ID: 1153347716

View in Genome Browser
Species Human (GRCh38)
Location 18:4046089-4046111
Sequence TGGCAGGTTAATGCCAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153347716_1153347721 -9 Left 1153347716 18:4046089-4046111 CCCCATCTGGCATTAACCTGCCA 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1153347721 18:4046103-4046125 AACCTGCCAATTATACAAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 156
1153347716_1153347720 -10 Left 1153347716 18:4046089-4046111 CCCCATCTGGCATTAACCTGCCA 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1153347720 18:4046102-4046124 TAACCTGCCAATTATACAAAGGG 0: 1
1: 0
2: 1
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153347716 Original CRISPR TGGCAGGTTAATGCCAGATG GGG (reversed) Intronic
900792477 1:4689534-4689556 TGGCAGGTGAAGGCCAGACAAGG + Intronic
901756247 1:11443246-11443268 TGGTGGGTTGATGACAGATGTGG - Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
914903849 1:151728246-151728268 TCGCAGGATGACGCCAGATGAGG - Intronic
916701765 1:167303112-167303134 GGGGAGGTTAATGTCAAATGTGG + Intronic
916945238 1:169719701-169719723 TGGAAGGTAAAGGCAAGATGGGG - Intronic
924217038 1:241833143-241833165 TGGCATTTTAAGGCAAGATGTGG + Intergenic
924386355 1:243501658-243501680 AGGTAGGTTAATACCAGCTGGGG + Exonic
1065192950 10:23231484-23231506 AGGCAGGATAATGCCCCATGAGG - Intronic
1067063659 10:43091011-43091033 CAGCAGGGTGATGCCAGATGGGG + Intronic
1067176529 10:43953731-43953753 TGGCAGCTCAATGCCAGGAGAGG - Intergenic
1070633999 10:78109262-78109284 AGGCAGGTTGGAGCCAGATGGGG + Intergenic
1070803175 10:79255278-79255300 AGGCAGGCAAATCCCAGATGGGG + Intronic
1070980814 10:80645448-80645470 TGGGAAGTGAATGCCCGATGTGG + Exonic
1071728012 10:88218936-88218958 GGGCAGGTAAATGACAGGTGGGG - Intergenic
1073694851 10:105853316-105853338 TGGCATGAATATGCCAGATGTGG + Intergenic
1075391900 10:122098063-122098085 GGGCAGGTGAGTGACAGATGTGG + Intronic
1075575475 10:123574263-123574285 TGGCAGGTTGGGGCCAGGTGGGG - Intergenic
1081368269 11:42264065-42264087 AGGCAGATTAATGCCAATTGTGG - Intergenic
1081541903 11:44040695-44040717 TGGCAGGGTAATGTGAGCTGTGG + Intergenic
1082200424 11:49359683-49359705 TGGCAGCTGAATGCAGGATGGGG - Intergenic
1083193272 11:61067979-61068001 TCTCAGGTCAATGACAGATGTGG + Intergenic
1084456615 11:69271427-69271449 TGGCAGGTCAGTGTCAGATCTGG + Intergenic
1086488744 11:87337086-87337108 TGGTAGGTCCATGCCAGAAGAGG + Intergenic
1086655251 11:89346543-89346565 TGGCAGCTGAATGCAGGATGGGG + Intronic
1087219730 11:95533302-95533324 TGCCTTGTTAGTGCCAGATGTGG - Intergenic
1087353296 11:97060520-97060542 TTGCAGGTTGGTGCCAGCTGAGG - Intergenic
1089750581 11:120648476-120648498 AGGCAGGTGAATACCAGCTGTGG + Intronic
1090081156 11:123613653-123613675 TGGCAGGTGTGTGCCAGGTGGGG + Exonic
1091156309 11:133377439-133377461 TGGCAGGCAAAGGCAAGATGTGG + Intronic
1093534110 12:20202516-20202538 TGGCAGGGTAAAGCCAGGTGGGG + Intergenic
1095258916 12:40075706-40075728 TGTCAGCATAATGCCAGAAGAGG - Intronic
1096729349 12:53595261-53595283 TGGTAGGTAAATGCCATTTGTGG - Intronic
1096912371 12:54997087-54997109 TAGCAGGTTAATGACAGAGCAGG - Intergenic
1097877448 12:64656695-64656717 TGGTAGGTTTTTGCCTGATGGGG - Intronic
1098171016 12:67747315-67747337 TGTCATGTTTTTGCCAGATGTGG - Intergenic
1098404490 12:70109294-70109316 TTGCAGGTAGATGCCAGCTGAGG - Intergenic
1099186372 12:79519885-79519907 TGGCTGGGTAAAGGCAGATGGGG + Intergenic
1099474787 12:83095056-83095078 TGGCACATTAGTGCCAGTTGGGG + Intronic
1100796719 12:98189631-98189653 TGGTAGGAGGATGCCAGATGTGG + Intergenic
1103492206 12:121330497-121330519 TCGCTGGTTAATGACAGAGGTGG + Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1103945785 12:124525651-124525673 TGGCAGGGCCATGCCAGCTGTGG - Intronic
1104564531 12:129868851-129868873 TGCCTGGTGATTGCCAGATGAGG - Intronic
1107676520 13:42803305-42803327 TGGCAGGTTTATATTAGATGGGG + Intergenic
1109108654 13:58288412-58288434 TGGCACTTTTATGCAAGATGAGG - Intergenic
1109820489 13:67646140-67646162 AGGCAGATTAATGGCAGAAGTGG - Intergenic
1115118868 14:29915652-29915674 TGGGATGTGAATTCCAGATGAGG + Intronic
1115309854 14:31968214-31968236 TGTCAGTTTAGAGCCAGATGTGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1118730242 14:68660939-68660961 TGACATGTTGATGGCAGATGTGG - Intronic
1119355705 14:74004629-74004651 TGGCAAGTTGATGCCAGCTGTGG + Intronic
1121266888 14:92609619-92609641 TGGCAGGTTCATGGGTGATGTGG + Intronic
1121446145 14:93980445-93980467 AGGGAGGATAATGCCAGGTGAGG - Intergenic
1131264257 15:90906406-90906428 AGGCTGGGTGATGCCAGATGAGG + Exonic
1134394408 16:13849966-13849988 TGGGAGGATCATCCCAGATGAGG - Intergenic
1137408730 16:48210001-48210023 TGGCAGGTTTGGGGCAGATGTGG + Intronic
1141695753 16:85618364-85618386 TGACGGGTAAATGACAGATGCGG + Intronic
1143406631 17:6682087-6682109 TCCCAGGTAGATGCCAGATGGGG + Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1147016508 17:37496208-37496230 TGGCAGGCTCAGGCCAGAAGTGG + Intronic
1148082019 17:44972110-44972132 TGGTAGGGTCATTCCAGATGGGG - Intergenic
1151132969 17:71917148-71917170 TGGCAGGTTGATACCAAATTGGG + Intergenic
1151139122 17:71975129-71975151 AGGCAGGTTAATGCCCCATTTGG + Intergenic
1151831424 17:76554401-76554423 CAGCAGGTTCATGGCAGATGGGG - Intergenic
1153347716 18:4046089-4046111 TGGCAGGTTAATGCCAGATGGGG - Intronic
1155414438 18:25581885-25581907 GGGCTGGTTTAGGCCAGATGAGG + Intergenic
1157070731 18:44404884-44404906 TGGAAGGTGAATGCCAGGAGAGG + Intergenic
1159314894 18:66759745-66759767 TGGCAGGTTTATGCCAGTAAGGG - Intergenic
1160296841 18:77646437-77646459 TGGCTTGTTACTGCCAGGTGGGG + Intergenic
1162217621 19:9149489-9149511 TGGCCAGTGAATGCCAGATCAGG + Intronic
1163827707 19:19532898-19532920 TGGCTGGTGCAGGCCAGATGGGG + Intronic
1164062989 19:21691467-21691489 GCTCAGGTAAATGCCAGATGAGG - Intergenic
1167203828 19:48086508-48086530 TGGCAGGGCAAAGCCAGGTGTGG - Intronic
928416283 2:31094770-31094792 TGTAAGGTGAATACCAGATGAGG + Intronic
928992975 2:37255338-37255360 GGGCTGGTTAAATCCAGATGGGG + Intronic
930370690 2:50497519-50497541 TGTGAGCTTAATGCCAGATTTGG - Exonic
930434418 2:51322518-51322540 TGGAATGTTAATGCCAGCTGAGG - Intergenic
931629693 2:64287521-64287543 TGACAGGTTTATGCGACATGAGG - Intergenic
932707931 2:74041029-74041051 AGGCAGGACAATGCCAGAGGAGG - Intronic
932816415 2:74865607-74865629 AGGCAGGCTAACCCCAGATGAGG + Intronic
932966717 2:76484431-76484453 TGGCAGGTTGATGACAGGTCTGG - Intergenic
938031331 2:127996759-127996781 TGGCTTTTTAATGACAGATGCGG + Intronic
946826521 2:223684430-223684452 TGGCAGGACCATGCCACATGGGG + Intergenic
948812897 2:240494028-240494050 TGGCAGGTAGGTGCCAGCTGAGG + Intronic
948868736 2:240787880-240787902 GGGCAGGTGAGAGCCAGATGTGG - Intronic
948990208 2:241550270-241550292 TGGCAGGTTGCTGCCAGAGGGGG + Intergenic
1171265431 20:23767934-23767956 TTACAGGTGCATGCCAGATGGGG + Intergenic
1172357522 20:34290534-34290556 TGGCCGGTAGGTGCCAGATGGGG - Exonic
1174169397 20:48606763-48606785 GGGCAGGTGAATGACAGAGGAGG + Intergenic
1175187271 20:57187210-57187232 AGGCTGGTTAGTGGCAGATGCGG - Intronic
1180059270 21:45376186-45376208 TGGCAGGGAAATGCCACGTGGGG + Intergenic
1183513533 22:38249867-38249889 TTGCAGGTTATTGCCAGAGTTGG - Intronic
952409432 3:33034065-33034087 TGCCAGGATATTGCCATATGTGG - Intronic
952679802 3:36078170-36078192 TGGCAGGAAAATGACAGATGTGG + Intergenic
953118419 3:40015517-40015539 TAGCAGGGCAATGCCAGAGGAGG + Intronic
954587445 3:51747893-51747915 TGGGTGGTTAATGACAGAAGAGG + Intergenic
954725791 3:52608553-52608575 AGGCAGTGTAATGCCAGCTGGGG - Intronic
954835273 3:53461326-53461348 TGGCAGGTAAATGGCAAATTGGG - Intergenic
957943593 3:87036013-87036035 TGTCAGGTGAATGATAGATGAGG - Intergenic
959746687 3:109783604-109783626 TGGCAGGTTTATGCCAGTATAGG - Intergenic
963391735 3:144673671-144673693 TGGCAAGTTTATGCAAGGTGTGG - Intergenic
963705049 3:148676481-148676503 TGGCAGGTTAACGCCTACTGAGG - Intergenic
968743089 4:2341063-2341085 TGACAGGCTATTGCCACATGTGG + Intronic
973977226 4:56274319-56274341 TGGCAGTTTAATACAAAATGAGG + Intronic
974457456 4:62146083-62146105 TGGCACGTTAATGCAAGGGGTGG - Intergenic
981662595 4:147184655-147184677 TGGAAGCTTCATGCCAGAGGGGG - Intergenic
982041006 4:151396668-151396690 TGGTAAGTTAGCGCCAGATGTGG + Intergenic
982769752 4:159385977-159385999 TGCCTGATTACTGCCAGATGAGG - Intergenic
984245430 4:177269550-177269572 TGGCAGGTCAAAGCCAGTTTTGG - Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
986324323 5:6660448-6660470 GGGCAGGTGAATCCCAGACGTGG - Intronic
987210383 5:15676079-15676101 GGGCAGTTTAATTCCAGATCGGG - Intronic
988200902 5:28066977-28066999 TGGCAGGTTACTGGTAGATATGG - Intergenic
989793280 5:45433674-45433696 TGCCAGGCTAATGACAGAAGAGG - Intronic
990990477 5:61678771-61678793 TGGCAGGGAAGTGCCAGGTGAGG + Intronic
991764352 5:69958471-69958493 GGGCATGTTAATGCAAGAGGTGG - Intergenic
991843584 5:70833543-70833565 GGGCATGTTAATGCAAGAGGTGG - Intergenic
991875417 5:71160003-71160025 GGGCATGTTAATGCAAGAGGTGG + Intergenic
992565635 5:77992940-77992962 TGACAGATTAATACCAGATAAGG + Intergenic
995030047 5:107470177-107470199 TGGCAAGAGAATGCCAGATTTGG - Intronic
996087859 5:119322524-119322546 TGGCATTTTAATGCTAGGTGGGG + Intronic
999866991 5:155711503-155711525 TGCGAAGTTAATGGCAGATGTGG - Intergenic
1001308404 5:170593252-170593274 TGGCAGGTAGAAGCCAGATGGGG - Intronic
1001943423 5:175756980-175757002 TGCCATGTTAGTGCTAGATGGGG - Intergenic
1002077540 5:176717881-176717903 TGGCAGGCTACTGGCAGTTGGGG + Intergenic
1003077854 6:2998917-2998939 TGGCAGGTGACTGCCAAATGAGG + Intronic
1003085305 6:3055685-3055707 TGGCAGGTGACTGCCAAATGAGG - Intergenic
1003334445 6:5157354-5157376 TGGTAGGTTATTGCCAGGTTCGG + Intronic
1004243385 6:13949278-13949300 TGTCAGGTTTCTGACAGATGTGG - Intronic
1004539325 6:16534805-16534827 AGGAAGGTTTATTCCAGATGAGG - Intronic
1005954279 6:30652771-30652793 AGAAAGGTTAATGCCAGTTGGGG - Intronic
1014032375 6:116720260-116720282 TGGAAGCTTAATGCCAGGAGAGG - Intronic
1018685856 6:166304150-166304172 TGGAAGTTTAATGAAAGATGTGG + Intergenic
1021941030 7:25679172-25679194 TGGCAGGTTGATGCCACAGAGGG - Intergenic
1026020775 7:66704128-66704150 TGGCTTGCTAGTGCCAGATGGGG - Intronic
1033262626 7:139856850-139856872 TGGCAGGTTGATGTCAGCGGTGG + Intronic
1037437792 8:18881915-18881937 TAGAAGGTGAAAGCCAGATGAGG + Intronic
1038008451 8:23454596-23454618 TGGGAGGTCAATTCTAGATGGGG + Intronic
1042920047 8:73911576-73911598 TGGGTGGTTAATGACAGAAGAGG + Intergenic
1055023083 9:71691135-71691157 TGGCACTTTAAGGCCAGGTGTGG + Intronic
1057774707 9:97997937-97997959 TGCCAGGTTTATGCAAGATGTGG + Intronic
1059371890 9:113847762-113847784 TGGCAGGTCCATGCCACATCTGG - Intergenic
1186409005 X:9329376-9329398 TGTCAGGTTAAGGCCAGGTGGGG + Intergenic
1188094220 X:26002470-26002492 TGGCAGGACAAAGCCAGGTGGGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1193501042 X:82275494-82275516 TGTCACATTGATGCCAGATGTGG + Intergenic
1194556624 X:95368163-95368185 TGGCAGGGCAAAGCCAGGTGGGG - Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1195417940 X:104641175-104641197 TTGCAGGTAGATGCCAGCTGAGG + Intronic
1196351043 X:114730260-114730282 TGGCAGGCTATTGCCAGAGATGG - Intronic
1196481329 X:116153242-116153264 TGGCAGGGTAATGGTGGATGGGG + Intergenic
1199077052 X:143536196-143536218 TGGCAGGGCAAAGCCAGGTGTGG - Intergenic