ID: 1153350943

View in Genome Browser
Species Human (GRCh38)
Location 18:4080741-4080763
Sequence ACAGCCTATAGTAGTAAATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153350943_1153350948 21 Left 1153350943 18:4080741-4080763 CCCGATTTACTACTATAGGCTGT 0: 1
1: 0
2: 0
3: 13
4: 94
Right 1153350948 18:4080785-4080807 CCATTCTTTCTGTAACCTCAAGG 0: 3
1: 8
2: 18
3: 31
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153350943 Original CRISPR ACAGCCTATAGTAGTAAATC GGG (reversed) Intronic
904316100 1:29664764-29664786 ACAGCCTGTAGTAGGAACACTGG - Intergenic
906852763 1:49269660-49269682 ACAGGTTATGGTGGTAAATCAGG - Intronic
908629043 1:66081678-66081700 CCAGCCTATAGTAGTAGTACTGG + Intronic
912604735 1:110978042-110978064 TCAGCCTATAGAAGTAATTCAGG - Intergenic
913038809 1:115002991-115003013 ACAGACTATTGTAGTACATCAGG + Intergenic
917764167 1:178199185-178199207 ACAGACTGTACTAGGAAATCGGG - Intronic
919777077 1:201201132-201201154 AAAGCCTTTAGAAGTAAACCAGG - Intronic
1064692201 10:17929722-17929744 ACAGATTATGGTGGTAAATCAGG - Intergenic
1065578712 10:27150269-27150291 AAAGCCTGTAGTACTAAACCTGG - Intronic
1066190997 10:33056152-33056174 ACAGGTTATGGTGGTAAATCAGG + Intergenic
1068047401 10:51905242-51905264 TCAGACCATAGCAGTAAATCTGG + Intronic
1075306171 10:121369646-121369668 ACAGACTATAGTAGTAAGGTAGG + Intergenic
1078292123 11:10022669-10022691 ACTGCCTATAGAAAAAAATCAGG - Intronic
1078430538 11:11284882-11284904 AAAGTCTTTACTAGTAAATCAGG - Intronic
1081372036 11:42316020-42316042 ACCACATATAGTAGTGAATCAGG + Intergenic
1085137739 11:74108822-74108844 AGAGCCTTTAGTATTATATCTGG + Intronic
1088334875 11:108692751-108692773 CCAGCCTATACTAATAAATATGG - Intronic
1089839827 11:121406381-121406403 ACAGGTTATGGTAGTAAATCAGG + Intergenic
1093233492 12:16577535-16577557 ACAACATCTAGTAGAAAATCTGG - Intronic
1097000877 12:55875401-55875423 ACGGACTATGGTGGTAAATCAGG + Intergenic
1102866586 12:116379701-116379723 CCAGCCCATGGTAGTAAATGGGG + Intergenic
1103422733 12:120801332-120801354 ACAGGTTATGGTGGTAAATCAGG - Intronic
1105374189 13:19828625-19828647 AGAAACTATAGTAGTAATTCTGG + Intronic
1108602828 13:52009466-52009488 ACAGGTTATGGTTGTAAATCAGG - Intronic
1109344178 13:61095103-61095125 ACAGGTTATGGTGGTAAATCAGG - Intergenic
1109830630 13:67782395-67782417 ACAGCCTATATAAGTAAATATGG - Intergenic
1111113459 13:83745848-83745870 AGAGGCTATAGTAGTAGTTCTGG + Intergenic
1111312450 13:86507391-86507413 AAATCCTTTAGCAGTAAATCAGG - Intergenic
1111677411 13:91403988-91404010 ACATCCTATAGTTGTAAAATTGG + Intronic
1116085679 14:40235098-40235120 TTACCCTATAGTAGTATATCTGG - Intergenic
1116261305 14:42630944-42630966 ACAGGTTATAGTGGTATATCAGG - Intergenic
1119128060 14:72146666-72146688 ACAACATAAAGTCGTAAATCTGG + Intronic
1123726430 15:23107230-23107252 AAAGCCTGTTGTAGTAATTCAGG + Intergenic
1128887714 15:71303758-71303780 ATAGCCTATTGTAGTGACTCTGG + Intronic
1131881819 15:96870384-96870406 AAGGGCTATAGTAGTACATCTGG - Intergenic
1135959756 16:26985838-26985860 ACAGGCTATGGTGGTAAATCAGG + Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1141310370 16:82908015-82908037 ATAACCTATTGTTGTAAATCAGG - Intronic
1147299673 17:39516241-39516263 ACAACCTATAATAGAAAATATGG + Intronic
1148066391 17:44873682-44873704 ACTTCCTATTTTAGTAAATCAGG + Intronic
1153350943 18:4080741-4080763 ACAGCCTATAGTAGTAAATCGGG - Intronic
1155092490 18:22525175-22525197 ACAGCCTATAGCAGGAAATGAGG - Intergenic
1167786066 19:51637178-51637200 ACAGCCTCTACCAGGAAATCTGG + Intronic
927362327 2:22250319-22250341 ACAGCCTTTAGTTATAAATATGG - Intergenic
929721029 2:44367726-44367748 ACAGCTTAAAGTAGTATAACAGG - Intronic
932931493 2:76045086-76045108 TCACCCTATAATAGTATATCTGG + Intergenic
936625951 2:114149685-114149707 ACAGCCCAGATTAGTAAATGGGG + Intergenic
938689132 2:133770719-133770741 TCAGCCTCTAGTAGAAAAACAGG - Intergenic
941540275 2:166773524-166773546 ACAGGTTATGGTGGTAAATCAGG - Intergenic
944682002 2:202085566-202085588 AGAGCCTATAGAAGGAACTCAGG + Intronic
944852275 2:203732201-203732223 ACTGCCTACAGTAGCATATCAGG - Intronic
1174955676 20:55095180-55095202 AAAGCCCATAGTGGCAAATCTGG - Intergenic
953299327 3:41756268-41756290 AAAGCCGATTGTAGTAATTCAGG - Intronic
955457176 3:59136237-59136259 ACTGCCTAAAGAAGAAAATCAGG + Intergenic
959693607 3:109225374-109225396 ACTGGCTATAGTAGTCAATTTGG + Intergenic
959822433 3:110752474-110752496 ACAGGTTATAGTGGTAAAACAGG - Intergenic
959869761 3:111313115-111313137 ACAGGCTAAAGTAATAGATCAGG - Intronic
959980741 3:112514055-112514077 ACTGCCTAGGGTAGTAAAACAGG - Intergenic
965833310 3:172822893-172822915 ACAACCTATAATAGGATATCTGG + Intergenic
967863516 3:194171528-194171550 ACAGCCTACAGTACTCAATACGG + Intergenic
968059913 3:195719953-195719975 ACCGCTTAGAGTAGTAAAACAGG + Intergenic
970721942 4:18998225-18998247 ACAGACTAATGTAGTAAATGGGG - Intergenic
970847856 4:20563917-20563939 ACACACTTAAGTAGTAAATCTGG + Intronic
971055982 4:22913001-22913023 ACAGCCTATAGGAGAAAAAAGGG + Intergenic
971850722 4:31983417-31983439 ACAGGTTATAGTGGTAAATCAGG + Intergenic
972973694 4:44607773-44607795 TGAGCCTATAATAGTAAATATGG - Intergenic
979123992 4:116943829-116943851 AAAGCCTATTGGAATAAATCTGG + Intergenic
980702359 4:136448835-136448857 ACAGGCTATGGTGGTGAATCGGG + Intergenic
980816757 4:137957596-137957618 ACAGCCTACAGAACTAAATGTGG + Intergenic
980873182 4:138633311-138633333 ACAGCCTGTAGTAATGAACCAGG - Intergenic
982568643 4:157020541-157020563 ACAACCTATGGTAGGCAATCAGG + Intergenic
987679320 5:21115416-21115438 ACTGCCTAGAGTTGTAAAACAGG - Intergenic
987986971 5:25160456-25160478 ACTACCTATGGTAGTAAAACAGG - Intergenic
994745553 5:103673922-103673944 AATGCCTAGAGAAGTAAATCTGG - Intergenic
1002947545 6:1777444-1777466 TCAGCCTTCAGCAGTAAATCTGG - Intronic
1007046465 6:38780241-38780263 ACAGCAAAGAGGAGTAAATCTGG - Intronic
1014497395 6:122142854-122142876 ACATCCAAAAGCAGTAAATCCGG - Intergenic
1016429841 6:143971693-143971715 ACATGCAATGGTAGTAAATCTGG + Intronic
1022863161 7:34389255-34389277 ACAGGTTGTGGTAGTAAATCAGG - Intergenic
1024034878 7:45499103-45499125 ACAGGTTATAGTGGTAAATCAGG - Intergenic
1031442343 7:121810077-121810099 ACAGCTTCTAGTAGTGCATCAGG + Intergenic
1033627810 7:143128086-143128108 CCAGGTTATGGTAGTAAATCAGG - Intergenic
1033685577 7:143638077-143638099 ACAGCCTATAGTAGTATAAATGG - Intronic
1033688747 7:143717294-143717316 ACAGCCTATAGTAGTATAAATGG - Intronic
1033699037 7:143819544-143819566 ACAGCCTATAGTAGTATAAATGG + Intergenic
1035139286 7:156740622-156740644 ACACCCTAGAATAGTATATCTGG + Intronic
1039246241 8:35611936-35611958 ACAGCCAACATCAGTAAATCAGG - Intronic
1039878343 8:41606702-41606724 ACAGGCTATGGCGGTAAATCAGG + Intronic
1042386342 8:68179513-68179535 TCACCCTATAGTAGAAAAGCAGG + Intronic
1045613161 8:103872085-103872107 ACAGGCTAATGCAGTAAATCAGG - Intronic
1047038693 8:120968874-120968896 ACTTCCTAGAGTATTAAATCAGG - Intergenic
1047224271 8:122943377-122943399 ACAGCCTGGAGCAGTAAAACTGG - Intronic
1050872936 9:10597693-10597715 ACAGCCGATATTCCTAAATCTGG - Intronic
1051658118 9:19401988-19402010 ACAGCCAATAGCAGTAGATGTGG - Intergenic
1052221696 9:26031980-26032002 AGAGGATATAGTAGTAAATCAGG + Intergenic
1053612934 9:39733507-39733529 AGAGCTTATATTAGAAAATCTGG + Intergenic
1053870974 9:42491449-42491471 AGAGCTTATATTAGAAAATCTGG + Intergenic
1054240580 9:62608895-62608917 AGAGCTTATATTAGAAAATCTGG - Intergenic
1054554716 9:66643417-66643439 AGAGCTTATATTAGAAAATCTGG - Intergenic
1055029419 9:71758486-71758508 ACAGGTTACAGTAGTAAATCAGG + Intronic
1057557730 9:96100938-96100960 AAAGCCCATTGTAGAAAATCAGG + Intergenic
1058738744 9:107921494-107921516 ACTGCCTAGAGTAGTATATGAGG - Intergenic
1190495449 X:51024297-51024319 ACAGGTTATAGTGGTAAAACAGG + Intergenic
1192103922 X:68294685-68294707 TCAGGCTCTAATAGTAAATCTGG + Intronic
1194396338 X:93391841-93391863 TCACCCTAGAGTAGTATATCTGG - Intergenic
1196257700 X:113541242-113541264 ACAGGTTATGGTGGTAAATCAGG - Intergenic
1201319472 Y:12682354-12682376 ACTGCCTATGGTTGTAAAACTGG + Intergenic
1201589450 Y:15598763-15598785 ACAGCATATAAAAGCAAATCTGG - Intergenic