ID: 1153343964

View in Genome Browser
Species Human (GRCh38)
Location 18:4006529-4006551
Sequence TTGCAGTCACAGTTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153343960_1153343964 -8 Left 1153343960 18:4006514-4006536 CCAGCTGTTGAATTTTTGCAGTC 0: 1
1: 0
2: 1
3: 14
4: 191
Right 1153343964 18:4006529-4006551 TTGCAGTCACAGTTGGAGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153343964 Original CRISPR TTGCAGTCACAGTTGGAGGA GGG Intronic
900909252 1:5583200-5583222 TTGCGATCACAGCTGCAGGATGG - Intergenic
902598666 1:17526187-17526209 TTGCAGCCACACAGGGAGGAAGG - Intergenic
902770408 1:18642642-18642664 TTTCAGCCAGAGTTGGGGGAAGG - Intronic
906690201 1:47787546-47787568 ATGCAATCACAGCTAGAGGAGGG - Intronic
908613552 1:65890617-65890639 CTGCAATCAGAGTTGTAGGAGGG + Intronic
910989369 1:93039127-93039149 TTTGAGTCACAACTGGAGGATGG + Intergenic
911620754 1:100064533-100064555 TTGGGGTCACAGGTGGAGCATGG - Intronic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
919455759 1:197818217-197818239 ATGCAGCCACTGCTGGAGGATGG - Intergenic
920279890 1:204834817-204834839 TGGCACCCAGAGTTGGAGGAAGG + Intronic
922761496 1:228134796-228134818 TTGCAGTCAGAGTCAGAGGTCGG - Intergenic
922967186 1:229700202-229700224 TACAAGTCACAGTTGGAGGGTGG - Intergenic
1065153448 10:22846167-22846189 GTGCATTCAAAGTTGGTGGAAGG - Intergenic
1067324659 10:45255981-45256003 TGGCAGACACAGGAGGAGGATGG + Intergenic
1069169398 10:65206689-65206711 TTGCTGTAACATTTGGAAGAAGG + Intergenic
1072387988 10:94951775-94951797 TTGCAGTGAGAGTCAGAGGAGGG + Intronic
1074969945 10:118527897-118527919 TTGCAGTCAGAGTTCCAGAAAGG - Intergenic
1075954987 10:126515869-126515891 TAGCAGTCATAGATGGAGGCAGG - Intronic
1076138746 10:128063275-128063297 CTGCAGTGATAGTGGGAGGAAGG - Intronic
1078765638 11:14294759-14294781 TTTCAGTCACAGATAGAGGCAGG - Exonic
1080231165 11:30018290-30018312 CTGGAGTTACAGTTTGAGGAAGG + Intergenic
1080753935 11:35177329-35177351 TTGGAGCCATAGTTTGAGGAAGG - Intronic
1082731024 11:56797879-56797901 GTGCAGTCACAGGTTGAGGAGGG - Intergenic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1084106903 11:66986227-66986249 TGGCAGCCACAGTGGGAGTAGGG - Intergenic
1084465278 11:69319723-69319745 CAGCAGTCACACTTGGAGCAAGG - Intronic
1085097139 11:73770450-73770472 TTGCAGTGACAGATTTAGGATGG - Intergenic
1087094827 11:94308104-94308126 TTGAAGACACCGTCGGAGGATGG - Intergenic
1087165636 11:94999689-94999711 TTGCAGTCATGCTTCGAGGATGG + Intergenic
1087169066 11:95032010-95032032 TTGCAGTCATACTTTGAGGCTGG + Intergenic
1087205450 11:95389109-95389131 TGATAGACACAGTTGGAGGAAGG - Intergenic
1088972819 11:114788388-114788410 TTGCAGACACTGCTGGAGGAAGG + Intergenic
1091121366 11:133060602-133060624 ATGCAGCCACAGTAGGAGCAGGG - Intronic
1093667114 12:21827724-21827746 TAGCTGTGACAGTTGGAAGAAGG - Intronic
1094065695 12:26358776-26358798 TGGCAGCCACAGATGGGGGAGGG - Intronic
1094713103 12:32985374-32985396 TTCCAGTCTCAGTTGCAGGGAGG + Intergenic
1097487031 12:60215609-60215631 TTCCAGGCAGATTTGGAGGAGGG + Intergenic
1098243687 12:68493476-68493498 TTGCAGTCCCAGTTGTCAGAAGG + Intergenic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1101432683 12:104639774-104639796 GTGCAGGCCCAGTTGGAGGTCGG + Intronic
1102442869 12:112977092-112977114 TTGCAGTAAAAGTTGGATAAGGG + Intergenic
1102554393 12:113717355-113717377 ATGCAGTCACAGGTGGATGGAGG - Intergenic
1104265974 12:127232692-127232714 TTGTAGTCACAATTTGAGGCTGG + Intergenic
1105279133 13:18953053-18953075 TACCAGTCAAGGTTGGAGGAGGG + Intergenic
1105358057 13:19678231-19678253 TTGCAGACACAGTGGGAGTGAGG - Intronic
1106028628 13:25978363-25978385 GATCAGTCACAGTTGGAGGTAGG - Intronic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1109042103 13:57352185-57352207 TTACAGTAACAGGTGGTGGAAGG - Intergenic
1109897846 13:68717687-68717709 TTGAAGCCACATTTAGAGGATGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1115951402 14:38726411-38726433 CTGCAGTCTCATTTGGAGAATGG + Intergenic
1115957268 14:38795229-38795251 GTGCACTCACACATGGAGGAAGG - Intergenic
1116657470 14:47671163-47671185 ATGGTGTCACAGTTGGATGAGGG - Intronic
1117345436 14:54827341-54827363 TTGTAATCAGAGTTGGAGGATGG - Intergenic
1118835113 14:69472366-69472388 TTGCATCCAGAGTTGAAGGAGGG - Intergenic
1119549390 14:75497312-75497334 TTCCAGTCACAGCAGAAGGACGG + Intergenic
1119678877 14:76576872-76576894 TAGCCCTCACAGCTGGAGGATGG + Intergenic
1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG + Intronic
1121533906 14:94677964-94677986 TTGCAGCCACCCTTGTAGGAGGG - Intergenic
1124801210 15:32834599-32834621 TTTCAGCCACATTTGGAGAAAGG - Intronic
1126165359 15:45650242-45650264 TTCCGGACACAGTAGGAGGACGG - Intronic
1127007579 15:54587663-54587685 TGGCAATCAGACTTGGAGGAAGG + Intronic
1128765555 15:70248968-70248990 TTACAGTCACAGTGAGAGGGAGG + Intergenic
1129117296 15:73371668-73371690 GGGCAGGCACAGATGGAGGAAGG + Intergenic
1129179632 15:73865848-73865870 TTGCAGTAAGGCTTGGAGGAAGG + Intergenic
1130803118 15:87287622-87287644 TTGCAAGCACATTTGGTGGAAGG + Intergenic
1132113556 15:99119507-99119529 AAGCAGTCACAGTGGGAGGCGGG + Intronic
1132298561 15:100762487-100762509 TGGCGGGCACAGTCGGAGGAGGG + Intergenic
1134197285 16:12168995-12169017 TTTCCGTCACAGCTGAAGGATGG + Intronic
1135134041 16:19874661-19874683 GGGTTGTCACAGTTGGAGGAGGG - Intronic
1138233389 16:55357974-55357996 CTTCAGTCACATTTGGAAGATGG - Intergenic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1139597392 16:67966477-67966499 GTGCAGTCACAGTTGCTGGTGGG - Intronic
1140603783 16:76509314-76509336 TGGTCGTCACATTTGGAGGAAGG - Intronic
1140830370 16:78745301-78745323 TTGAAGGCAGAGGTGGAGGAAGG - Intronic
1141274053 16:82568972-82568994 ATGCAGTCACAGCTTGTGGATGG - Intergenic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143284935 17:5781868-5781890 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284952 17:5781958-5781980 ATGCAGGTACAGGTGGAGGATGG + Intronic
1144495134 17:15741159-15741181 TGGCAGACACAGGAGGAGGATGG - Exonic
1144951306 17:18995514-18995536 TTGCAGTCTCAGAAGGTGGAAGG + Intronic
1145252030 17:21301951-21301973 GTGCAGGCAGAGTTGGAGGGTGG + Intronic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1148511850 17:48177783-48177805 TTAGAGTCAGAGTTGGAGGTGGG - Intronic
1150904637 17:69325062-69325084 TGGCAATCCCAGTGGGAGGAAGG + Intronic
1152789319 17:82270252-82270274 CTGCTGTGACAGTTGGAGGGCGG - Intronic
1152896531 17:82914470-82914492 GTGCAGACACAGCTGGAGGCCGG - Intronic
1153183855 18:2465798-2465820 TTTCAGTCAGAGATGGAGAAGGG - Intergenic
1153343964 18:4006529-4006551 TTGCAGTCACAGTTGGAGGAGGG + Intronic
1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG + Intergenic
1154342166 18:13512707-13512729 ATGCAGTTAGAGTTAGAGGAGGG - Intronic
1155201542 18:23522159-23522181 TTTCTGGCACAGTTGGAGGAAGG + Intronic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1157188021 18:45557275-45557297 TTGCAGAAACAGTTAGAGAATGG - Intronic
1158212574 18:55067693-55067715 TAGCATTCAGAGATGGAGGATGG - Intergenic
1159082086 18:63746294-63746316 TAGCAGACTCAGTTGTAGGAGGG + Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1160413485 18:78690090-78690112 TTGCAGGCCAAGTTGGAGAATGG + Intergenic
1160707749 19:537279-537301 TGCCAGTCACAGATGGAGGCCGG + Intronic
1164085740 19:21900663-21900685 TTGCAATCACACCTGAAGGAAGG - Intergenic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
1166246578 19:41531708-41531730 TTTCAGTCAAAGTTGGTGAAAGG - Intergenic
1167050433 19:47074774-47074796 GTGCTGTCACAACTGGAGGAGGG + Intronic
1168484185 19:56747138-56747160 TGGCTGTCACAACTGGAGGAGGG - Intergenic
1168507917 19:56951767-56951789 TCGCAGCCACAGCTGGATGAGGG - Intergenic
1168721618 19:58557753-58557775 TTGGGGTGACAGGTGGAGGAGGG - Intronic
926337708 2:11876683-11876705 TTGCGGTCACAGCTGTATGATGG + Intergenic
927932482 2:27053980-27054002 TGGCAGTCACTGTAGGAGAAGGG - Exonic
929620285 2:43347819-43347841 TGGCAGACACAGCTGGAGAAAGG + Intronic
929633235 2:43488126-43488148 ATGCAGTCACCTTTGGAGGTTGG - Intronic
932290525 2:70573756-70573778 ATGCAGTTGCAGTTGGATGATGG - Intergenic
935285359 2:101559712-101559734 TGCCAGCCACAGTTGGAGGGTGG + Intergenic
937166799 2:119826523-119826545 TTGTTGTCACAGTTGGATGGTGG + Intronic
941312676 2:163953468-163953490 TTGCAAGCACACTAGGAGGATGG - Intergenic
941321531 2:164061511-164061533 TTACAGTCACACTTGGAGCTTGG - Intergenic
941919111 2:170831344-170831366 GGGCAGTAACAGTTGGTGGAGGG + Intronic
942486686 2:176447015-176447037 TTGAAGCCACAGGTGCAGGAGGG + Intergenic
943620064 2:190139372-190139394 GTGCAGTCAGAGATGTAGGATGG + Intronic
946134358 2:217633576-217633598 TTCCAGCCAGAGCTGGAGGAAGG + Intronic
946180498 2:217946116-217946138 TGACCGTCAAAGTTGGAGGATGG - Intronic
946892056 2:224287041-224287063 TTGCAGTCTCATTTGGATGATGG + Intergenic
947743101 2:232493933-232493955 TTGCAGTCAAAGTCGGATGGTGG + Intergenic
948606798 2:239141034-239141056 TCTCAGTCACTGTTTGAGGAAGG + Intronic
1172708565 20:36901985-36902007 ATACAGTGACAGATGGAGGAAGG + Intronic
1173487858 20:43454925-43454947 TGGTTGTCACAGCTGGAGGAGGG - Intergenic
1178939604 21:36894005-36894027 TTGTAATCAGTGTTGGAGGAGGG + Intronic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1180637141 22:17270161-17270183 TTGCAGTCACCGTCTGGGGAGGG + Intergenic
1181916312 22:26283288-26283310 TTGCAGTACTAATTGGAGGAAGG + Intronic
1182031865 22:27165462-27165484 TTTCAGGTAGAGTTGGAGGAGGG + Intergenic
1182396983 22:30043406-30043428 TGGCACTCACAGTTACAGGAAGG + Intergenic
1182777557 22:32842069-32842091 TTGCAGGCACCTTTGGAGGCTGG + Intronic
1182834628 22:33332019-33332041 TTGCAGTCACTGTTGAGTGAGGG - Intronic
1182916249 22:34034959-34034981 TTGCTGTCACAGCTGGAGAGTGG + Intergenic
1183728068 22:39600436-39600458 TTGCAGCCACAGTGTGAGGTGGG - Intronic
1185030437 22:48440128-48440150 TTCCAGTCCCAGTAGGAGAAAGG + Intergenic
950105166 3:10384045-10384067 TTTCAGGCACAGGAGGAGGAAGG - Intronic
951950707 3:28197381-28197403 TGGCTGTCACAACTGGAGGATGG - Intergenic
955476362 3:59340409-59340431 TGGCACTCACAGTTGGAGCCTGG - Intergenic
956217391 3:66862697-66862719 TGGTAGTCACAGCTGGATGAGGG - Intergenic
956791064 3:72680479-72680501 ATGTACTCACAGTGGGAGGATGG - Intergenic
957388866 3:79535332-79535354 TTACAGGCACATTTAGAGGAGGG - Intronic
959589313 3:108060082-108060104 TGGCAGTTGCATTTGGAGGATGG - Intronic
960058042 3:113289940-113289962 TTGCAGTCACACTAGGAGCTGGG - Exonic
960991129 3:123312089-123312111 TTGCAGTCAGTTGTGGAGGAGGG - Intronic
961562400 3:127739832-127739854 CTGCATGCACACTTGGAGGATGG - Intronic
964523714 3:157594846-157594868 TTGTAACCACAGTTGGAGGCAGG + Intronic
964820416 3:160762777-160762799 ATGCAGGCACCGTTGGAAGAAGG + Intronic
967289121 3:187902185-187902207 GCTCAGTCACACTTGGAGGATGG - Intergenic
967864246 3:194177331-194177353 TGGAAGGCACAGATGGAGGAAGG + Intergenic
969856033 4:10000569-10000591 ATGCACTCACAATTGCAGGATGG + Intronic
969924741 4:10575390-10575412 TTTCAGACACAGTTGGATGGTGG - Intronic
969994710 4:11299916-11299938 TTGCAGGCATTGTTGGGGGAAGG + Intergenic
970115967 4:12695826-12695848 GTGCATTAACAATTGGAGGAAGG + Intergenic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
972067548 4:34968646-34968668 TTGTAGTCTCTGTTGGAGTACGG + Intergenic
972140871 4:35957862-35957884 TTGCAGGCACACTTGCAGGGTGG + Intronic
972337639 4:38121966-38121988 TTGAATTCAGAGTTGAAGGAAGG - Intronic
976317996 4:83680149-83680171 TGAAAGTCACAGTGGGAGGACGG + Intergenic
981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG + Intergenic
983301843 4:165935624-165935646 TTGCAGTTACATTTGAAGAATGG - Intronic
985021845 4:185699969-185699991 TTGCAGACACAGTCGGAACAGGG - Intronic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991324570 5:65416195-65416217 TTGTAGTCACAGCTGGAGCCTGG - Intronic
995891887 5:116963217-116963239 CAGCAGTCACAGCTGGAGAAGGG - Intergenic
996269148 5:121581012-121581034 TTGGAGTCAAAAGTGGAGGAAGG - Intergenic
998140525 5:139697280-139697302 CTGCAGTCACAGTGAGAGCAGGG + Intergenic
1000319088 5:160119405-160119427 CTGCAGCCGGAGTTGGAGGAGGG - Exonic
1000671896 5:164073381-164073403 TTGTTGTCACAGTTGGAGGTAGG - Intergenic
1001128117 5:169039132-169039154 TTGTAGACCCAGTTTGAGGATGG + Intronic
1002050292 5:176566700-176566722 TTCCAGTCACAGAAGGAGGAAGG + Intronic
1004257413 6:14077953-14077975 TTCCAGTAACAGCTGGATGAGGG + Intergenic
1005412813 6:25568157-25568179 TTGCAGTTATATTTGGAGCATGG - Intronic
1009649173 6:66451339-66451361 ATGCAGACACCGTTGGAGTAGGG - Intergenic
1009806697 6:68608510-68608532 TTGTAGTATCAGATGGAGGAAGG + Intergenic
1011553799 6:88554007-88554029 TTGGAGTCTCAGATGCAGGACGG - Intergenic
1013761972 6:113529434-113529456 ATGCAGCCACATTTGGAAGATGG + Intergenic
1016938872 6:149468480-149468502 AAGCAGTCACATATGGAGGAAGG + Intronic
1017026771 6:150188072-150188094 TTTTAGTCACTGTTGGAGAAAGG + Intronic
1017409587 6:154153861-154153883 GTGAACTCACAGTTCGAGGAAGG - Intronic
1018635819 6:165858454-165858476 TTGAAGTCACAGTTGGTTGAAGG - Intronic
1021405119 7:20257667-20257689 TTTTAGTCACAGTTGGAAAATGG + Intergenic
1021719442 7:23491337-23491359 TTGTAGTCACAGCTGGAGCCTGG - Intergenic
1022003533 7:26247092-26247114 TTGAAGCCACAGTTCTAGGATGG + Intergenic
1022976543 7:35562939-35562961 TTTCCTTCACAGTTGGAAGATGG - Intergenic
1024967453 7:55036707-55036729 TTGCAGTAACAGTAAGATGAGGG - Intronic
1024974318 7:55099503-55099525 ATGCAGTCCCAGATGGAGGGGGG + Intronic
1028132547 7:87193263-87193285 TAGCAGTCAGAGTTAGGGGAAGG - Exonic
1028903662 7:96129130-96129152 TTGCAGTCACAGTAGCAGCCAGG - Intronic
1028980512 7:96962754-96962776 TTGCAGTCAGAGTTAGAAGTAGG - Intergenic
1032126312 7:129196162-129196184 TTACATTCATAATTGGAGGAAGG + Intronic
1032186277 7:129729453-129729475 TGGCAGTCACAGACTGAGGATGG - Intronic
1032965347 7:137091188-137091210 TTGCTTCCACAGTTGAAGGAAGG + Intergenic
1033566226 7:142580818-142580840 TAGCATTCACCTTTGGAGGAAGG + Intergenic
1035766898 8:2113565-2113587 TTGCAGCCAGGGATGGAGGAAGG + Intronic
1036784004 8:11673337-11673359 TTGTAGGCACATGTGGAGGAGGG + Intergenic
1037524590 8:19712377-19712399 TCACAGGAACAGTTGGAGGATGG + Intronic
1038391219 8:27203196-27203218 TTGCAGTGACATTGGGAGAAAGG + Intergenic
1038626325 8:29196991-29197013 TGGCAGTTTCAGTGGGAGGAAGG - Intronic
1040381937 8:46881601-46881623 TTACCATCACAGTTGGATGAAGG - Intergenic
1041443594 8:57926067-57926089 TTTCAGGCAAAGTAGGAGGAAGG - Intergenic
1043883320 8:85569619-85569641 TTGCAGCCAAAGTTGTGGGAAGG + Intergenic
1045328716 8:101137035-101137057 TTGCATTCACAAATGGTGGAGGG + Intergenic
1045566307 8:103319551-103319573 TGGCTGACAGAGTTGGAGGATGG - Intronic
1047015012 8:120714769-120714791 TTCAAGTCACATTTAGAGGAAGG + Intronic
1047189032 8:122661338-122661360 TTGCAGGCAGGGTTGGAGGATGG - Intergenic
1047437500 8:124847110-124847132 GTACAGTCCCAGTGGGAGGAAGG + Intergenic
1047533736 8:125700261-125700283 TTCCAAACACAGATGGAGGAAGG + Intergenic
1047879789 8:129180485-129180507 TGGCAGTCAGAGTGGCAGGATGG + Intergenic
1052111097 9:24582938-24582960 TTAAAGTAAGAGTTGGAGGACGG + Intergenic
1056056386 9:82828356-82828378 GTGCAGTCACACTTAGAAGAAGG - Intergenic
1056143899 9:83710270-83710292 TTGAAGTGATAGTTGGATGATGG + Intergenic
1056208829 9:84345663-84345685 TGGCAGGTACAGTTGGAGAATGG - Intergenic
1056276980 9:85002970-85002992 TTGGAGAAACAGTTGGGGGACGG + Intronic
1059986479 9:119824874-119824896 TTCCAGTCACAACTGGAGGTGGG - Intergenic
1060168531 9:121441286-121441308 TGGTTGTCACAGTTGGTGGAGGG - Intergenic
1062391282 9:136334921-136334943 CAGCAGTTACAGTTTGAGGAGGG + Intronic
1185769539 X:2755097-2755119 TTCCTGTAACACTTGGAGGAGGG - Intronic
1190808487 X:53861723-53861745 TTGCAGCCACTGCTGGGGGATGG + Intergenic
1191925726 X:66307579-66307601 TTGCATTCACAGTTGCTGCAAGG - Intergenic
1193508671 X:82372862-82372884 CTGCAATCACAGGTGGAGGGAGG + Intergenic
1195676322 X:107509816-107509838 TTGCAGTCTAAGGTGGAGGCAGG - Intergenic
1200017326 X:153177236-153177258 TTGCAGTCTCGGTTGGAGGGGGG + Intergenic
1201300969 Y:12504532-12504554 TTCCTGTAACACTTGGAGGAGGG + Intergenic