCAACCATGCCTGG + Intergenic
1183559740 22:38562908-38562930 CAGGCACTTGCCACCATGCCCGG + Intronic
1183837899 22:40471727-40471749 CAGGCACTTGCCACCATGCCTGG - Intronic
1183863247 22:40684407-40684429 CAAGCACGTGCCACCATGCCTGG - Intergenic
1183944840 22:41319425-41319447 TAAGCACTTGCCACTATGCCCGG - Intronic
1184223054 22:43112760-43112782 GAGGCACATGCCACCATGCCCGG - Intronic
1184830220 22:46981269-46981291 GAAGCACTCAGGACCATGTCAGG - Intronic
1184961501 22:47932652-47932674 CAGGCACTTGCCACCATGCCTGG - Intergenic
1203240155 22_KI270733v1_random:9243-9265 GAAAAACTTAGAAACATGCCAGG - Intergenic
949348179 3:3096871-3096893 AAAGCACTTAGAACAGTGCCTGG - Intronic
949385736 3:3500477-3500499 GAAGCACTCAGAAAAATGCCTGG - Intergenic
949566105 3:5246212-5246234 GAAGCAGTTGCAACCCTTCCTGG + Intergenic
949691702 3:6647981-6648003 TCAGCACTTAGAACTATGCCTGG - Intergenic
949807071 3:7967082-7967104 AAAGCATTTAGAACAATGCCTGG + Intergenic
949865389 3:8542874-8542896 GAAGCACTTGGAAGAGTGCCTGG + Intronic
949959444 3:9300090-9300112 GAAATACTTGGAACAATGTCTGG + Intronic
950242421 3:11383589-11383611 CAGGCACTTGCCACCATGCCTGG + Intronic
950427521 3:12932484-12932506 CAGGCCCTGGGAACCATGCCTGG + Intronic
950500599 3:13361219-13361241 GTGGCACCTAGAACCATGCCTGG + Intronic
950560136 3:13716475-13716497 GAAGTACTTAGAAGCGTGCCTGG - Intergenic
950762821 3:15248848-15248870 AAAGCACATGCCACCATGCCTGG - Intronic
950849360 3:16048157-16048179 GAAGAACTTAGGACAATGCCTGG - Intergenic
950873449 3:16249156-16249178 AAAGCACTTAGAACAAGGCCTGG - Intergenic
950938867 3:16873243-16873265 GAAGCTCTTGAAATCGTGCCTGG + Intronic
951041187 3:17990326-17990348 AAAGCACTTGGAACAGTGCCTGG + Intronic
951347743 3:21566485-21566507 CAAGCACCTGCCACCATGCCTGG - Intronic
951440938 3:22722790-22722812 GAACCACCTGTAACAATGCCTGG + Intergenic
951466674 3:23007776-23007798 AAAGCACTTGGAACTCTGCCTGG + Intergenic
951547055 3:23837150-23837172 AAAGCACTTGGAACAGTGCCTGG + Intronic
951609001 3:24470509-24470531 AAAGTACTTGGAACGGTGCCTGG + Intronic
951609033 3:24470757-24470779 CAGGCACTTGCCACCATGCCCGG + Intronic
951730222 3:25802283-25802305 GAGGCACTTGAAACAATGCCTGG - Intergenic
951866428 3:27313852-27313874 TAGGCACCTGGCACCATGCCTGG + Intronic
951882792 3:27495876-27495898 TAGGCACTTGCCACCATGCCCGG - Intergenic
952418257 3:33108846-33108868 CAGGCACATGGCACCATGCCCGG + Intergenic
952676557 3:36037814-36037836 CAGGCACATGCAACCATGCCTGG - Intergenic
952771956 3:37009943-37009965 CAGGCACTTGCCACCATGCCCGG + Intronic
952784770 3:37142279-37142301 CAAGCACGTGTCACCATGCCTGG + Intronic
953100129 3:39816526-39816548 GAAGCACTCTGAACAGTGCCTGG + Intronic
953160082 3:40410955-40410977 GAGGCAATGGGAACCATGACTGG + Intronic
953313412 3:41902890-41902912 AAAGCACTTAAAACAATGCCTGG + Intronic
953340607 3:42131271-42131293 GAGGCACTGGGAGCCAAGCCAGG - Intronic
953669841 3:44953044-44953066 AAAGCATTTGGAACTATGCCTGG - Intronic
953710475 3:45265533-45265555 GATGCTCTTGGGACCAGGCCTGG - Intergenic
953824805 3:46241988-46242010 GAGGCACATGCCACCATGCCTGG - Intronic
954057250 3:48037535-48037557 CAAGCACATGCCACCATGCCTGG + Intronic
954126571 3:48534526-48534548 CAGGCACTTGCCACCATGCCAGG - Intronic
954191220 3:48963009-48963031 CCAGCACTTGCCACCATGCCTGG + Intronic
954319318 3:49820621-49820643 CAGGCACTTGCTACCATGCCCGG - Intergenic
954620353 3:51991886-51991908 CAGGCACATGGCACCATGCCTGG - Intergenic
954729642 3:52648750-52648772 GAAGCACTTAGAACTGTGCTTGG - Intronic
954815329 3:53275986-53276008 CAAGCACATGCCACCATGCCTGG - Intergenic
954947025 3:54434776-54434798 GAAACACTTGGAAACTGGCCTGG - Intronic
955328222 3:58025988-58026010 AAAGCTCTTGGCACCGTGCCTGG + Intronic
955402912 3:58606236-58606258 CAAGCACCTGCCACCATGCCTGG + Intronic
955788816 3:62567471-62567493 GAATCACTTGGGAGCATGCCTGG - Intronic
955810096 3:62779028-62779050 CAAGCACATGCCACCATGCCTGG + Intronic
955856095 3:63275747-63275769 AAAGCACTTAGCACAATGCCTGG + Intronic
956245251 3:67175672-67175694 TAAGCACCTGCCACCATGCCTGG + Intergenic
956251152 3:67235670-67235692 TAAGCACTTAGAACAAAGCCTGG + Intergenic
956256893 3:67292649-67292671 AAAGCACCTGGCACAATGCCTGG - Intergenic
956351747 3:68344756-68344778 AAAGCACTTAGCACAATGCCTGG - Intronic
956412035 3:68989603-68989625 TAAGCACATGCCACCATGCCTGG - Intronic
956485386 3:69717067-69717089 CAAGCACCTGCCACCATGCCTGG + Intergenic
956745371 3:72306954-72306976 GAAGCATTTGGAAGAGTGCCTGG + Intergenic
956802221 3:72770021-72770043 AAAGCACTTAGCACAATGCCTGG + Intronic
956996109 3:74828026-74828048 GATGCAATTGGAACCCTGCAAGG + Intergenic
957154093 3:76524757-76524779 GTAGCACTTTGAAATATGCCAGG + Intronic
957167583 3:76694959-76694981 GAAGCATGTGCCACCATGCCTGG - Intronic
958031013 3:88110132-88110154 AAAGCACTTGGCACAATTCCTGG - Intronic
958530282 3:95321118-95321140 CAGGCACTTGCCACCATGCCCGG + Intergenic
958547263 3:95570013-95570035 GAAGCATTTAGAACAATCCCAGG + Intergenic
958710390 3:97710113-97710135 GAAGAACTTGGAAAAATGTCTGG - Intronic
958905529 3:99937847-99937869 GAAGCACTTAAAACAGTGCCTGG - Intronic
959346918 3:105207395-105207417 AAAGCACTTGGAAACAAGCAGGG - Intergenic
959348228 3:105226841-105226863 GAAGCACTTAGACCAGTGCCAGG + Intergenic
959944703 3:112114559-112114581 TAAGCACCTGCCACCATGCCCGG - Intronic
960025961 3:113009785-113009807 AAAGCACTTAGAACAATGCCTGG + Intronic
960026658 3:113018735-113018757 AAAGCATTTGGAACACTGCCTGG - Intronic
960315049 3:116166259-116166281 AAAGCACTTAGAACTGTGCCTGG - Intronic
960436592 3:117634137-117634159 GAGGCACTTGCCACCATGCTTGG + Intergenic
960829649 3:121833140-121833162 AAAGCAATTGGAACAATTCCTGG + Intronic
960939693 3:122925523-122925545 CAGGCACGTGGCACCATGCCTGG - Intronic
961021918 3:123515075-123515097 AAAGCACTTAGAACACTGCCTGG - Intronic
961204654 3:125072268-125072290 AAATCATTTGGAACCAAGCCTGG - Intergenic
961958598 3:130830155-130830177 CAAGCACATGCCACCATGCCTGG - Intergenic
962024458 3:131532570-131532592 CAAGCACTTAGAACAGTGCCTGG + Intergenic
962169386 3:133084652-133084674 GAAGTGCTTGGAACAGTGCCTGG - Intronic
962199511 3:133389857-133389879 TATGTCCTTGGAACCATGCCTGG + Intronic
962231600 3:133670276-133670298 GAAGCACTTAGTACAATGCCTGG + Intergenic
962626387 3:137229678-137229700 GAAGTTCTTAAAACCATGCCTGG + Intergenic
962871945 3:139504663-139504685 CAAGCACCTGCCACCATGCCTGG + Intergenic
962958578 3:140289124-140289146 AAAGCCCTTGGAACCATGCCTGG - Intronic
963105126 3:141640470-141640492 GAAGCACATGCTATCATGCCCGG - Intergenic
963350157 3:144141623-144141645 AAAGTACTTGGAACAATTCCTGG - Intergenic
963670869 3:148250570-148250592 GAAACACTTAGGACAATGCCTGG - Intergenic
963825502 3:149948883-149948905 CAGGCACTTGCCACCATGCCTGG - Intronic
964084595 3:152800635-152800657 GAAGCCCTTGATACTATGCCAGG - Intergenic
964351537 3:155807902-155807924 GAAGCACCTAGAACAATACCTGG - Intergenic
964584881 3:158286425-158286447 AAAGCACTTGTTACCGTGCCTGG + Intronic
964591073 3:158362195-158362217 GAAGCATGTGCCACCATGCCTGG - Intronic
964623888 3:158740559-158740581 GAAGCATTTAGGACAATGCCTGG + Intronic
964659813 3:159107643-159107665 AAAGCACTTAGAGCAATGCCTGG - Intronic
964879675 3:161409761-161409783 GAAGCATTTGAAACAATTCCTGG + Intergenic
965419157 3:168435794-168435816 TAAGCACTTAGAACAGTGCCTGG - Intergenic
965661682 3:171048585-171048607 CAGGCACTTGCCACCATGCCCGG - Intergenic
965711356 3:171559368-171559390 AAAGCACTTGGGACCCTGCCTGG + Intergenic
965792567 3:172405218-172405240 GAAGCTCCTGCCACCATGCCTGG - Intergenic
965822258 3:172696447-172696469 AAAGCACTTGGAGCAATACCTGG - Intronic
965863812 3:173181131-173181153 GAGGCACCTGTCACCATGCCTGG + Intergenic
965918230 3:173877785-173877807 AAAGCATTTGTAACAATGCCTGG - Intronic
966189952 3:177263189-177263211 CAGGCACTTGCCACCATGCCTGG + Intergenic
966352346 3:179044499-179044521 CAAGCACCTGCAACCATGCCTGG - Intronic
966415092 3:179681139-179681161 GGAGCACTTGGAGCCAGGGCTGG + Intronic
966521604 3:180880041-180880063 CAAGCACCTGTCACCATGCCCGG + Intronic
966526539 3:180925216-180925238 GAGGCACGTGCCACCATGCCCGG - Intronic
966611783 3:181874863-181874885 AAAGCACGTGGAACAGTGCCTGG - Intergenic
967199512 3:187059695-187059717 AAAGCACTTAGAACAATACCTGG + Intronic
967472125 3:189874210-189874232 GAGGCACCTGCCACCATGCCTGG + Intronic
967544488 3:190708387-190708409 AAAGTACTTAGAATCATGCCTGG - Intergenic
967960391 3:194916767-194916789 CAAGCACGTGCCACCATGCCTGG - Intergenic
967999517 3:195195246-195195268 AAAGCACTTAGAACAATGCCTGG + Intronic
968166307 3:196467873-196467895 GAGGCACATGTCACCATGCCCGG + Intergenic
968244082 3:197124415-197124437 CAGGCACTTGCCACCATGCCCGG + Intronic
968309434 3:197671155-197671177 CAAGCACATGCCACCATGCCTGG + Intergenic
968334468 3:197901278-197901300 CAGGCACTTGCCACCATGCCCGG + Intronic
968344194 3:197986980-197987002 CAGGCACCTGCAACCATGCCCGG + Intronic
968349300 3:198039470-198039492 CAAGTAGCTGGAACCATGCCTGG - Intronic
968507543 4:978088-978110 CAGGCACTTGCCACCATGCCCGG - Intronic
968884361 4:3319585-3319607 CAGGCACTTGCTACCATGCCTGG + Intronic
969208861 4:5671057-5671079 AAAGCACTTGGATCCATCCCTGG - Intronic
969280425 4:6167050-6167072 CAAGTACTTGGAACAGTGCCTGG + Intronic
969535373 4:7753444-7753466 AAAGCACCTGGAACAAAGCCTGG + Intergenic
969611093 4:8228184-8228206 GAAGCACGTGCAGCCAGGCCAGG - Exonic
969674565 4:8607740-8607762 GAAGCACTGGGGACCCCGCCAGG - Intronic
969852017 4:9965058-9965080 TCAGCACTTGGAACAGTGCCTGG - Intronic
970351745 4:15208388-15208410 TAAACACTTGGTACAATGCCTGG - Intergenic
970361924 4:15318553-15318575 CAGGCACTTGCCACCATGCCCGG + Intergenic
970492352 4:16587263-16587285 AAAGCACTTAGAACAATGCCTGG - Intronic
970550571 4:17176955-17176977 AAAGCACTTAGAACAATGGCCGG + Intergenic
970890997 4:21044452-21044474 GAGGCACCTGCCACCATGCCCGG + Intronic
970927434 4:21469205-21469227 CAAGCACGTGCCACCATGCCTGG + Intronic
971078932 4:23184254-23184276 CAGGCACATGGCACCATGCCCGG + Intergenic
971093841 4:23375383-23375405 TAGGCACTTGCCACCATGCCTGG - Intergenic
971215312 4:24657143-24657165 GAAGCACCTTGAATTATGCCTGG - Intergenic
971248595 4:24952447-24952469 CAGGCACCTGCAACCATGCCTGG - Intronic
971306236 4:25484163-25484185 GCAGCTCTCAGAACCATGCCTGG + Intergenic
971386582 4:26146077-26146099 TAGGCACATGCAACCATGCCCGG + Intergenic
971766108 4:30834121-30834143 GAAGCAGTTGGAAAAGTGCCTGG - Intronic
971768696 4:30868212-30868234 AAAACACTTAGCACCATGCCTGG - Intronic
971900123 4:32648813-32648835 TAGGCACTTGCCACCATGCCTGG + Intergenic
971920363 4:32931676-32931698 AAAGCAGTTGGAACAATACCTGG + Intergenic
971967598 4:33580255-33580277 CAAGCACATGCTACCATGCCTGG + Intergenic
972033292 4:34489912-34489934 CAGGCACCTGGAACCATGTCTGG - Intergenic
972359312 4:38313055-38313077 AAAACACTTGTCACCATGCCTGG + Intergenic
972590326 4:40479892-40479914 GAAACACTTAGAACAGTGCCTGG - Intronic
972715845 4:41644999-41645021 AAAGTACTTAGAACAATGCCTGG - Intronic
972920608 4:43936665-43936687 CAAGCACCTGCCACCATGCCCGG - Intergenic
973302041 4:48596635-48596657 AAAGCACTTGGAACAGTACCTGG + Intronic
973825790 4:54705738-54705760 CAAGCATGTGGCACCATGCCCGG - Intronic
973843897 4:54891278-54891300 AAAGCACTTAGAACAGTGCCTGG + Intergenic
973936115 4:55848513-55848535 CAAGCACATGCCACCATGCCTGG - Intergenic
974514945 4:62897093-62897115 GAAGCAGTTGTAGCCAAGCCTGG + Intergenic
974725793 4:65796197-65796219 CAAGCACGTGCCACCATGCCTGG + Intergenic
974803785 4:66854500-66854522 TAAGCATTTGGAACCATGGTTGG - Intergenic
975159315 4:71107487-71107509 GAGGCACATGCCACCATGCCCGG + Intergenic
975216989 4:71767500-71767522 GGAGCACTTGGTACCAGTCCTGG + Intronic
975562482 4:75720651-75720673 GAGGCACATGCCACCATGCCTGG - Intronic
975771394 4:77727186-77727208 AAAGCACTTAGAACAGTGCCTGG - Intronic
975804686 4:78099562-78099584 GAAGCACCTGTAACAGTGCCAGG - Intronic
975820338 4:78264725-78264747 GAAGCACTTAGAACAGTGCCTGG + Intronic
975824856 4:78308728-78308750 AAAGCACTTGGAACCGTGCCTGG - Intronic
975941165 4:79648480-79648502 GCAGTGCTTGGAACCAGGCCTGG - Intergenic
976077608 4:81317406-81317428 AAAGCACAGGGAACAATGCCTGG - Intergenic
976105876 4:81616764-81616786 CAAGCACGTGCCACCATGCCTGG - Intronic
976133370 4:81908575-81908597 CAAGCACCTGCTACCATGCCTGG - Intronic
976313314 4:83633982-83634004 CAAGCACCTGCCACCATGCCTGG - Intergenic
976330774 4:83828812-83828834 AAAGTACTTGGAATGATGCCTGG + Intergenic
976414622 4:84758386-84758408 CAGGCACATGCAACCATGCCTGG + Intronic
976720436 4:88164207-88164229 CAAGCACTTGCCACCATGCCTGG + Intronic
976788906 4:88854928-88854950 AAATCTCTTGGAACCATGCCTGG - Intronic
976849698 4:89530895-89530917 CAGGCACATGTAACCATGCCTGG - Intergenic
976863240 4:89691402-89691424 CAAGCACATGCAACCATACCTGG - Intergenic
976890247 4:90038348-90038370 AAAACACTTGGAACAATGCCTGG - Intergenic
976959215 4:90946486-90946508 GAGGCGCCTGGAACCACGCCTGG - Intronic
976987194 4:91316299-91316321 AAAGAACATGGAACAATGCCTGG + Intronic
977051337 4:92131495-92131517 CAGGCACTTGCCACCATGCCTGG - Intergenic
977093199 4:92705378-92705400 TAAGCACTTTCAACAATGCCTGG - Intronic
977125162 4:93156157-93156179 GAAGTACTTGGAACAGTGCCTGG + Intronic
977233224 4:94476928-94476950 GAAGCACTTGGAACATTATCTGG + Intronic
977450572 4:97190839-97190861 CAGGCACATGCAACCATGCCTGG - Intronic
977595825 4:98878493-98878515 CAAGCACCTGCCACCATGCCCGG - Intronic
977596390 4:98886216-98886238 CTAGCACTTGAAACCGTGCCTGG - Intronic
977641485 4:99362395-99362417 AAAGCACTTAGAACAGTGCCTGG + Intergenic
977695645 4:99962411-99962433 CAGGCACTTGCCACCATGCCCGG + Intergenic
977705473 4:100065822-100065844 AAAGCACTTAGAACAGTGCCTGG - Intergenic
977923368 4:102670347-102670369 AGAGCACTTAGAACAATGCCTGG + Intronic
978171646 4:105678586-105678608 AAAGCACTTAGAACAATGTCTGG - Exonic
978385948 4:108175523-108175545 TAGGCACTTGCCACCATGCCCGG + Intergenic
978396888 4:108290189-108290211 CAGGCACGTGCAACCATGCCTGG + Intergenic
978458509 4:108923486-108923508 CAAGCACATGTCACCATGCCTGG + Intronic
980038354 4:127910705-127910727 TAAGCACATGCCACCATGCCTGG + Intergenic
980446268 4:132912251-132912273 CAGGCACTTGCCACCATGCCCGG + Intergenic
980955459 4:139423977-139423999 AAAGCACTTAGAACCAAACCTGG - Intergenic
981027360 4:140090454-140090476 TAAGCACTTAGAACAGTGCCTGG - Intronic
981027403 4:140090905-140090927 CACGCACTTGCCACCATGCCTGG - Intronic
981073215 4:140567063-140567085 GAAGCACTTAGAACAATGTCTGG + Intronic
981205499 4:142035081-142035103 GAAGCACTTGGCATCAAGCCTGG + Intronic
982240882 4:153298175-153298197 GAAGAACTTAGAACAGTGCCTGG + Intronic
982444005 4:155469152-155469174 CAGGCACATGGCACCATGCCTGG + Intergenic
983099540 4:163608092-163608114 AAAGTACCTGGAACAATGCCTGG - Intronic
983244837 4:165275983-165276005 CAAGCACATGCCACCATGCCTGG - Intronic
983592365 4:169427965-169427987 CAGGCACATGCAACCATGCCTGG + Intronic
983604213 4:169567540-169567562 CAAGCACATGTCACCATGCCTGG + Intronic
983931057 4:173453933-173453955 CAAGCACATGCCACCATGCCTGG - Intergenic
984205571 4:176784023-176784045 AAAGCCCTTGGAACCATGATTGG - Intronic
984904988 4:184618260-184618282 CAAGCACATGCCACCATGCCCGG - Intergenic
985136699 4:186793340-186793362 AAAGCACTTAGACCAATGCCAGG - Intergenic
985191297 4:187376333-187376355 GAAGCCCCTGAAGCCATGCCTGG + Intergenic
985264644 4:188146550-188146572 CAAGCACGTGCCACCATGCCTGG + Intronic
985289134 4:188369490-188369512 CAAGCACGTGCCACCATGCCTGG - Intergenic
985782405 5:1878158-1878180 ACAGCACTTTGAACCAGGCCTGG - Exonic
986271308 5:6233287-6233309 GAAGCACTTGAACCCAACCCGGG - Intergenic
986336715 5:6760832-6760854 GAAGCACCTGGAGCCATGCCAGG + Intergenic
986403392 5:7401157-7401179 AAAGCCCTTAGAACAATGCCTGG + Intronic
986564818 5:9101449-9101471 GAAGCACTTTAAACAATACCTGG + Intronic
986685165 5:10270042-10270064 CAGGCACTTGCCACCATGCCCGG - Intergenic
986833812 5:11611633-11611655 TAAGCACATGCCACCATGCCTGG - Intronic
987103815 5:14617257-14617279 CAAGCACCTGCCACCATGCCCGG - Intergenic
987207920 5:15646424-15646446 GAAGAACTTGAAAGAATGCCAGG + Intronic
987357011 5:17072562-17072584 CAAGCACATGCCACCATGCCTGG - Intronic
987358778 5:17087802-17087824 CAAGCACTTGCCACCATGCCTGG + Intronic
987503186 5:18739473-18739495 CAGGCACTTGCCACCATGCCTGG + Intergenic
988465473 5:31487100-31487122 GAAGCATTTGGGACACTGCCTGG - Intronic
988521019 5:31945730-31945752 GAAGCACCTGGATCCAAGCCAGG - Intronic
988571837 5:32375647-32375669 CAAGCACATGCCACCATGCCGGG + Intronic
989052643 5:37336490-37336512 AAAGCACTCAGAACAATGCCTGG - Intronic
989181529 5:38582188-38582210 GTAGCACGTGACACCATGCCTGG + Intronic
989672748 5:43937330-43937352 GAAGCACTAGGGACCAATCCTGG + Intergenic
989986724 5:50708922-50708944 CAGGCACTTGCCACCATGCCTGG + Intronic
990152784 5:52838952-52838974 GAGGCACATGCCACCATGCCTGG - Intronic
990173316 5:53079792-53079814 AAAGCACTTGATACCATGGCTGG - Intronic
990574014 5:57107453-57107475 CAAGCACGTGCCACCATGCCTGG + Intergenic
991124191 5:63051116-63051138 GAAGCACTTGGCACAATGCCAGG - Intergenic
991157214 5:63453074-63453096 GAGGCACCTGCCACCATGCCAGG - Intergenic
991573618 5:68080378-68080400 CAAGCACCTGCCACCATGCCTGG + Intergenic
991906654 5:71520676-71520698 TCAGCACTTAGAACAATGCCTGG - Intronic
992122472 5:73608907-73608929 CAGGCACCTGGCACCATGCCCGG + Intergenic
992439076 5:76782212-76782234 CAGGCACTTGCCACCATGCCCGG - Intergenic
992578771 5:78149574-78149596 GAAGCACTTAGAACAGTGCTCGG - Intronic
992650885 5:78858838-78858860 GAAACATTTAGCACCATGCCTGG - Intronic
992783608 5:80149766-80149788 GAAGAACTTAGAACAGTGCCTGG + Intronic
992829735 5:80582752-80582774 CAGGCACTTGCCACCATGCCCGG + Intergenic
993274530 5:85839271-85839293 AAAGCACTTAGAACAGTGCCTGG - Intergenic
993564654 5:89458267-89458289 GAAGCATTGGGTAGCATGCCAGG - Intergenic
993956702 5:94243155-94243177 AAAACACTTAGAACAATGCCTGG + Intronic
994097583 5:95860786-95860808 CAAGCACCTGCCACCATGCCCGG - Intergenic
994118137 5:96084023-96084045 AAAGCATTTAGAACAATGCCTGG + Intergenic
994128014 5:96191337-96191359 AAAGTACTTAGAACAATGCCTGG - Intergenic
994183804 5:96796924-96796946 CAGGCACAAGGAACCATGCCTGG + Intronic
994203623 5:97007460-97007482 GAAGCACCTAGAACAATGCCTGG + Intronic
994213306 5:97109394-97109416 CAGGCACTTGGCACCATACCTGG + Intronic
994335443 5:98560276-98560298 GGAGGCCTTGGAACCATGACAGG + Intergenic
995238775 5:109861535-109861557 AAAGCACTTGGCACAATGCCTGG - Intronic
995294157 5:110499392-110499414 CAGGCACATGCAACCATGCCTGG + Intronic
995379729 5:111518484-111518506 CAGGCACCTGGAACCACGCCTGG + Intergenic
996260763 5:121465319-121465341 CAGGCACTTGCCACCATGCCCGG + Intergenic
996408718 5:123132021-123132043 AAAGCACTTAGAACAGTGCCTGG + Intronic
996561633 5:124836104-124836126 CAAGCACCTGCCACCATGCCTGG - Intergenic
996836192 5:127795413-127795435 GAGACACTTAGAACAATGCCTGG - Intergenic
997015091 5:129923443-129923465 CCAGCACTTGGAACAGTGCCTGG - Intronic
997525815 5:134552590-134552612 AAGGCACTTGGCACCAGGCCTGG + Intronic
997539851 5:134652737-134652759 GTAGCACATGCCACCATGCCTGG + Intronic
997544761 5:134696639-134696661 CAGGCACCTGCAACCATGCCTGG + Intronic
997805962 5:136918094-136918116 AAAGCACCTAGCACCATGCCAGG + Intergenic
997869181 5:137491972-137491994 GAAGCTCTTAGCACAATGCCTGG - Intronic
997923705 5:138008297-138008319 CAAGCACATGCCACCATGCCTGG - Intronic
998102954 5:139449478-139449500 CAAGCACGTGCCACCATGCCCGG + Intronic
998210456 5:140193423-140193445 CAAGCACATGCCACCATGCCCGG + Intronic
998390527 5:141784371-141784393 CTAGCCCTTGGAACAATGCCTGG - Intergenic
998495066 5:142581583-142581605 GAAGTGCTTAGCACCATGCCTGG + Intergenic
998836440 5:146206721-146206743 CAGGCACTTGCCACCATGCCCGG + Intronic
999085087 5:148880945-148880967 CAAGCACCTGGAAGCATGGCTGG + Intergenic
999202838 5:149828451-149828473 AAAGCACTTAGAACAGTGCCTGG + Intronic
999640492 5:153667575-153667597 TAAGCACTTAGTACCATGTCTGG - Intronic
999747801 5:154605511-154605533 CAGGCACCTGCAACCATGCCCGG - Intergenic
999817658 5:155193516-155193538 GAAGCACTTAGAACAGTGCCTGG - Intergenic
999910321 5:156190565-156190587 CAAGCACCTGGAATTATGCCAGG - Intronic
999913439 5:156231391-156231413 CAAGCACGTGCCACCATGCCCGG - Intronic
999993281 5:157068129-157068151 GAAGCACCCGCAACCATGCCTGG - Intergenic
999993478 5:157069786-157069808 AAAGCACTCGCTACCATGCCTGG + Intergenic
1000160009 5:158587938-158587960 GCAGCACTTAGAACAGTGCCTGG - Intergenic
1000160745 5:158595229-158595251 AAAGTACTTGGAACAGTGCCTGG + Intergenic
1000416304 5:160987499-160987521 CAGGCACTTGCCACCATGCCTGG + Intergenic
1000655730 5:163875947-163875969 CAAGCACATGCCACCATGCCTGG + Intergenic
1000801943 5:165738708-165738730 AAAGCACTTGGCAGAATGCCTGG - Intergenic
1000915164 5:167072568-167072590 AAAGCACTTGGCACAGTGCCCGG - Intergenic
1001082085 5:168674878-168674900 GAACCACTTAGCACCATGTCTGG - Intronic
1001386194 5:171341300-171341322 GAAACACTTAGAACAGTGCCTGG - Intergenic
1001453109 5:171841237-171841259 AAAGCACTTAGAACCGTGTCTGG + Intergenic
1001647779 5:173295093-173295115 GGAGCATTTGGAACCAGGACAGG - Intergenic
1001752740 5:174143983-174144005 GAAGCACTTAGCACAGTGCCTGG - Intronic
1001753507 5:174148889-174148911 ATAGCACCTGGAACAATGCCAGG + Intronic
1002056349 5:176599795-176599817 GAAGCAGCTGGAGCCAGGCCGGG + Exonic
1002155796 5:177278248-177278270 CAAGCACTTGCCACCATGCCCGG + Intronic
1002170075 5:177370011-177370033 GAAGCATCTGGCACAATGCCTGG - Intronic
1002270081 5:178065767-178065789 CAGGCACTCGCAACCATGCCCGG - Intergenic
1002394369 5:178941614-178941636 GCAGGACTCGGAACCACGCCAGG - Intronic
1003004371 6:2367415-2367437 TAAGCACCTGGAACAAAGCCTGG - Intergenic
1003325481 6:5086902-5086924 CAAGGCCTTAGAACCATGCCCGG - Exonic
1003375946 6:5577942-5577964 CAGGCACTTGCCACCATGCCTGG + Intronic
1003818721 6:9871087-9871109 AAAGCACTTAAAACAATGCCTGG + Intronic
1003946778 6:11083237-11083259 CAAGCACCTGCCACCATGCCTGG + Intergenic
1004314437 6:14573558-14573580 AAAGTGCTTAGAACCATGCCAGG - Intergenic
1004403975 6:15314400-15314422 CAAGCACCTGGAACAGTGCCTGG + Intronic
1004878787 6:19984464-19984486 CAAGCACCTGCCACCATGCCTGG - Intergenic
1004901475 6:20198083-20198105 CAAGCACCTGCCACCATGCCTGG - Intronic
1004919372 6:20361686-20361708 CAGGCACTTGCCACCATGCCTGG - Intergenic
1005077949 6:21926971-21926993 GAAGCACTTGCCACCATGCCTGG + Intergenic
1006267042 6:32934253-32934275 AAAGCACCTGGTACAATGCCTGG + Intergenic
1006464499 6:34184214-34184236 CAGGCACCTGGCACCATGCCCGG - Intergenic
1006493261 6:34402312-34402334 AAAGCACCTGCCACCATGCCCGG - Intronic
1006597034 6:35201113-35201135 CAAGCGCTTGCCACCATGCCCGG - Intergenic
1006606536 6:35261163-35261185 AAAGCACCGGGCACCATGCCTGG + Intronic
1006650747 6:35549262-35549284 CAGGCACTTGCCACCATGCCTGG + Intergenic
1007183748 6:39949872-39949894 CAGGCACTTGCCACCATGCCCGG - Intergenic
1007299521 6:40856308-40856330 GAAGCACTTAGCACAATACCTGG + Intergenic
1007554266 6:42753067-42753089 CAGGCACTTGCCACCATGCCTGG + Intronic
1007617380 6:43188138-43188160 GAAGCAATTGGAACAAGTCCTGG + Intronic
1007727404 6:43924756-43924778 GAAGCACCTGGTAACAAGCCTGG + Intergenic
1007855258 6:44849044-44849066 GAAGCACTGGGTACCATACATGG + Intronic
1007933475 6:45713128-45713150 CAAGCACTCAGCACCATGCCTGG - Intergenic
1008540344 6:52541272-52541294 GAAGCCCTTGGACTCATGCATGG - Intronic
1008684427 6:53909167-53909189 AAAGCCCTTGGCACCATGCCTGG - Intronic
1008757577 6:54816023-54816045 GAGGCACATGCCACCATGCCAGG + Intergenic
1009581665 6:65543159-65543181 TAGGCACTTGCCACCATGCCGGG + Intronic
1009903454 6:69838491-69838513 AAAGTACGTGGAGCCATGCCTGG - Intergenic
1009934870 6:70222242-70222264 AAAGCTCTTGGAACAGTGCCTGG - Intronic
1009979847 6:70715237-70715259 CAAGCACTTGCCAGCATGCCTGG + Intronic
1010207455 6:73335653-73335675 CAGGCACGTGCAACCATGCCTGG - Intergenic
1010265189 6:73857743-73857765 AAAGAACTTAGAACAATGCCGGG - Intergenic
1010368134 6:75076310-75076332 AAGGCACTTAGTACCATGCCAGG + Intergenic
1010512121 6:76733046-76733068 GAAGCACTTAGTTGCATGCCTGG - Intergenic
1010563130 6:77375521-77375543 AAAGTACTTGGAACAGTGCCTGG - Intergenic
1011046835 6:83093761-83093783 CAGGCACCTGGCACCATGCCTGG - Intronic
1011202840 6:84856396-84856418 GAAGCATGTGGAACCACTCCAGG - Intergenic
1011494606 6:87925827-87925849 GAAGCACCTGGCACTATGTCTGG - Intergenic
1011585305 6:88918178-88918200 CAGGCACTTGCCACCATGCCTGG - Intronic
1011600302 6:89053723-89053745 CAGGCACTTGCCACCATGCCTGG + Intergenic
1011743937 6:90391020-90391042 AAAGCACTTGGAACAGTGTCTGG - Intergenic
1011750221 6:90447923-90447945 TAAACACTTAGCACCATGCCTGG - Intergenic
1011897399 6:92247169-92247191 GAGGCAATTTGAACCATGGCTGG - Intergenic
1012197248 6:96358745-96358767 TAAACACTTAGAACAATGCCTGG + Intergenic
1012520023 6:100110141-100110163 AAAGCACTCGGAACAGTGCCTGG + Intergenic
1012891704 6:104904360-104904382 CAGGCACATGCAACCATGCCTGG - Intergenic
1013081127 6:106814250-106814272 GAGGCACATGCCACCATGCCTGG - Intergenic
1013652015 6:112205162-112205184 GAAACACTTAGAACAATGCCAGG + Intronic
1013743395 6:113316059-113316081 GAAGCAATTGGAACAATTTCTGG + Intergenic
1014050827 6:116952400-116952422 CAAGCACGTGCCACCATGCCTGG + Intergenic
1014672046 6:124317020-124317042 TAAGCACATGCAACCGTGCCTGG - Intronic
1014773607 6:125484476-125484498 CCAGCACTTGGAACAATGCCTGG - Intergenic
1014779694 6:125550093-125550115 TAAGCACTTGGAATAGTGCCTGG - Intergenic
1014803062 6:125798425-125798447 AAAGTACTTGGAACCTTGCCTGG + Intronic
1014863470 6:126498667-126498689 AAAGTACTTGGAACTATGTCTGG - Intergenic
1014932549 6:127351319-127351341 CAAGCACATGACACCATGCCTGG - Intergenic
1015319396 6:131855466-131855488 CAAGCACATGACACCATGCCTGG + Intronic
1015365097 6:132388437-132388459 CAAGCACATGGAATCATTCCTGG + Intronic
1015412411 6:132909558-132909580 GAGGCACTTGGAGGCATGACTGG - Intergenic
1015532246 6:134232240-134232262 CAGGCACTTGCCACCATGCCTGG - Intronic
1015538582 6:134291922-134291944 AAAGCACGTGCCACCATGCCTGG - Intronic
1015746001 6:136510393-136510415 GATGCACTTGCAATGATGCCTGG - Intronic
1015785350 6:136917316-136917338 CAAGCACTCGCCACCATGCCTGG - Intergenic
1015839567 6:137462196-137462218 CAGGCACTTGCCACCATGCCCGG - Intergenic
1016604377 6:145902798-145902820 GAGGCATTTGGAACAATACCTGG - Intronic
1016798320 6:148142106-148142128 CAAGCACCTGCCACCATGCCTGG + Intergenic
1017174827 6:151493406-151493428 GAAGCACTTAGAACAGTGCATGG + Intergenic
1017185307 6:151594792-151594814 CAGGCACCTGCAACCATGCCTGG + Intronic
1017472458 6:154752862-154752884 TAGGCACTTGCCACCATGCCCGG + Intronic
1018194407 6:161342457-161342479 GAAGCACTTGGAAGCATGCCTGG - Intergenic
1018245848 6:161823075-161823097 GAAGCACATGCTACTATGCCAGG + Intronic
1019702778 7:2482069-2482091 CAGGCACGTGGTACCATGCCTGG + Intergenic
1019966888 7:4506775-4506797 GAGGCACCTGCCACCATGCCCGG + Intergenic
1020193141 7:6015950-6015972 GAAGCTGCTGGACCCATGCCCGG - Intronic
1020772651 7:12414792-12414814 CAGGCACATGGCACCATGCCCGG - Intergenic
1021228724 7:18059633-18059655 AAAGCTCTTGGTACTATGCCTGG - Intergenic
1021295952 7:18906285-18906307 CAGGCACTTGCCACCATGCCTGG + Intronic
1021449284 7:20767472-20767494 CAAGCACGTGCCACCATGCCTGG - Intronic
1021488453 7:21192447-21192469 CAAGCACGTGCCACCATGCCTGG - Intergenic
1021537520 7:21722324-21722346 GAAGCACTATGAACCATGAGAGG - Intronic
1021602688 7:22379957-22379979 CAAGCACTTGCCACCATGCCTGG - Intergenic
1021624197 7:22576445-22576467 CAGGCACTTGCCACCATGCCTGG - Intronic
1021665054 7:22968841-22968863 CAGGCACATGGCACCATGCCAGG - Intronic
1021667879 7:23004946-23004968 CAAGCACGTGCCACCATGCCCGG + Intronic
1021989703 7:26129812-26129834 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1022155108 7:27652984-27653006 CAAGCACATGCCACCATGCCTGG - Intronic
1022282903 7:28928629-28928651 AAAGTACTTGGAACAGTGCCTGG + Intergenic
1022645543 7:32225913-32225935 CAAGCACGTGCCACCATGCCCGG - Intronic
1022886184 7:34646991-34647013 AAAGCACTTAGAATAATGCCTGG - Intergenic
1023278223 7:38543112-38543134 CAAGCACATGCCACCATGCCTGG - Intronic
1023294779 7:38703147-38703169 GAAGCATTTAGAACAATGACTGG - Intergenic
1023469537 7:40499764-40499786 AAAGCACTTGGAAAAATGACTGG - Intronic
1023953511 7:44867082-44867104 CAGGCACATGGCACCATGCCTGG + Intergenic
1023985889 7:45095671-45095693 CAGGCACTTGCCACCATGCCTGG + Intergenic
1024317828 7:48037299-48037321 AAAGCACTTAGAACAGTGCCTGG - Intronic
1025248014 7:57332179-57332201 CAAGCACCTGCCACCATGCCTGG - Intergenic
1025641924 7:63382049-63382071 CAGGCACTTGTCACCATGCCAGG - Intergenic
1025824862 7:65002464-65002486 CAGGCACATGCAACCATGCCTGG + Intronic
1025843219 7:65171383-65171405 GAAGCACATGTCACCATGCCCGG + Intergenic
1025879825 7:65524588-65524610 GAAGCACATGTCACCATGCCCGG - Intergenic
1025893612 7:65678002-65678024 GAAGCACATGTCACCATGCCCGG + Intergenic
1026170815 7:67952396-67952418 CAAGCACCTGCCACCATGCCGGG + Intergenic
1026184548 7:68072225-68072247 CAGGCACTTGCCACCATGCCTGG + Intergenic
1026229947 7:68473961-68473983 AAAGCACTTAGAACCACTCCTGG + Intergenic
1026257892 7:68728524-68728546 AAAGCACTTAGAACAATGCCTGG - Intergenic
1026257922 7:68728748-68728770 GAAGCACCCGGCACCATGCCTGG - Intergenic
1026508207 7:71004845-71004867 AAAGCACTTGGGACAGTGCCTGG - Intergenic
1026638012 7:72101104-72101126 CAGGCACATGGTACCATGCCTGG + Intronic
1027190534 7:75993617-75993639 GAAGCAGTTGGAACCAGTCCAGG + Intronic
1027261179 7:76465721-76465743 CAAGCACCTGCCACCATGCCTGG + Intronic
1027312563 7:76963829-76963851 CAAGCACCTGCCACCATGCCTGG + Intergenic
1027631948 7:80617582-80617604 CAAGCACCTGCCACCATGCCCGG - Intronic
1027671418 7:81104278-81104300 CAAGCACATGCCACCATGCCTGG - Intergenic
1027759521 7:82260249-82260271 AAAACACTTAGAACAATGCCTGG + Intronic
1027825770 7:83113664-83113686 TAAGCACCTGGAATAATGCCTGG + Intronic
1027997824 7:85448102-85448124 CAGGCACATGCAACCATGCCTGG + Intergenic
1028002024 7:85510750-85510772 CAAGCACTTAGAACAGTGCCTGG - Intergenic
1028026212 7:85843659-85843681 CAAGCCCCTGCAACCATGCCCGG - Intergenic
1028121518 7:87060222-87060244 AAAGCACTTGGAAGAGTGCCTGG + Intergenic
1028204818 7:88004521-88004543 GAAGTTCTTGGAACAGTGCCTGG - Intronic
1028479664 7:91291107-91291129 CAAGCACGTGCCACCATGCCCGG + Intergenic
1028647852 7:93118775-93118797 GAAACATTTAGAACAATGCCTGG - Intergenic
1029016716 7:97322266-97322288 CAGGCACCTGGCACCATGCCCGG - Intergenic
1029119958 7:98261166-98261188 CAGGCACTTGCCACCATGCCTGG - Intronic
1029144137 7:98433959-98433981 CAGGCACCTGGCACCATGCCTGG + Intergenic
1029202076 7:98845845-98845867 CAAGCACGTGCCACCATGCCCGG - Intergenic
1029435367 7:100561267-100561289 CAAGCACCTGCCACCATGCCTGG + Intronic
1029555360 7:101265096-101265118 TAGGCACGTGGCACCATGCCCGG + Intergenic
1029588919 7:101494267-101494289 CAGGCACTTGCCACCATGCCCGG + Intronic
1029635658 7:101781978-101782000 GAGGCACGTGCCACCATGCCCGG - Intergenic
1029669297 7:102018097-102018119 TAGGCACTTGCCACCATGCCTGG + Intronic
1029792686 7:102861837-102861859 CAAGCACCTGCCACCATGCCCGG - Intronic
1029982722 7:104894286-104894308 AAAGCACTTAGCACAATGCCTGG + Intronic
1030001643 7:105070489-105070511 CAAGCACCTGCCACCATGCCCGG - Intronic
1030011521 7:105173245-105173267 GAAGTACATGCCACCATGCCTGG + Intronic
1030055277 7:105578913-105578935 GAGGCACATGCCACCATGCCTGG + Intronic
1030058386 7:105602984-105603006 CAGGCACGTGCAACCATGCCCGG + Intergenic
1030128759 7:106179239-106179261 GAGGCACATGCCACCATGCCTGG + Intergenic
1030167004 7:106565180-106565202 GAAGAACTTGGAAACAGGCCGGG - Intergenic
1030218260 7:107069075-107069097 GAGGCACCTGTCACCATGCCCGG + Intronic
1030265364 7:107615451-107615473 CAGGCACTTGCCACCATGCCCGG - Intronic
1030531667 7:110718587-110718609 AAAGCACTTGGAAGCTAGCCTGG + Intronic
1030654359 7:112149966-112149988 GAAGCAGCTGGTACCTTGCCTGG - Intronic
1030964587 7:115974913-115974935 AAAGCACTTAGAAGCATGCCTGG - Intronic
1031434404 7:121714553-121714575 GAATCACTTTGAACCATTCCTGG - Intergenic
1031779621 7:125944975-125944997 CAAGCACATGCTACCATGCCTGG - Intergenic
1032027301 7:128454195-128454217 AAAGCGCTTAGAACAATGCCTGG - Intergenic
1032079299 7:128850718-128850740 GAAGCACTCAGGACCAGGCCTGG + Intronic
1032218324 7:129974657-129974679 CAAGCACATGCCACCATGCCTGG + Intergenic
1032266132 7:130371236-130371258 AATGCACTTGGCACCGTGCCTGG - Intergenic
1032268148 7:130382604-130382626 CAAGCACGTGCCACCATGCCCGG + Intronic
1032640219 7:133758279-133758301 GAGGCACGTGCCACCATGCCCGG + Intronic
1033135587 7:138781470-138781492 CAAGCACCTGCCACCATGCCTGG + Intronic
1033159556 7:138983365-138983387 CAAGCACGTGCCACCATGCCTGG - Intergenic
1033221589 7:139530039-139530061 GAGGCACGTGCCACCATGCCTGG - Intronic
1033342762 7:140504955-140504977 CAAGCACGTGCCACCATGCCTGG - Intergenic
1033720896 7:144058752-144058774 CAAGCACGTGCCACCATGCCCGG - Intergenic
1033761819 7:144443983-144444005 GAGGTACTTGCCACCATGCCTGG - Intergenic
1034396743 7:150831736-150831758 GAAGCACTTAGCACAGTGCCGGG + Intronic
1034909444 7:154982491-154982513 CAAGCACATGCCACCATGCCTGG + Intronic
1035585209 8:767497-767519 GAGGCACCTGGCACCCTGCCCGG + Intergenic
1035592123 8:824215-824237 TAAGTACTTGCCACCATGCCTGG + Intergenic
1036046412 8:5146359-5146381 AAAGTACTTGAAACAATGCCAGG - Intergenic
1036456287 8:8911360-8911382 CAAGCTCATGGCACCATGCCTGG - Intergenic
1037489353 8:19382972-19382994 TAGGCACTTGCCACCATGCCTGG + Intronic
1037490094 8:19389761-19389783 CAAGCACGTGCCACCATGCCTGG - Intronic
1037546326 8:19927092-19927114 GAAGCTTTTAGAACAATGCCTGG + Intronic
1037757458 8:21720423-21720445 GAAGTACCAGGGACCATGCCTGG + Intronic
1038324496 8:26562317-26562339 AAAGCACTGAGAACAATGCCTGG + Intronic
1038484954 8:27928387-27928409 GAAGCACTTAGAACAGTGCTTGG - Intronic
1038682048 8:29677788-29677810 GAACCACTTAGCACAATGCCTGG - Intergenic
1038958052 8:32488646-32488668 CAAGCAGTTGCCACCATGCCTGG - Intronic
1038967052 8:32586075-32586097 AAAGCTCTTAGAACAATGCCTGG + Intronic
1039188795 8:34948336-34948358 GAAGCACTTAGAACAGTGCCTGG - Intergenic
1039498466 8:37998848-37998870 TAGGCACTTGCCACCATGCCCGG - Intergenic
1039509329 8:38078288-38078310 TAGGCACCTAGAACCATGCCTGG - Intergenic
1039589194 8:38732623-38732645 GAAGCACTTAGCACAATGCCTGG - Intronic
1039801552 8:40961159-40961181 CAAGCACCTGCCACCATGCCCGG + Intergenic
1039914447 8:41849379-41849401 TAGGCACTTGCCACCATGCCCGG - Intronic
1039987442 8:42459477-42459499 GGAGCACCTGGGGCCATGCCTGG - Intronic
1040762711 8:50870042-50870064 GATGCACCTGCCACCATGCCTGG + Intergenic
1040834026 8:51712524-51712546 CAAGCACCTAGAATCATGCCTGG + Intronic
1040884356 8:52243661-52243683 AAAGAACTTGACACCATGCCTGG + Intronic
1041046877 8:53895785-53895807 CAGGCACCCGGAACCATGCCTGG + Intronic
1041184319 8:55283247-55283269 AAAGCACTTAGCACCATGCCAGG - Intronic
1041247057 8:55898429-55898451 CAGGCACGTGCAACCATGCCTGG + Intronic
1041565084 8:59267962-59267984 AAAGCACTTGAAACAGTGCCTGG - Intergenic
1041667777 8:60462615-60462637 GTAGTACCTGTAACCATGCCTGG - Intergenic
1041748226 8:61232175-61232197 CAGGCACCTGCAACCATGCCCGG + Intronic
1041825283 8:62088695-62088717 AAAGCACTTAGATCAATGCCTGG - Intergenic
1042068514 8:64904789-64904811 TAGGCACTTGCCACCATGCCTGG + Intergenic
1042154771 8:65832625-65832647 CAAGCACGTGTCACCATGCCTGG + Intronic
1042211069 8:66381161-66381183 AAAGCTCTTAGAACTATGCCAGG - Intergenic
1042517505 8:69674895-69674917 CAGGCACTTGCCACCATGCCTGG - Intronic
1042525199 8:69757534-69757556 CAGGCACTTGCCACCATGCCTGG - Intronic
1042540397 8:69902239-69902261 TAAGCACTTGCCACCACGCCTGG + Intergenic
1042648393 8:71012641-71012663 GAAGTACTTAGTACAATGCCTGG - Intergenic
1042729841 8:71920496-71920518 CAAGCACATGCCACCATGCCCGG + Intronic
1042868360 8:73375871-73375893 AAAGCACTTAGAAGAATGCCTGG + Intergenic
1043146361 8:76660690-76660712 AAAGCACTTATCACCATGCCTGG + Intergenic
1043437085 8:80245344-80245366 GAAGGCCTTGGAGGCATGCCAGG - Intergenic
1043977875 8:86603533-86603555 AAAGCACTTAGAACACTGCCTGG - Intronic
1044176851 8:89136524-89136546 CAAGCACCTGCCACCATGCCCGG - Intergenic
1044321043 8:90802035-90802057 AAAGCACTTGGCCCAATGCCTGG - Intronic
1044418763 8:91967154-91967176 AAAGCACTTCATACCATGCCTGG + Intronic
1044454172 8:92373086-92373108 GAAGCACGTAGAACAGTGCCTGG - Intergenic
1044563603 8:93638613-93638635 CAGGCACCTGGCACCATGCCTGG - Intergenic
1044804226 8:95988398-95988420 GAAGCACTTAGAAGAGTGCCTGG - Intergenic
1044831619 8:96255494-96255516 CAAGCACGTGCCACCATGCCTGG - Intronic
1044871262 8:96622140-96622162 AAAGCACTTAGAACAATGCCTGG + Intergenic
1045022229 8:98053670-98053692 CAAGCACTCGACACCATGCCCGG + Intergenic
1045135844 8:99217226-99217248 GAAGCCCTTAGAACAGTGCCAGG - Intronic
1045238496 8:100377282-100377304 CAAGCACTAGCTACCATGCCTGG + Intronic
1045371548 8:101529288-101529310 CAAGCACATGCCACCATGCCAGG - Intronic
1045505550 8:102775855-102775877 AAAGCACTTAGCACCATGCCTGG + Intergenic
1045672985 8:104577513-104577535 GAAGTTCTTGGAAACAGGCCGGG + Intronic
1045808344 8:106191877-106191899 CAGGCACTTGGCACCACGCCCGG - Intergenic
1046651672 8:116842410-116842432 CAAGCACGTGCCACCATGCCCGG + Intronic
1046687066 8:117239438-117239460 GAAACCCTTAGCACCATGCCTGG + Intergenic
1046793585 8:118347066-118347088 CAAGCACGTGCCACCATGCCTGG + Intronic
1046812163 8:118544876-118544898 GAAGCACCTAGCACAATGCCTGG - Intronic
1046833684 8:118775895-118775917 TAAGCACTTAGAACTATGCAAGG + Intergenic
1046948892 8:120001359-120001381 AAAGAACTTGGAACCATGGGCGG + Intronic
1047074218 8:121381772-121381794 AAAGCACTTAGAACAAAGCCTGG - Intergenic
1047598137 8:126399316-126399338 CAGGCACTTGCCACCATGCCTGG - Intergenic
1047633042 8:126729006-126729028 AAATCATTTAGAACCATGCCTGG - Intergenic
1047809381 8:128391541-128391563 CAGGCACATGGCACCATGCCTGG - Intergenic
1047928635 8:129704606-129704628 GAAGCACTTGGAGGCAAGCTTGG + Intergenic
1047946843 8:129888731-129888753 TGAGCACTTAGAACAATGCCTGG + Intronic
1047985471 8:130228556-130228578 CAGGCACTTGCTACCATGCCTGG - Intronic
1048003427 8:130398670-130398692 AAAGCACTTGGAACAGTGCCTGG - Intronic
1048016168 8:130499588-130499610 AAAGCATTTGGAACCATGCCTGG - Intergenic
1048039774 8:130715922-130715944 GAGGCACATGTCACCATGCCTGG - Intergenic
1048485406 8:134843447-134843469 AAAGCACTTAGAACCATACTTGG - Intergenic
1048611511 8:136028191-136028213 GAAGCATTTAGAACAGTGCCTGG + Intergenic
1048800930 8:138193279-138193301 CAAGCACTTAGAACTGTGCCAGG + Intronic
1048894514 8:138978466-138978488 CAGGCACGTGCAACCATGCCTGG + Intergenic
1048947879 8:139467144-139467166 AAAGCACTTAGAACAGTGCCTGG + Intergenic
1049281293 8:141747391-141747413 CAGGCACATGGCACCATGCCTGG + Intergenic
1049855413 8:144858705-144858727 GAGGCACGTGCCACCATGCCCGG - Intergenic
1050535754 9:6629355-6629377 GAGGCACCTGCCACCATGCCCGG + Intronic
1051282859 9:15460531-15460553 CAGGCACCTGGCACCATGCCTGG + Exonic
1051308233 9:15739580-15739602 AAAGCATTTAGAACAATGCCTGG + Intronic
1051595359 9:18819311-18819333 CAGGCACTTGCCACCATGCCTGG - Intronic
1051612690 9:18976938-18976960 GAAGCACTTAGCACAATGCCTGG + Intronic
1051987933 9:23113045-23113067 TAAGCACTTAGAACACTGCCTGG - Intergenic
1052361186 9:27560993-27561015 AAAGCACTTAGAACAGTGCCTGG - Intronic
1052815331 9:33098674-33098696 CAGGCACATGCAACCATGCCTGG - Intergenic
1052903203 9:33812907-33812929 CAAGCACATGCCACCATGCCCGG - Intergenic
1052931338 9:34058084-34058106 CAGGCACTTGCCACCATGCCCGG + Intergenic
1053633265 9:39967285-39967307 CAAGCACCTGCCACCATGCCTGG + Intergenic
1053772481 9:41496195-41496217 CAAGCACCTGCCACCATGCCTGG - Intergenic
1054210623 9:62283412-62283434 CAAGCACCTGCCACCATGCCTGG - Intergenic
1054314361 9:63565509-63565531 CAAGCACCTGCCACCATGCCTGG + Intergenic
1054974250 9:71123477-71123499 AAAGCACTTAGAACAGTGCCTGG + Intronic
1055147098 9:72948962-72948984 GAAGCACTTCAAATCGTGCCTGG + Intronic
1055281415 9:74678887-74678909 CAGGCACTTGCCACCATGCCGGG - Intronic
1055291222 9:74784111-74784133 CAGGCACTTGCCACCATGCCCGG - Intronic
1055481411 9:76712177-76712199 AAAACCCTTAGAACCATGCCTGG - Intronic
1056351123 9:85750022-85750044 CAGGCACTTGCCACCATGCCTGG + Intergenic
1056389265 9:86125740-86125762 CAAGCACGTGGCACCATGCCCGG - Intergenic
1056509425 9:87288997-87289019 GAAGCACATGGAGCCATGAGTGG - Intergenic
1057325162 9:94056189-94056211 AAAGCACTTGGAACAGTACCTGG + Intronic
1057402517 9:94737245-94737267 CAAGCACATGCCACCATGCCTGG + Intronic
1057590931 9:96372861-96372883 CAGGCACTAGCAACCATGCCCGG + Intronic
1057798669 9:98175849-98175871 CAAGCACTTAGAACCCAGCCTGG + Intronic
1057939863 9:99272547-99272569 CAAGCACGTGCCACCATGCCCGG + Intergenic
1057987095 9:99728197-99728219 GAAGTACTTAGAGCAATGCCTGG - Intergenic
1058336773 9:103838893-103838915 CAAGCACTTAGAAATATGCCAGG + Intergenic
1058422757 9:104848470-104848492 CAAGCACATGCCACCATGCCTGG - Intronic
1058425663 9:104873756-104873778 GAAGCACTTAGTACAGTGCCTGG - Intronic
1058501680 9:105625615-105625637 AAAGAACTTAGCACCATGCCTGG + Intronic
1058545548 9:106057728-106057750 GAAACACTTAGCACAATGCCTGG - Intergenic
1058643959 9:107113202-107113224 GAGGTACTTGGAAGAATGCCTGG - Intergenic
1058654998 9:107212275-107212297 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1058729060 9:107832471-107832493 GGAGCACTTGGTACAATGCCTGG + Intergenic
1058995560 9:110295418-110295440 TAAGAACTTTGATCCATGCCTGG + Intergenic
1059085383 9:111296343-111296365 CAGGCACATGGCACCATGCCTGG - Intergenic
1059131118 9:111750475-111750497 CAGGCACTTACAACCATGCCTGG + Intronic
1059225816 9:112672061-112672083 AAAGCACTTAAAACAATGCCTGG + Intergenic
1059709810 9:116857138-116857160 AAAGCACTTAGAACCGTGCTTGG + Intronic
1059761878 9:117345411-117345433 GAAGCACTTAGAGTCATGCAAGG - Intronic
1059780375 9:117519727-117519749 CAAGCACATGCCACCATGCCTGG - Intergenic
1059937011 9:119321615-119321637 CAAGCACGTGCCACCATGCCTGG + Intronic
1060162303 9:121375483-121375505 CAAACACCTGGAACAATGCCTGG - Intergenic
1060210149 9:121705360-121705382 GAAGTATTTGGAACAGTGCCTGG + Intronic
1060243296 9:121923566-121923588 AAAGCACCTGGAACAATGCCTGG - Intronic
1060400341 9:123344978-123345000 AGAGCACTTAGAATCATGCCTGG + Intergenic
1060482826 9:124027673-124027695 CAAGCATGTGGCACCATGCCCGG - Intronic
1060607036 9:124924487-124924509 CAAGCACATGCCACCATGCCTGG - Intronic
1060950688 9:127600356-127600378 CAGGCACTTGCCACCATGCCCGG + Intergenic
1061067723 9:128289067-128289089 AAAGCACTTAGCACAATGCCTGG - Intergenic
1061281354 9:129599259-129599281 CAGGCACATGCAACCATGCCTGG - Intergenic
1061303555 9:129720030-129720052 AAAGCGCTTAGAACAATGCCTGG + Intronic
1061353905 9:130088593-130088615 GAAGCACTTAGCACAATGCCTGG - Intronic
1061424770 9:130492087-130492109 AAAGCACCTGGAACAATGTCTGG + Intronic
1061439216 9:130588567-130588589 AAAGCACTAGAAACAATGCCGGG - Intronic
1061488377 9:130931910-130931932 AAAGCACTTGGAGCCGTGCCTGG + Intronic
1061503126 9:131015013-131015035 GAAGCACTTGGAACAGTCCCAGG - Intronic
1061606478 9:131714848-131714870 TACGCACTTGCCACCATGCCTGG + Intronic
1061697366 9:132387098-132387120 TAAGCACGTGGCACCATGCCCGG + Intronic
1061844352 9:133378592-133378614 GAAGTGCTTGGCACCATGCCAGG + Intronic
1061898203 9:133659409-133659431 GAAGCACTTGGTACCACGCCTGG - Intergenic
1062149933 9:135012886-135012908 TAAGCACCTGCCACCATGCCCGG + Intergenic
1062674975 9:137737059-137737081 CAGGCACTTGCCACCATGCCTGG - Intronic
1203422179 Un_GL000195v1:3208-3230 GAAAAACTTAGAAACATGCCAGG + Intergenic
1185538109 X:879234-879256 CAAGCACATGCCACCATGCCTGG + Intergenic
1185548889 X:967884-967906 CAAGCACCTGCCACCATGCCCGG - Intergenic
1186221930 X:7358325-7358347 GAAGCACTTAGAACCATGTCTGG - Intergenic
1186468136 X:9800481-9800503 CAGGCACCTGGCACCATGCCTGG + Intronic
1186530264 X:10288005-10288027 CAAGCCCCTGGAACAATGCCTGG + Intergenic
1186881794 X:13873649-13873671 TAAGCAATTAGAACCAAGCCTGG + Intronic
1186995625 X:15118543-15118565 AAAACACTTAGAACAATGCCTGG + Intergenic
1187199406 X:17120490-17120512 AAAGCACTTAGAATGATGCCTGG + Intronic
1187235390 X:17462532-17462554 AAAGTACTTGGAACAGTGCCAGG - Intronic
1187251974 X:17606887-17606909 AAAGCACTTGGAACGGTTCCTGG - Intronic
1187467961 X:19543110-19543132 CCAGCACTGGGAACAATGCCTGG - Intronic
1187993772 X:24904075-24904097 CAGGCACTTGGCACCATGACTGG + Intronic
1188308002 X:28582467-28582489 TCAGTACTTTGAACCATGCCTGG + Intergenic
1188402374 X:29761644-29761666 GAAACACTTAGAACATTGCCTGG + Intronic
1188431620 X:30109938-30109960 AAAGCACCTGAAACCACGCCTGG - Intergenic
1188685491 X:33064744-33064766 CAGGCACTTGCCACCATGCCCGG - Intronic
1188996243 X:36888846-36888868 GAAGCACCAGGGACCATTCCTGG + Intergenic
1189044523 X:37576299-37576321 GAAACCCTTGGAACTATTCCAGG - Intronic
1189126048 X:38447832-38447854 CAAGCACATGCCACCATGCCTGG + Intronic
1189245368 X:39559225-39559247 GTAACACTTAGAACCATGCCCGG + Intergenic
1189264453 X:39703018-39703040 CAGGCACTTGCCACCATGCCTGG - Intergenic
1189625847 X:42895797-42895819 CAAGCACATGCCACCATGCCTGG - Intergenic
1189795587 X:44642935-44642957 AAAGCACTTAGAACAATGCCTGG + Intergenic
1189805979 X:44736186-44736208 CAGGCACCTGCAACCATGCCCGG + Intergenic
1190111155 X:47589797-47589819 GAAGTACTTGGAACAGTGCTAGG + Intronic
1190210831 X:48446077-48446099 TAAGCACGTGCCACCATGCCTGG + Intergenic
1190476142 X:50829518-50829540 GAAGCATTGAGAATCATGCCTGG + Intergenic
1190580726 X:51891581-51891603 CCAGCACCTAGAACCATGCCTGG - Intronic
1190862100 X:54354939-54354961 CAGGCACGTGGCACCATGCCTGG - Intronic
1191054008 X:56223279-56223301 GAAGCACCTAGAACAATGACTGG + Intergenic
1192146112 X:68684040-68684062 TAAGCACTTAGAACAATGTCTGG + Intronic
1192214076 X:69145823-69145845 AAAGCTCTTGGAACAGTGCCTGG - Intergenic
1192230555 X:69261804-69261826 AAAGCACTTGGAACAGTGCATGG + Intergenic
1192250129 X:69405898-69405920 GAAGCTCTTTGAACAGTGCCTGG - Intergenic
1192355393 X:70398178-70398200 CAGGCACATGGCACCATGCCTGG + Intronic
1192357194 X:70415463-70415485 CAAGCACATGCCACCATGCCTGG - Intronic
1192676928 X:73207323-73207345 CAAGCACTTAGCACAATGCCTGG - Intergenic
1193119613 X:77809624-77809646 GAGGCACCTGCCACCATGCCCGG + Intergenic
1193186655 X:78521334-78521356 AAAGCCCTTGGAGCTATGCCTGG - Intergenic
1193277745 X:79609376-79609398 CAAGCACCTGCCACCATGCCCGG - Intergenic
1193318550 X:80093546-80093568 AAAGAACTTAGAACAATGCCTGG + Intergenic
1193628298 X:83847363-83847385 AAAGCACCTGCCACCATGCCTGG - Intergenic
1193898141 X:87140426-87140448 AAATCACTTGGAATAATGCCTGG + Intergenic
1194037793 X:88899862-88899884 CAGGCACTTGCCACCATGCCTGG - Intergenic
1194113801 X:89872005-89872027 GAAGTACTCGTAAGCATGCCAGG - Intergenic
1194446016 X:93987499-93987521 CAGGCACCTGCAACCATGCCCGG - Intergenic
1194704906 X:97163330-97163352 CAAGCACATGGCACCACGCCTGG + Intronic
1195076284 X:101329980-101330002 CAGGCACTTGCCACCATGCCTGG + Intergenic
1195348005 X:103970391-103970413 AAAGCACTTAGAACAATGCCTGG + Intergenic
1195355485 X:104035748-104035770 AAAGCACTTAGAAAAATGCCTGG + Intergenic
1195359437 X:104068450-104068472 AAAGCACTTAGAACAATGCCTGG - Intergenic
1195676098 X:107507979-107508001 TAAGCACTTAGAACTGTGCCTGG - Intergenic
1196102081 X:111857061-111857083 GAAGTGCTTAGAACTATGCCTGG + Intronic
1196177118 X:112651319-112651341 AAAACACTTGGAACATTGCCTGG + Intronic
1196202340 X:112899900-112899922 CAAGCACTGGCCACCATGCCCGG + Intergenic
1196681789 X:118476934-118476956 GAAGCACGGGCCACCATGCCCGG + Intergenic
1196811382 X:119631723-119631745 CAGGCACGTGCAACCATGCCTGG + Intronic
1196989737 X:121315212-121315234 TAAGGCCTTGGAACCATGTCTGG + Intergenic
1197752333 X:129973907-129973929 TAAGCACTTAGAACAGTGCCTGG - Intergenic
1197790691 X:130251137-130251159 GAAGTACTTGCCATCATGCCTGG - Intronic
1197999495 X:132418329-132418351 AAAGCACTTTGAACAATGCCTGG - Intronic
1198470939 X:136946296-136946318 CAGGCACTTGCCACCATGCCTGG - Intergenic
1198760085 X:140023101-140023123 TAAGCACCTGCCACCATGCCTGG - Intergenic
1199014360 X:142795692-142795714 AAAGCACTTGAAACAGTGCCTGG - Intergenic
1199337803 X:146640816-146640838 GAGGCACTTGACACCATGCCTGG + Intergenic
1199449219 X:147960901-147960923 GAAGCACTTAGGCTCATGCCTGG + Intergenic
1199655576 X:149991745-149991767 GAAGCACTTAAAACAAGGCCTGG + Intergenic
1199711702 X:150474124-150474146 GAAGCACCAGGTCCCATGCCTGG - Intronic
1199722446 X:150551600-150551622 CAAGCGCTTGCCACCATGCCCGG - Intergenic
1199791153 X:151156485-151156507 AAAACACTTGGAACAGTGCCTGG - Intergenic
1200022668 X:153225282-153225304 GAAGCTCTTGGTACCGTGCCTGG + Intergenic
1200466537 Y:3527360-3527382 GAAGTACTCGTAAGCATGCCAGG - Intergenic
1201366624 Y:13213488-13213510 CAAGCACATGCCACCATGCCCGG + Intergenic
1201450784 Y:14111641-14111663 GAGGCACATGCCACCATGCCTGG + Intergenic
1201590309 Y:15607460-15607482 AAAGCACTTAGAATCATGTCTGG - Intergenic
1202039531 Y:20667615-20667637 GAGGCACATGCTACCATGCCTGG - Intergenic
1202108187 Y:21392134-21392156 GAGGCACCTGTGACCATGCCAGG - Intergenic
1202364180 Y:24144602-24144624 CAGGCACATGCAACCATGCCCGG + Intergenic
1202371952 Y:24204982-24205004 GAAGCTCCTGCCACCATGCCCGG + Intergenic
1202498833 Y:25465134-25465156 GAAGCTCCTGCCACCATGCCCGG - Intergenic
1202506600 Y:25525520-25525542 CAGGCACATGCAACCATGCCCGG - Intergenic