ID: 1153341606

View in Genome Browser
Species Human (GRCh38)
Location 18:3980445-3980467
Sequence ATTTGTGTCCAAAATGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153341606 Original CRISPR ATTTGTGTCCAAAATGAAGT GGG Intronic
900889309 1:5438093-5438115 ATGTGAGTCCAAAATCCAGTAGG + Intergenic
902594612 1:17500400-17500422 AATTGTGTGAAAAATGATGTTGG + Intergenic
902648704 1:17822712-17822734 ATGTGTGTGCAAAGTGCAGTGGG + Intronic
905442475 1:38004265-38004287 ATTTGAGTTCAAAAATAAGTTGG + Intronic
906249844 1:44302507-44302529 AGAGGTGTCCAAAGTGAAGTTGG + Intronic
907390306 1:54153753-54153775 CTTTGTGTCCAACAGGAAGCGGG + Exonic
907561324 1:55391416-55391438 ATTTCTGTGAAAAATGATGTTGG + Intergenic
908587901 1:65593933-65593955 ATTGTTTTTCAAAATGAAGTAGG + Intronic
908683492 1:66688751-66688773 ATTTATGTCCAAGATGAAAATGG - Intronic
910512653 1:88023912-88023934 AATTCTGTGAAAAATGAAGTTGG + Intergenic
910548652 1:88450700-88450722 ATTTGTGGCAAAAATGCAATTGG - Intergenic
911239110 1:95446191-95446213 ATTTGTGTCCTTAAAAAAGTGGG - Intergenic
911656761 1:100452806-100452828 ATTTGTTTACAAAATGTGGTAGG + Intronic
917823103 1:178786840-178786862 ATTTATGTCCTACATGATGTAGG + Intronic
918423851 1:184388374-184388396 ATTTGTTTTCAATAGGAAGTCGG + Intronic
920060300 1:203222647-203222669 ATCTGTGTGCACACTGAAGTGGG - Intronic
920615205 1:207485720-207485742 ATTAGTTGGCAAAATGAAGTAGG - Intronic
921258984 1:213368874-213368896 TTTTATGTGCAAGATGAAGTAGG + Intergenic
923623693 1:235597298-235597320 AGTTGAGGCCAAAATGAATTTGG - Intronic
923907896 1:238406112-238406134 ATTTGTGTCAAAAAAGAACAGGG - Intergenic
924334771 1:242976278-242976300 ATTTGTGTTCAAACTGATTTGGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063958408 10:11285911-11285933 ATTTTTGTCCTAAAGGAACTTGG + Intronic
1064390302 10:14936249-14936271 ATTTGTTCCCAAATTGAACTAGG - Intronic
1064680123 10:17802601-17802623 ATTTGTTTCAAAAATTAAATGGG + Intergenic
1065451944 10:25868520-25868542 ATTTGTGACTAAAATGATTTGGG + Intergenic
1066708769 10:38209673-38209695 ATTTGTTTCAAAAAAGAATTTGG + Intergenic
1066980730 10:42412820-42412842 ATTTGTTTCAAAAAAGAATTTGG - Intergenic
1067131291 10:43567826-43567848 TTTTGTGTCAAAAAGGAAGTAGG + Intronic
1068722180 10:60257771-60257793 ATTTGTTTCCAAAAAGATTTCGG - Intronic
1068749750 10:60578601-60578623 ATTTGAGTCCACAGTGAAATGGG + Intronic
1069012664 10:63391760-63391782 ATTTCTGTGAAAAATGATGTTGG - Intronic
1069013034 10:63395703-63395725 AGATGTCCCCAAAATGAAGTGGG + Intronic
1071535585 10:86426774-86426796 ATTTATGACTTAAATGAAGTGGG - Intergenic
1071791899 10:88963739-88963761 TTTTGGGTCAAAAAAGAAGTAGG + Intronic
1071809152 10:89159705-89159727 TTTCTTTTCCAAAATGAAGTTGG - Intergenic
1073230091 10:101961984-101962006 AATAGTTTCTAAAATGAAGTGGG + Intronic
1073476103 10:103754970-103754992 ATTTGTGTGCACCATAAAGTTGG - Intronic
1073961959 10:108942242-108942264 ATTTGTGTCTAAAAGCAAGGCGG - Intergenic
1074075863 10:110123934-110123956 ATTTGTATACAAAAGGAATTAGG + Intronic
1074657668 10:115612802-115612824 ATTTGTGTCAAAAATTAAGCTGG - Intronic
1079019123 11:16894630-16894652 AATAGTGCCCAAAATGAAGAAGG + Intronic
1079117696 11:17651107-17651129 CTTTGTGTCCAGAATGATTTAGG + Intergenic
1080207003 11:29741364-29741386 ATTTTTGTCCAAAATATTGTGGG + Intergenic
1080739394 11:35049550-35049572 ATGTATGTCCAAAATCCAGTAGG - Intergenic
1081007181 11:37759555-37759577 ATTTGTTGCAAAAATGAATTTGG + Intergenic
1081019052 11:37920441-37920463 ATTTGTGACTAAAATCAATTGGG - Intergenic
1081294925 11:41373924-41373946 ATTTGTTTAAAAAATAAAGTTGG + Intronic
1084170662 11:67399394-67399416 ATGTGTGTCCTACATGGAGTGGG - Intronic
1084894523 11:72256069-72256091 ATTAGTATCCCAAATGAAATAGG + Intergenic
1084907724 11:72361139-72361161 ATGTTTGGCCAAAATAAAGTTGG + Intronic
1087107723 11:94428005-94428027 ATTTCTGTGAAAAATGACGTTGG - Intronic
1087676475 11:101168458-101168480 ACTTGTGTCTAAAATGAACCAGG - Intergenic
1088197535 11:107291949-107291971 ATTTTTGTGAAAAATGATGTTGG + Intergenic
1088520831 11:110697948-110697970 AATTGTGTGAAAAATGAAATTGG + Intronic
1092167570 12:6352347-6352369 ATTTGGGTCAGAAATGAAGAAGG - Intronic
1093103853 12:15061425-15061447 ATTTCTGTCAAAAATGACCTTGG + Intergenic
1094068630 12:26388314-26388336 ATTTGAGTGCCAAGTGAAGTGGG + Intronic
1098466512 12:70793128-70793150 ATTTGTGCCCTAATTGAAGAGGG + Intronic
1099211753 12:79799706-79799728 ATCTGTGTCAAAAGTTAAGTAGG + Intronic
1100466591 12:94851018-94851040 ATTTCTGTGAAAAATGATGTTGG - Intergenic
1100787735 12:98096454-98096476 ATGTGAGTCCAAAATCCAGTGGG - Intergenic
1100906048 12:99300662-99300684 TGTTGTGTTCAAAATGCAGTAGG + Intronic
1103412633 12:120723552-120723574 CTTTGTGTCCAAAGTAAACTAGG + Exonic
1106472593 13:30070832-30070854 ATTTGTTTCAAAAATGCAATGGG - Intergenic
1106544768 13:30720924-30720946 ATTTGTGCCCACAGAGAAGTGGG - Intronic
1106975839 13:35213154-35213176 TTTTGTGACTAAAATGAGGTAGG + Intronic
1107183151 13:37485572-37485594 ATCTCTGTCAAAAAAGAAGTAGG + Intergenic
1107324718 13:39229468-39229490 ATTAGTGTTAAAAATGAATTGGG - Intergenic
1107510384 13:41078107-41078129 AATTCTGTAAAAAATGAAGTTGG - Intronic
1107766243 13:43738005-43738027 ATTTGGGTCTAAATTAAAGTAGG - Intronic
1108951717 13:56102570-56102592 GTTTGTGTCCAAAAAGAAGTAGG + Intergenic
1109155139 13:58900524-58900546 ATTTGTAGCAAAAATGTAGTTGG - Intergenic
1109608858 13:64737093-64737115 ATTTTTCTCCAAAATTATGTTGG + Intergenic
1109815076 13:67570933-67570955 AGTTTTCTCAAAAATGAAGTTGG - Intergenic
1110395989 13:75029793-75029815 ATATGAGTCCAAAATCCAGTGGG - Intergenic
1111112957 13:83739019-83739041 ATTTGTGTCCAAAAATGTGTTGG + Intergenic
1111549493 13:89787963-89787985 AATTTTATTCAAAATGAAGTCGG + Intergenic
1111886711 13:94030501-94030523 ATCTGTGTGGAAAATGGAGTTGG - Intronic
1111938046 13:94577848-94577870 ATATGTGTCTTAAATTAAGTTGG - Intronic
1112057408 13:95702972-95702994 ATTTGTGTATAAAATAAAATTGG + Intronic
1112485252 13:99813985-99814007 ATTTCTGTGCAAAATGAAGTAGG - Intronic
1112954042 13:105037647-105037669 ATTTGTGAACAAAATCAAGAAGG + Intergenic
1113035094 13:106039485-106039507 ATTTGTTTCAATTATGAAGTAGG - Intergenic
1114325529 14:21585050-21585072 ATGTGTGACAAAAATAAAGTGGG - Intergenic
1114757574 14:25277460-25277482 ATTTGTATTCCAAATGAATTAGG + Intergenic
1115052968 14:29087299-29087321 ATTTCTGTGTAAAATGATGTTGG - Intergenic
1115572894 14:34683520-34683542 ACTTGTGTCAAAAATACAGTGGG - Intergenic
1120568679 14:86091068-86091090 ATTTGTTTCCAAAATAAACTGGG + Intergenic
1120652288 14:87149350-87149372 ATTTGTGTCCAAAATTAGCATGG + Intergenic
1123140333 14:106071131-106071153 ATTTATGCCCAAAATTAATTTGG - Intergenic
1123541121 15:21292725-21292747 ATTTATTTCCAAATTGAAGGGGG + Intergenic
1124133697 15:27013883-27013905 ATTTCTGCCAAAAATGCAGTTGG + Intronic
1125405077 15:39343963-39343985 ATTTCTGTCTAAAATGGAGAGGG - Intergenic
1125416752 15:39461796-39461818 ATTAGTCTTCAGAATGAAGTTGG - Intergenic
1126297873 15:47161531-47161553 TTTTGTGTGCAAAGTGATGTTGG - Intergenic
1126526752 15:49664809-49664831 AGCTGTTTCCAAAATGAAGATGG - Intergenic
1127032729 15:54881709-54881731 AGATTTGTCCAAAGTGAAGTGGG - Intergenic
1128246726 15:66138089-66138111 TTTTGTTTTCAAAATGAAGGTGG - Intronic
1128478202 15:68015318-68015340 ATTTGTGCCCAGAATGCACTGGG + Intergenic
1129291634 15:74572646-74572668 ATTTGGTTCCAAAATAAAGAGGG - Intronic
1202949434 15_KI270727v1_random:19866-19888 ATTTATTTCCAAATTGAAGGGGG + Intergenic
1133407848 16:5539862-5539884 ATTTTGGTCACAAATGAAGTAGG + Intergenic
1133700706 16:8305712-8305734 ATTTTTGTCCAAAATGATCTGGG - Intergenic
1136642448 16:31578228-31578250 ATGTGAGTCCAAAATCCAGTAGG - Intergenic
1137742144 16:50789030-50789052 AGTTCTCTACAAAATGAAGTGGG + Intronic
1139793476 16:69461766-69461788 ATTAGTGTCCAAACTTAACTAGG + Intronic
1141709656 16:85690557-85690579 CTTTATCTTCAAAATGAAGTAGG + Intronic
1144030975 17:11323270-11323292 ATTTGTATCATAAAGGAAGTTGG - Intronic
1144834302 17:18148898-18148920 CTCTGTGCCCACAATGAAGTAGG - Exonic
1149466110 17:56880430-56880452 CTCAGTGTCCAGAATGAAGTGGG - Intergenic
1149956467 17:61056203-61056225 ATTAGTGGCCAAAATAAAGATGG + Intronic
1150587953 17:66535458-66535480 ATTTGGGTCCAAGATGGAGCAGG - Intronic
1152056187 17:78028882-78028904 TTTTGTGTACAAGATGAGGTGGG + Intronic
1153341606 18:3980445-3980467 ATTTGTGTCCAAAATGAAGTGGG + Intronic
1153678402 18:7476791-7476813 ATTTGAGCCCAAGATGAAGGAGG - Intergenic
1153855577 18:9142492-9142514 AGTTGTGTACAATATGAATTTGG - Intronic
1157692272 18:49693175-49693197 AGCTGTGTCCAAAATGAATTAGG + Intergenic
1157898530 18:51491246-51491268 AGTTGTACCTAAAATGAAGTAGG - Intergenic
1157950138 18:52027421-52027443 ATTTTTTTCCAAATTAAAGTTGG - Intergenic
1159819213 18:73118706-73118728 ATTTCTGTGAAAATTGAAGTAGG - Intergenic
1163230158 19:15996265-15996287 ATGTAAGTCCAAAATGCAGTAGG - Intergenic
1164519331 19:28966382-28966404 ATTTGAGTTCAAAAGGAAGGTGG + Intergenic
1166717755 19:44979551-44979573 ATTTTTGTACTAAAAGAAGTAGG - Intronic
925581361 2:5414672-5414694 ACTTGTGACCAAAAGGAAATGGG + Intergenic
925703677 2:6663947-6663969 ATTTGCGTGCACATTGAAGTTGG - Intergenic
928177615 2:29045592-29045614 GTTTTTGATCAAAATGAAGTAGG + Intronic
928799661 2:35072205-35072227 AGTTCTGTGGAAAATGAAGTTGG - Intergenic
928898152 2:36288486-36288508 ATGTATGTCCAAAAGAAAGTTGG + Intergenic
930712116 2:54558949-54558971 ATTTGTGACCCTAATGAAGACGG + Intronic
931852533 2:66266179-66266201 ACTTGTGCCAAAAATGAAGCAGG - Intergenic
932037953 2:68267297-68267319 AATTTTGTGAAAAATGAAGTTGG - Intergenic
932133457 2:69208078-69208100 AATTGTGTCAAAAAGGAAGAGGG + Intronic
932939452 2:76145492-76145514 ATTTGGGTAGAAAATAAAGTAGG + Intergenic
932967416 2:76492826-76492848 TTTTGTTACCAAAAGGAAGTAGG + Intergenic
933417857 2:82009952-82009974 ATTAGTATCCAGCATGAAGTAGG + Intergenic
934578838 2:95421790-95421812 ATTTATGGCTCAAATGAAGTCGG + Intergenic
934600609 2:95654913-95654935 ATTTATGGCTCAAATGAAGTCGG - Intergenic
935298791 2:101674675-101674697 ATTTGTCTCAAAAACAAAGTGGG + Intergenic
936534107 2:113298224-113298246 GTTTGTGTCCAAAATTAAGGGGG - Intergenic
936724004 2:115290334-115290356 AAATGTGTCCAAAATTAAGATGG + Intronic
936911965 2:117602612-117602634 ATTTGGGACCAAAATGAATCAGG - Intergenic
936965622 2:118125013-118125035 TTTTGTTTCCCAAATCAAGTTGG - Intergenic
937045992 2:118852205-118852227 AATTCTGTCCAAAGTGGAGTGGG + Intergenic
937934755 2:127234233-127234255 ATCTTTGTCAAAAATGAAATTGG - Intergenic
939508724 2:143080395-143080417 ATTTCTTTCCATAATTAAGTTGG - Intergenic
939730743 2:145781794-145781816 ATTTGTGTCTAAGACGTAGTAGG - Intergenic
940846155 2:158644093-158644115 AATTGTGTCCCACATGCAGTAGG + Intronic
943348146 2:186765263-186765285 ATTTGTGACCAAAATCATCTAGG - Exonic
943498573 2:188656203-188656225 ATCTTAGTCCAAAATGAACTAGG - Intergenic
944148933 2:196536911-196536933 ATTTGTGTCCCTAGTGAATTTGG - Intronic
944829354 2:203517120-203517142 ATTTGTGTCTATATTAAAGTGGG - Intronic
945083841 2:206111647-206111669 ACTTGTGTCCAGTATAAAGTTGG - Intergenic
1169611488 20:7385208-7385230 ATTTATGTTCAAAATGATATTGG - Intergenic
1170070848 20:12365110-12365132 AATTATGTGCAATATGAAGTTGG - Intergenic
1170224600 20:13977967-13977989 ATTTTTGTGAAAAATGATGTTGG - Intronic
1170251049 20:14282992-14283014 AGTTGTGTCCAGTATGATGTAGG - Intronic
1170297968 20:14850074-14850096 ACTTGTGGCCAAAATAACGTAGG + Intronic
1170536177 20:17343209-17343231 ATCTGTCTCCCAAATGTAGTTGG - Intronic
1170619779 20:17986046-17986068 ATTTCTGTGAAAAATGATGTTGG + Intronic
1170899051 20:20442886-20442908 ATTTATGTGAAAAATGAAATTGG - Intronic
1172137875 20:32699687-32699709 ATTCGTGTCCAGGATGGAGTGGG + Intergenic
1175413019 20:58784038-58784060 ATGAGACTCCAAAATGAAGTTGG + Intergenic
1175421239 20:58835189-58835211 ATTTCTGTCCAAAGGAAAGTTGG + Intergenic
1176690297 21:9899777-9899799 ATTTTTGTCTCAAATGAATTTGG - Intergenic
1177372247 21:20218904-20218926 AACTGTGTCCAAAATGGATTAGG - Intergenic
1179590226 21:42403233-42403255 TTTTGTTTCCAAAATGAGGCGGG - Intergenic
1179919720 21:44501038-44501060 TTTTGTGTACAATGTGAAGTGGG + Intronic
1182327841 22:29527482-29527504 ATTTGTGTAAAAAATAAAGTGGG + Intronic
1183148068 22:36013776-36013798 ATTTGTGTCAAAAAGAAAGGAGG + Intronic
950243574 3:11394054-11394076 ATTTGTGTATAAAATTGAGTGGG - Intronic
950315724 3:12000417-12000439 AATTGTGTTCAAAATTCAGTGGG + Intergenic
951334423 3:21404483-21404505 ATTTCTGTGAAAAATGACGTTGG - Intergenic
952592477 3:34973945-34973967 ATGAGTGTCGAAAATGAAGATGG + Intergenic
955222648 3:57036082-57036104 AATTGTGTCCAAAAAGAGTTTGG - Intronic
956757856 3:72406890-72406912 GTTTGTATCAAAAATGCAGTAGG + Intronic
956910425 3:73810470-73810492 ATTTGTGTCCACAATGTGGGTGG + Intergenic
958194998 3:90232844-90232866 ATTTGTTTACAAAATGCAGATGG + Intergenic
958471678 3:94528902-94528924 ATTTGCGTCTAACATCAAGTTGG + Intergenic
958984026 3:100759548-100759570 ATTTGTGTCCCCACAGAAGTGGG - Intronic
959289670 3:104457821-104457843 GTGTGTGTGCAAAATGAGGTCGG - Intergenic
959721033 3:109489410-109489432 ATTTATATGCAAAAAGAAGTTGG + Intergenic
960354466 3:116634118-116634140 AATTGTGTGGAAAATGTAGTGGG + Intronic
961024125 3:123538021-123538043 ATTTCTGACCAAAATGGAGAAGG + Intronic
961178094 3:124852472-124852494 AATTCTGTGCAAAATGCAGTTGG - Intronic
962650645 3:137485900-137485922 ATTTCTGTAAAAAATGATGTTGG + Intergenic
964031481 3:152144192-152144214 ATTTGTTGCTAAAATGGAGTAGG - Intergenic
965177405 3:165353063-165353085 ATATGTCTCCTAAATGATGTTGG + Intergenic
965565146 3:170107966-170107988 ATGTGTGCCCAAAAGGTAGTAGG + Intronic
965966635 3:174499305-174499327 ACTTGTATCCAAAATGTAGGAGG - Intronic
966292097 3:178371485-178371507 ATTTGAGCTCAAATTGAAGTAGG - Intergenic
968208827 3:196829308-196829330 ATTTATTTCCAAATTGAAGGGGG - Exonic
969191453 4:5524346-5524368 TTTTGAGTCAAAACTGAAGTAGG - Intergenic
969231772 4:5836939-5836961 ATTTGCCTTCAAAATGAACTAGG - Intronic
970222598 4:13825836-13825858 ATTTGAGTCCAAAGTCCAGTGGG - Intergenic
971060384 4:22962065-22962087 ATTTATTTCCAAAATGAATATGG - Intergenic
971591405 4:28473695-28473717 ATTTTTGTCCAAAATCCAGTGGG - Intergenic
973006329 4:45011172-45011194 TTTGGTTTCCAAAAGGAAGTTGG + Intergenic
973657967 4:53070454-53070476 ATTTGTATCCAAAATGATGAAGG + Intronic
973673480 4:53240524-53240546 AGTTGTATGCAAAAAGAAGTTGG - Intronic
973755043 4:54065841-54065863 AGTTGTTTCCAAAAGGAGGTTGG - Intronic
974662354 4:64908675-64908697 ATTCATTTCCAAAATTAAGTAGG + Intergenic
974921581 4:68247804-68247826 TTTTGTGTACATGATGAAGTGGG + Intergenic
976050947 4:81010999-81011021 ATTTATGTCCAAAATAAACAAGG + Intergenic
976192993 4:82506745-82506767 ATTTATGTCCAAAAAGTTGTGGG + Intronic
976785269 4:88812397-88812419 ATTTTTATCCCAAATGCAGTGGG - Intronic
978691750 4:111521609-111521631 ATGTGGTTCCAAAATCAAGTAGG - Intergenic
979913495 4:126401509-126401531 ATTTGTGTGTAGTATGAAGTAGG + Intergenic
981998780 4:151003075-151003097 ATTTCTGTGAAAAATGATGTTGG - Intronic
982029024 4:151280362-151280384 ATCTGTGTCCAAACTCACGTTGG - Intronic
983227182 4:165096096-165096118 ATTTGAGTTCAAAATGTATTTGG - Intronic
983261674 4:165463689-165463711 GTTTATCTGCAAAATGAAGTTGG + Intronic
983933487 4:173478043-173478065 ATTTATCTCCAAAATCCAGTTGG - Intergenic
985020866 4:185688689-185688711 CTGTGTTTACAAAATGAAGTAGG - Intronic
985857758 5:2443372-2443394 ATTTCTGTCCAAACTTAGGTGGG - Intergenic
986376677 5:7139119-7139141 AGTTGTGGCCAAAAGGAGGTAGG - Intergenic
988041395 5:25892868-25892890 AATTGTGTACAAAATAAAATGGG + Intergenic
988320880 5:29695030-29695052 ATTTATGTGGAAAATCAAGTGGG - Intergenic
990254215 5:53948229-53948251 GTAAGTGTCCAAAATAAAGTTGG + Intronic
991095723 5:62737788-62737810 GTTTGTGGCCAAGATGAAGAAGG + Intergenic
991284912 5:64962400-64962422 ATTTGGGTCCAAAATCCACTTGG - Intronic
991433189 5:66569265-66569287 ATTAAAGTTCAAAATGAAGTAGG + Intergenic
992148908 5:73881120-73881142 ATTTTTGTCAAAAATCATGTGGG + Intronic
992353961 5:75960541-75960563 ATTTGTGGCCAAAAAGCAATAGG + Intergenic
992375596 5:76185084-76185106 ATGTGAGTCCAAAATCCAGTAGG + Intronic
993331076 5:86600715-86600737 ATTTCTGTGAAAAATGATGTTGG - Intergenic
993593212 5:89821859-89821881 AATTCTGTGCAAAATGATGTTGG + Intergenic
994270928 5:97775615-97775637 ATTTCTGTGAAAAATGATGTTGG - Intergenic
996024501 5:118629648-118629670 ACTTGTCTCCAAGATGGAGTCGG - Intergenic
997520072 5:134517586-134517608 ATTTGTGTGCATAGTGTAGTCGG + Intergenic
998907756 5:146924720-146924742 CTTTGTGTCCAGAATTATGTAGG + Intronic
999853938 5:155572883-155572905 ATCTTGGTCAAAAATGAAGTTGG + Intergenic
1000375042 5:160572928-160572950 ATTTGTGTTCAAGATGAAAGAGG - Intronic
1002439848 5:179258634-179258656 ATATGTGTCCAGAATGATCTGGG + Intronic
1002687655 5:181026853-181026875 ATTTGTGACAAAAGTTAAGTTGG + Intergenic
1003757653 6:9139985-9140007 ATTTGTGGTCCAAATGAAGTTGG - Intergenic
1004662716 6:17724391-17724413 ATTTTATTCCAAAATGAGGTAGG + Intergenic
1006982134 6:38155168-38155190 ATCTCTGTCCTAAAAGAAGTGGG - Intergenic
1008727023 6:54434060-54434082 ATATGTTTCCAAAATGAATAGGG - Intergenic
1010955544 6:82087113-82087135 ATTTGTGTTCAATATGACGCAGG - Intergenic
1011991906 6:93531680-93531702 AGTTTTGTCGAAAGTGAAGTAGG - Intergenic
1013865037 6:114686109-114686131 ATTTGTTTCTATAATTAAGTTGG - Intergenic
1014310599 6:119796273-119796295 AATTCTGTGAAAAATGAAGTTGG + Intergenic
1014354992 6:120397137-120397159 ATTTCTGTGAAAAATGATGTTGG - Intergenic
1014819350 6:125969526-125969548 AGTTGTGTGAAAAATGATGTTGG + Intronic
1015647756 6:135413400-135413422 ATTTCTGACCAAAATGGAGTAGG + Intronic
1016426290 6:143939214-143939236 CTTTCTGTCCAAATTTAAGTAGG + Intergenic
1016516650 6:144900131-144900153 TTTTGTGTGTAATATGAAGTGGG + Intergenic
1016546512 6:145229937-145229959 ATTTGTGCCCAAAAGCAAATGGG - Intergenic
1016676381 6:146774522-146774544 AATTGTATTTAAAATGAAGTAGG + Intronic
1016708430 6:147141247-147141269 CTTTGTAGACAAAATGAAGTGGG - Intergenic
1017242554 6:152187117-152187139 ATTTGAGTTCAAAATGAATTTGG - Intronic
1017397041 6:154013476-154013498 AATTTTGTCCAAAATGAAATTGG - Intronic
1017734069 6:157344864-157344886 ATTTTTGTCAAAAATCAATTGGG + Intergenic
1017942168 6:159062429-159062451 ATCTGTGTCAGAAAGGAAGTGGG + Intergenic
1018043255 6:159943654-159943676 ATTTATGTCCCTAATGAAGAGGG + Intergenic
1018406316 6:163486311-163486333 ATTTGTTTCCCAAATGTATTTGG + Intronic
1018448606 6:163883129-163883151 ATTTCTGTGAAAAATGATGTTGG - Intergenic
1020732840 7:11905882-11905904 ATTTGGGCCCAAAAGGAATTAGG - Intergenic
1022633850 7:32112358-32112380 ATATTTGTCAAAAATGAAGTTGG - Intronic
1024127155 7:46310975-46310997 ATTTGTGTCCAAAACAAAGGTGG - Intergenic
1027558989 7:79703560-79703582 AATTCTGTCAAAAATGATGTTGG - Intergenic
1028053982 7:86221156-86221178 ATTTGTGTCCCTAAAGAAGATGG + Intergenic
1028305293 7:89255586-89255608 ATTTGTGTACAGTATGATGTAGG - Intronic
1029646937 7:101863048-101863070 ATTTGTTTCAAAATTTAAGTCGG - Intronic
1031028690 7:116711713-116711735 ATTTGTCTCCAAAGTGCTGTTGG + Intronic
1031202904 7:118713564-118713586 ATTTCACTCCAAACTGAAGTAGG + Intergenic
1031778817 7:125937269-125937291 ATGTGTCTCCAAAATGAGGCAGG - Intergenic
1031910537 7:127512651-127512673 AATGTTGGCCAAAATGAAGTAGG + Intergenic
1032672216 7:134095436-134095458 AATTCTGTGAAAAATGAAGTTGG - Intergenic
1034914745 7:155027616-155027638 ATTAGTTTACCAAATGAAGTGGG - Intergenic
1037382192 8:18297860-18297882 ATTTCTGTGTAAAATGATGTTGG + Intergenic
1038322695 8:26543021-26543043 ATTTTTGTCCCAAAAGAGGTGGG - Intronic
1040976152 8:53196386-53196408 CTTTGTGTGTAAAATGAAGCAGG + Intergenic
1041483045 8:58344465-58344487 ACCTGTGTCCACAATGAAGATGG - Intergenic
1042734350 8:71970932-71970954 ATTTGAGGCCAAATTAAAGTGGG - Intronic
1045095740 8:98796108-98796130 AGTTTTGTCCAAAATGATGTTGG - Intronic
1045375762 8:101572323-101572345 ATATGTGTCTTAAAAGAAGTTGG - Intronic
1046143404 8:110124170-110124192 AATTGTGTCCAACATTAAGAAGG - Intergenic
1046524236 8:115363713-115363735 ATTAAGGTCCAAAATCAAGTTGG - Intergenic
1046963268 8:120132578-120132600 ATTTCTGTGAAAAATGATGTAGG + Intronic
1046981256 8:120338962-120338984 ATTTATTTCCAAAAAGAATTTGG + Intronic
1048460369 8:134616331-134616353 TTTGGTGTCCAAAAGGGAGTGGG - Intronic
1048629770 8:136229582-136229604 AGTTGTTTCCAAATTAAAGTAGG - Intergenic
1050377688 9:4989838-4989860 AATTGTGTTAAAAATGTAGTTGG + Intronic
1051455568 9:17253294-17253316 ATTTCTGTGAAAAATGATGTTGG + Intronic
1051969244 9:22866721-22866743 TTTTGTGTCCAAATTTATGTTGG + Intergenic
1052242348 9:26289456-26289478 ATTTATGTGAAAAATGATGTTGG + Intergenic
1052328016 9:27237950-27237972 ATTTGTGACATGAATGAAGTTGG + Intergenic
1053627028 9:39884290-39884312 ATTTTTGTCTCAAATGAATTTGG - Intergenic
1053651524 9:40174740-40174762 TTAAGTGTCCAAAATGAAGGTGG + Intergenic
1053754035 9:41285036-41285058 ATTGGTTTACAAAAGGAAGTTGG + Intergenic
1053778963 9:41581730-41581752 ATTTTTGTCTCAAATGAATTTGG + Intergenic
1054166923 9:61791970-61791992 ATTTTTGTCTCAAATGAATTTGG + Intergenic
1054216859 9:62366413-62366435 ATTTTTGTCTCAAATGAATTTGG + Intergenic
1054332219 9:63770640-63770662 ATTGGTTTACAAAAGGAAGTTGG - Intergenic
1054670623 9:67788928-67788950 ATTTTTGTCTCAAATGAATTTGG - Intergenic
1054857459 9:69916229-69916251 ATATTTGGCCAAAAGGAAGTGGG + Intergenic
1055194554 9:73572787-73572809 ATTGGTGTGAAAACTGAAGTGGG + Intergenic
1055794673 9:79962824-79962846 ACTTGGGGCCAAAATGAAGCAGG - Intergenic
1056041247 9:82669832-82669854 ATTTGTCTCCGGCATGAAGTGGG - Intergenic
1056219869 9:84440755-84440777 ATCTGTTTCCATAATGTAGTTGG + Intergenic
1056490934 9:87106278-87106300 ATATTTGTACAACATGAAGTTGG + Intergenic
1058319686 9:103613555-103613577 ATTTGTGTGAAAAATGTAATTGG + Intergenic
1058462996 9:105200163-105200185 AGTTGTTTCCAAAATGATCTTGG - Intergenic
1059905488 9:118980202-118980224 ATTTGTGTCAAAGATGATATGGG - Intergenic
1060061712 9:120466587-120466609 ATTTGTGTCTCAAATGAAGTTGG + Intronic
1188381948 X:29505840-29505862 ATTTGTGTTCAAGAGGGAGTCGG - Intronic
1188903014 X:35758453-35758475 ATTTGTGTCAAGAATGTCGTTGG + Intergenic
1189607515 X:42695565-42695587 ATTTCTGTCCACACTGAAGTGGG + Intergenic
1189679230 X:43497895-43497917 ATTTGTGTCAATAATGAAATGGG - Intergenic
1191900082 X:66031849-66031871 ATTTGGGTTTACAATGAAGTGGG + Intronic
1192967005 X:76188130-76188152 ATTTTTGTGAAAAATGATGTTGG + Intergenic
1193572598 X:83162157-83162179 ACTTGTGTCCAAAATCCTGTTGG + Intergenic
1193840455 X:86402645-86402667 AATTGTGTGAAAAATGATGTTGG - Intronic
1194219889 X:91177066-91177088 ATGTGAGTCCAAAATCCAGTGGG - Intergenic
1194397798 X:93407503-93407525 TTTTGTGGCCAACATAAAGTAGG - Intergenic
1194835554 X:98677734-98677756 ATTTGTTCCAAAGATGAAGTGGG - Intergenic
1195002848 X:100658634-100658656 ATTTCTGTGAAAAATGATGTTGG + Intronic
1196979944 X:121201471-121201493 AGTTCTGTGAAAAATGAAGTTGG + Intergenic
1197499156 X:127222624-127222646 ATTTGAGTCCAAAATTCAGCAGG - Intergenic
1197577362 X:128231947-128231969 TTTTGAGTCCAAAAGGCAGTGGG + Intergenic
1197684440 X:129424339-129424361 ATTTATGTAAAAAATGAAATTGG + Intergenic
1198026922 X:132715974-132715996 CTTGGTTTCCAAAATGCAGTCGG - Intronic
1199288192 X:146077066-146077088 ATTTCTGTTGAAAAGGAAGTGGG + Intergenic
1200556395 Y:4640827-4640849 ATGTGAGTCCAAAATCCAGTGGG - Intergenic
1201310172 Y:12589945-12589967 TTTTGGGTCCAAAATTAACTTGG + Intergenic