ID: 1153351683

View in Genome Browser
Species Human (GRCh38)
Location 18:4087806-4087828
Sequence CCATTTTAAAATAAAGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 931
Summary {0: 1, 1: 0, 2: 11, 3: 108, 4: 811}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153351683_1153351686 1 Left 1153351683 18:4087806-4087828 CCTAGTTCTTTATTTTAAAATGG 0: 1
1: 0
2: 11
3: 108
4: 811
Right 1153351686 18:4087830-4087852 TTTCATGTGAACTGTGTAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 170
1153351683_1153351687 2 Left 1153351683 18:4087806-4087828 CCTAGTTCTTTATTTTAAAATGG 0: 1
1: 0
2: 11
3: 108
4: 811
Right 1153351687 18:4087831-4087853 TTCATGTGAACTGTGTAGTTGGG 0: 1
1: 0
2: 2
3: 16
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153351683 Original CRISPR CCATTTTAAAATAAAGAACT AGG (reversed) Intronic
901370985 1:8797956-8797978 CAATTTTAAAATAAATGACTAGG + Intronic
902775459 1:18671674-18671696 CCATTTTAAAATGAAGAAAGTGG - Intronic
903089943 1:20904646-20904668 CTCTTTTAAAATAACAAACTTGG - Intronic
903203290 1:21761150-21761172 CCATTTGTAAATAAAAAACATGG - Intronic
904135189 1:28306882-28306904 CCATTTTAAGATAAGGAAACTGG - Intergenic
905805322 1:40872680-40872702 CCATTTAAAAATGAATAATTCGG - Intergenic
906115890 1:43357004-43357026 ACATTTAAAAATAAAGGATTTGG - Intergenic
906970542 1:50509003-50509025 CCATTTTAAAGTATACAATTTGG - Intronic
907345758 1:53778450-53778472 TCCTTTTAAAATAAATGACTTGG + Intronic
907688737 1:56641129-56641151 CCAATTTAAAATAAAAAATTTGG - Intronic
907749326 1:57246908-57246930 CCATTCTAAAAGGAAGAAATTGG - Intronic
908185087 1:61644818-61644840 CTATTTTAAAATAAACCACTTGG + Intergenic
908400006 1:63762913-63762935 CTATTTTAAAATATATAAATGGG + Intergenic
908709691 1:67001310-67001332 ACTTTTTAAAAAAAAAAACTAGG + Exonic
908869807 1:68596396-68596418 CTCATTTAAAATAAAAAACTGGG + Intergenic
909446418 1:75754094-75754116 CCAATTAAAAATGAAAAACTAGG - Intronic
909575332 1:77169652-77169674 ACATTTTAAAGTAGAGAAATTGG + Intronic
909590088 1:77338506-77338528 ACATTTGAAAACATAGAACTGGG + Intronic
910054153 1:83011374-83011396 CCATCTTTAAATAATGAGCTTGG - Intergenic
910214164 1:84825499-84825521 CCATTTAAAAACACAGAACATGG - Intronic
910553712 1:88506078-88506100 CATTTTTAAAATAAAGAAGATGG - Intergenic
910666415 1:89729566-89729588 CATTTTTACAATAAAGCACTAGG + Intronic
911025594 1:93433243-93433265 CCATCTCAAAATAAAAAACTGGG + Intergenic
911378070 1:97076058-97076080 CCATTTAAAAATGAAGACATAGG - Intergenic
911625262 1:100116883-100116905 CCAAATTAAGATAAAGAAATTGG - Intronic
911766385 1:101680490-101680512 ACATTTTAAAAATAGGAACTTGG - Intergenic
911781668 1:101887350-101887372 CCATTTTATTATAAATATCTAGG - Intronic
911994004 1:104739314-104739336 CCATTAAAAATTAAAGAAATGGG - Intergenic
912147532 1:106811239-106811261 CCAATTAAAAATAAAGTACATGG + Intergenic
912781940 1:112559022-112559044 GAATTTTAATAGAAAGAACTTGG - Intronic
912789393 1:112637180-112637202 CCATTTATAAATCAAGAAATAGG - Intronic
913280673 1:117182221-117182243 CCATTATAAAATAAAGATAGTGG - Intronic
913402720 1:118454374-118454396 CCATTGCAAAAGAAAGAAATTGG + Intergenic
913523857 1:119671743-119671765 ACATTTTAAAATCAGGAAGTGGG + Intronic
913689235 1:121262782-121262804 CCATTTAATAATAAAGAACTGGG + Intronic
914051021 1:144131238-144131260 CCATTTTAAAATATATAAATAGG - Intergenic
914128160 1:144834205-144834227 CCATTTTAAAATATATAAATAGG + Intergenic
914148364 1:145017499-145017521 CCATTTAATAATAAAGAACTGGG - Intronic
914978586 1:152391172-152391194 GCATTTTAAAAGAAAGCACTGGG - Intergenic
915209393 1:154296362-154296384 CCATGTCAAAATAAATAACAAGG + Intergenic
915676819 1:157539600-157539622 CCATTTTAGGGTAAAGATCTTGG - Intronic
915686618 1:157640540-157640562 CCATTTTAGGGTAAAGATCTTGG - Intergenic
916120041 1:161521409-161521431 CCGTTTTAAAATGAAGAGATTGG - Intronic
916129801 1:161603058-161603080 CCGTTTTAAAATGAAGAGATTGG - Intronic
916158541 1:161884221-161884243 TGATTTTAAAATATAAAACTAGG + Intronic
916533814 1:165683919-165683941 CCAATTTAAAATAAATAATAGGG + Intronic
916740217 1:167640912-167640934 CCATATAAAGGTAAAGAACTTGG + Intronic
917434074 1:175000787-175000809 GATTTTTAAAATAAATAACTTGG + Intronic
917562601 1:176175076-176175098 GCAATTAAAAATTAAGAACTTGG - Intronic
917938469 1:179892754-179892776 ACTTTTTAAAAAAGAGAACTTGG + Intronic
918263800 1:182821256-182821278 CCATTTGAATTTAAAGAACTTGG + Intronic
918514231 1:185344801-185344823 CCATTTTATAAAAAACAACCAGG + Intergenic
918580245 1:186118423-186118445 AGATTTTAAAATAAAGTATTAGG + Intronic
918614967 1:186533607-186533629 CCATTTCTAAATAAACAAATGGG + Intergenic
918715178 1:187777250-187777272 TCTTTTTAAAATATAGTACTGGG - Intergenic
920083645 1:203397310-203397332 AAATTTTAAAATAAATAAATAGG - Intergenic
920476558 1:206281257-206281279 CCATTTAATAATAAAGAACTGGG + Intronic
920886318 1:209932044-209932066 ATATTTTAAAATAAAGGACAAGG + Intergenic
920988897 1:210916845-210916867 ACATTTTTAAAAAAAGAAATGGG + Intronic
921122896 1:212152025-212152047 CCATTTTAATATTAAGAACAAGG + Intergenic
921641044 1:217554812-217554834 CAATTTGAAAATAAAGAATGGGG - Intronic
921815758 1:219561509-219561531 ACATTTCATACTAAAGAACTGGG + Intergenic
921871424 1:220144530-220144552 CCATTTTAAAATTTAAAACTTGG + Intronic
922714140 1:227857803-227857825 CCATTTCAAAATGAACAGCTTGG - Intergenic
923002827 1:230021826-230021848 CCACTTTAAAATAAATTACCTGG + Intergenic
923298636 1:232619748-232619770 CAATTTTAAAATAAGGATGTGGG - Intergenic
923733559 1:236578773-236578795 CCAGTTTTAAATAAAGAATCTGG + Intronic
1063260019 10:4377379-4377401 TCATTTAAAAACAAACAACTAGG - Intergenic
1063371760 10:5526847-5526869 CCTTTGTAAAACAAAGAGCTGGG + Intergenic
1063681614 10:8193490-8193512 TTATTTAAAAATAAAAAACTAGG - Intergenic
1063786078 10:9384575-9384597 CCTCTTTAAATGAAAGAACTGGG + Intergenic
1063963139 10:11323934-11323956 TCATTTTAATATTAAAAACTCGG + Intronic
1064839311 10:19573038-19573060 CTATTTTATAGTCAAGAACTGGG + Intronic
1065061077 10:21901161-21901183 CCATATTTAAATGAAGTACTTGG + Intronic
1065079206 10:22111145-22111167 TTATTTTAAAATACAGAACTTGG + Intergenic
1065387822 10:25150770-25150792 GCATTTTAAAAGAAATAATTAGG - Intergenic
1065414376 10:25468403-25468425 CCATTTTATAAGAAAAAACAAGG - Intronic
1065491452 10:26286196-26286218 CAATTTTAAAAAAAAGAATGGGG - Intronic
1065572272 10:27083421-27083443 ACATTTTAAAATAAATAAACTGG + Intronic
1066520707 10:36215539-36215561 ACATTATAAAATCAAGAACAAGG - Intergenic
1066574257 10:36808479-36808501 CCATTTTAAAAAGAACTACTAGG - Intergenic
1066760910 10:38752068-38752090 CCATTTTAAAATATATAAATAGG + Intergenic
1066960670 10:42220354-42220376 CCATTTTAAAATATATAAATAGG - Intergenic
1067475895 10:46565873-46565895 CCAATTTAAAAAAGAGAAATTGG + Intergenic
1067546153 10:47194023-47194045 CCATTTCAAAATGAGGAATTTGG + Intergenic
1067618843 10:47775902-47775924 CCAATTTAAAAAAGAGAAATTGG - Intergenic
1067993207 10:51239411-51239433 CCATTATAAAAGAAATATCTGGG - Intronic
1068354365 10:55891705-55891727 CAATTATAAAATAATGAAATAGG + Intergenic
1068368361 10:56081986-56082008 CCATTTTAAGATGAAGAAATTGG - Intergenic
1069045845 10:63742161-63742183 CCATTTTAAAGTACAAAACCAGG + Intergenic
1069093686 10:64232085-64232107 CCCTTTTCAAATAAATAGCTTGG - Intergenic
1069429985 10:68325667-68325689 ACATTGTAAAATAAGGAAGTAGG - Intronic
1070138694 10:73719641-73719663 CCACTTTAAAATAAAGAATGAGG + Intergenic
1072562458 10:96588322-96588344 CCACTTTAAAAAAAGGAAATAGG + Intergenic
1073824619 10:107305798-107305820 TCATTTTAAAATTAAGAATTTGG + Intergenic
1074126853 10:110535398-110535420 CCATTTTAAAGAAAAGAAGCTGG - Intergenic
1074617527 10:115084405-115084427 CAATTTAAAAATGTAGAACTTGG + Intergenic
1074914798 10:117945260-117945282 CAGTTTTAAAATGAGGAACTGGG + Intergenic
1074920766 10:118008394-118008416 ACATTTTCAAATCAAGAAATTGG + Exonic
1075290709 10:121228307-121228329 CCATTCTAAAAGAAAGAAATAGG + Intergenic
1075303530 10:121347097-121347119 CCATTTCAAAGCACAGAACTTGG + Intergenic
1075322750 10:121505310-121505332 CAGTATTAAAATAAAGAAGTGGG + Intronic
1075430064 10:122372915-122372937 ACATTTAAAAATAAAAATCTAGG - Intergenic
1075652657 10:124139456-124139478 GAATTTTAATATAGAGAACTAGG + Intergenic
1075897314 10:126008353-126008375 TCATTTTAAGAAAAAGAAATTGG + Intronic
1075901418 10:126045416-126045438 AAGTTTTAAAATAAAGAATTTGG + Intronic
1076255667 10:129022555-129022577 GCATTTTTACATATAGAACTTGG + Intergenic
1076578823 10:131492939-131492961 CAATTTAAAAATAAAGGACAAGG + Intergenic
1077995851 11:7452030-7452052 ACATTTTAAAATTAACCACTGGG - Intronic
1078535929 11:12174216-12174238 CCATTTTAAAATGTATAATTTGG + Intronic
1078841912 11:15085192-15085214 CCATTTTTTAATAAAAAAATTGG + Intergenic
1078974019 11:16450304-16450326 AGATTTTCAAATACAGAACTTGG + Intronic
1079403013 11:20121358-20121380 CCATTTTTAAAGAGAAAACTAGG + Intronic
1079619236 11:22533227-22533249 CAATTTTATAATAAAAAATTGGG + Intergenic
1079645437 11:22859428-22859450 TAATGTTTAAATAAAGAACTAGG - Intronic
1079805358 11:24923757-24923779 CCATTTTAGGATAAAGACCTTGG - Intronic
1080031388 11:27665271-27665293 CCACTCTGTAATAAAGAACTTGG + Intronic
1080559390 11:33448858-33448880 CTATTTCAAAAGAAACAACTTGG + Intergenic
1080688804 11:34538304-34538326 CCATTGTAAAACAAAGAAGCGGG - Intergenic
1080888864 11:36391198-36391220 ACAACTTAAAATAAAGAAGTGGG - Intronic
1081076953 11:38687927-38687949 GCAATTAAAAATAAAGAATTTGG + Intergenic
1081087389 11:38818587-38818609 GCATTTTAAAAAAAATAACCAGG - Intergenic
1081901392 11:46631352-46631374 CTAATTTTAAATAAAGAAATAGG - Intronic
1081943274 11:46963942-46963964 ACATTTAAAAATAATGAATTAGG - Intronic
1082217831 11:49596204-49596226 CCATTTTAAAAGAATGAATTAGG - Intergenic
1084076655 11:66783780-66783802 CCATTTTAAAGTATACAATTTGG + Intronic
1085890442 11:80573018-80573040 CCATTATAAATGAAAGAAATTGG + Intergenic
1086114973 11:83239588-83239610 CCATATGCAAAAAAAGAACTTGG - Intronic
1086429046 11:86717536-86717558 CCATTTTAAAATGAACAGTTTGG - Intergenic
1086631737 11:89027945-89027967 CCATTTTAAAAAAATGAATTAGG + Intronic
1087128523 11:94649573-94649595 CTATTCTAAAATAAATAACTCGG + Intergenic
1087335795 11:96842742-96842764 CCATATTTTAATAAAGAGCTTGG + Intergenic
1087399368 11:97645177-97645199 AAATTTTAAAATAAAAAATTGGG + Intergenic
1087463291 11:98472297-98472319 CCTTTTTAAAAAAAATAGCTGGG + Intergenic
1087471823 11:98584910-98584932 CCATTTAAAAATAAGGACCCTGG - Intergenic
1087652814 11:100888034-100888056 CAATTTTTAAATAAAGTACAGGG - Intronic
1087672522 11:101125389-101125411 ACAGTTTAAAATAAAAAACCTGG - Intronic
1088195978 11:107274226-107274248 CAGTTTCAAAATAGAGAACTGGG + Intergenic
1088299538 11:108341691-108341713 TCATTTTAATATAAAGAACAAGG + Intronic
1088539607 11:110899934-110899956 CTATTTTAAAACAAACATCTTGG + Intergenic
1088616686 11:111637255-111637277 TTATTTTAAAAGAAATAACTAGG - Intronic
1088650761 11:111956379-111956401 CAATTTTAAAAAAATGACCTAGG + Intronic
1088655812 11:111998832-111998854 ACATTTAAAAATATAGTACTAGG - Intronic
1090136339 11:124203370-124203392 ATATATTAAAATAAATAACTGGG + Intergenic
1090481463 11:127072358-127072380 CCATTGTAAAATAAAGATTTTGG - Intergenic
1090582339 11:128173912-128173934 TAATTTAAAAATAAAGAAATAGG + Intergenic
1090602450 11:128387219-128387241 ACATTTTAAAAATGAGAACTGGG - Intergenic
1090810796 11:130240338-130240360 ACATTTAAAAATATAGAACACGG - Intronic
1091125474 11:133091651-133091673 CCATTCTAAAAGGAAGAAATAGG - Intronic
1091208532 11:133836634-133836656 CGATTTTAAAATAGAAATCTAGG + Intergenic
1091436600 12:478493-478515 CCATTTTGAGAAAAAGAAATGGG + Intronic
1091944323 12:4521906-4521928 CCATTTAAAAATAGATAAATTGG + Intronic
1092035205 12:5328498-5328520 CCATTTTAAAATGGGGAAATGGG + Intergenic
1092202770 12:6596793-6596815 CCATTTCAAAAAAAAAAATTAGG + Intronic
1092636177 12:10452457-10452479 CCATTTTAGATTAACAAACTGGG - Intronic
1092799495 12:12150008-12150030 TCATCTTAAAATAAAGACCAAGG - Intronic
1093129563 12:15373879-15373901 CCATTTTAAAATAAGGTCATAGG - Intronic
1093501665 12:19819548-19819570 TCATTTTAAGATAAGGAAATTGG - Intergenic
1093739035 12:22659403-22659425 CCACTTAAAAATAAAGAGTTAGG + Intronic
1094172840 12:27512197-27512219 CCTTTTTAAAAAAAAGATTTTGG + Intergenic
1094353190 12:29549304-29549326 TCACTTTAAAATAAAGTTCTAGG + Intronic
1094469565 12:30791198-30791220 GCTTTTTAAAAAAAAAAACTGGG + Intergenic
1095278572 12:40321919-40321941 TCATTTTGAAATAAAGTATTGGG - Intronic
1095353022 12:41237290-41237312 CCATTTTATGAGAAAAAACTAGG - Intronic
1095449183 12:42311591-42311613 CCATTTTAAAGCAAATAATTGGG - Intronic
1095607163 12:44082841-44082863 CTATTTTAAAATAAAGGCATGGG - Intronic
1096812480 12:54180378-54180400 TCATTGTATAATAAAGAATTTGG - Intronic
1096853872 12:54463930-54463952 TTGTTTTAAAATAAGGAACTTGG - Intronic
1098070289 12:66667495-66667517 ACATTTATTAATAAAGAACTAGG + Intronic
1098270518 12:68765250-68765272 CCATTTCAAAAAAAAAAAATTGG + Exonic
1098618834 12:72565182-72565204 GCATTGTAAAATAAAGATCTAGG - Intronic
1098896899 12:76073312-76073334 CCGTGTTAAAATAGAGCACTTGG - Intronic
1098907408 12:76176323-76176345 GCTTTTTAAAATAGAGGACTGGG - Intergenic
1098918124 12:76278117-76278139 GCATTTTGAAATAAACACCTTGG + Intergenic
1099347797 12:81524484-81524506 CCACTGGAAAATAAAGAAATAGG - Intronic
1099395903 12:82138327-82138349 CCATCCTAAATTAAAGAATTGGG + Intergenic
1099495761 12:83343832-83343854 CCATTTCAAAAGAAAGAAGTTGG - Intergenic
1099803253 12:87483144-87483166 TCATTTTAAAAAAAATAGCTGGG + Intergenic
1100116709 12:91314147-91314169 CCATTTTAAAATATAGAAACTGG - Intergenic
1100206809 12:92358692-92358714 TCATTTTAAAATATAACACTTGG + Intergenic
1100530797 12:95459785-95459807 TCATTTAAAAACAAAAAACTGGG + Intergenic
1101441416 12:104706846-104706868 ACATTTTAATATGGAGAACTTGG + Intronic
1101742940 12:107515241-107515263 ACATTTTAAAACAAAGATCTGGG + Intronic
1101773956 12:107776795-107776817 CCTTTTTAAAATATTGAATTTGG + Intergenic
1101807499 12:108077131-108077153 CTTTTTTAAAAAAAAGAACGAGG + Intergenic
1101863692 12:108503705-108503727 GCATTTTACAATAAAAAAATTGG + Intergenic
1102151727 12:110693138-110693160 CCAATTTAAAAAAAAAAATTTGG - Intronic
1102820837 12:115907977-115907999 CCATCTCAAAATAAATAAATAGG + Intergenic
1103050434 12:117774689-117774711 CCATTTCAAAGTACAGAATTCGG + Intronic
1103205700 12:119127219-119127241 TAAATTTAAAAAAAAGAACTGGG + Intronic
1103498023 12:121378068-121378090 CCATTTTAAAGTAAATAATTTGG + Intronic
1103526340 12:121571592-121571614 CCATTTTAAAATGTAGAAGTTGG - Intronic
1103651337 12:122434908-122434930 CCATTTAAAAATAAACAATTCGG - Intergenic
1105013399 12:132770934-132770956 TAATTTTAAAATCAAGAAATCGG - Exonic
1105446114 13:20458903-20458925 ACATTTTAAAATACAGACATTGG + Intronic
1105987721 13:25585443-25585465 CCATTTTAAAGTAATTAAGTTGG + Intronic
1106021149 13:25916643-25916665 TCATTTGGAAACAAAGAACTTGG - Intronic
1106305115 13:28502834-28502856 TCATTTTCAAATAAATAACATGG - Intergenic
1106431094 13:29681339-29681361 CCATTTTAAAGTATATAATTTGG + Intergenic
1106728630 13:32514831-32514853 CCACTTTAAAAAAACCAACTAGG + Intronic
1107191753 13:37596369-37596391 TCATTGTAAAATAAAGACTTTGG + Intronic
1107206023 13:37789568-37789590 CCATTTTAGATTAAATAAATAGG + Intronic
1107502408 13:40993783-40993805 CTAATTTAAATTAAAGAACCCGG - Intronic
1107776367 13:43847436-43847458 CCATATTTAAAAAAAGAAGTGGG + Intronic
1107780079 13:43890799-43890821 TCATTTTAAAATAAAAATTTGGG - Intronic
1107962758 13:45573473-45573495 CCATTTTAAAATATTGAAGTAGG - Intronic
1108100359 13:46947772-46947794 CCATTTGAAAATAAATAATCAGG + Intergenic
1108888038 13:55214367-55214389 TCATTTTAAAATCAATTACTGGG + Intergenic
1108893660 13:55295182-55295204 CCATTCTAAAAGGAAGAAATTGG - Intergenic
1109151095 13:58848148-58848170 CCATCTTAAAAAAAAGAAGAAGG - Intergenic
1109326814 13:60877908-60877930 CTATGTTCAAATAGAGAACTTGG + Intergenic
1110059186 13:71019902-71019924 CTATTTTAAAAGAAACAAATAGG - Intergenic
1110157123 13:72330918-72330940 GCATTTTAAAATATACAATTAGG - Intergenic
1110316011 13:74107400-74107422 CTAAGTTAAAATAAAGAAATAGG + Intronic
1110384488 13:74892899-74892921 ACATATTAAAATTAAGAAATTGG - Intergenic
1110423106 13:75335401-75335423 CCATTTTAAAATAAGCAAAATGG - Intronic
1110962727 13:81649746-81649768 TCATTTTAAAATAAATACCTTGG - Intergenic
1111166802 13:84468444-84468466 CCACATTAAAATAAAGAAGTTGG + Intergenic
1111437124 13:88225109-88225131 ACACTTTAAAAAACAGAACTGGG - Intergenic
1111695311 13:91615863-91615885 CCCTTTTAAAATATACTACTAGG + Intronic
1111718809 13:91915850-91915872 GCATTTTAATTTAAACAACTAGG + Intronic
1111818756 13:93188274-93188296 CCATGTTAAGATATACAACTTGG + Intergenic
1112051662 13:95649282-95649304 CCATTTCAAAAGAGAGAAATAGG + Intergenic
1112198865 13:97255592-97255614 CCATTTTCAAATAAACAATTAGG + Intronic
1112668391 13:101603744-101603766 CCATTTCAAATTAAAAACCTTGG + Intronic
1112804931 13:103154138-103154160 CCATATTTAAATAAAAATCTAGG + Intergenic
1113452544 13:110421680-110421702 CCATTTTAAAGGATACAACTCGG - Intronic
1113502783 13:110790944-110790966 CCCTTTAAAAACAGAGAACTTGG - Intergenic
1115567216 14:34635278-34635300 ACATTTTTAAATAAAAAAATTGG + Intergenic
1115657868 14:35461403-35461425 CCATTTTAAGATGAAGAAACAGG + Intergenic
1115916471 14:38320941-38320963 CCATTCCAAAAGAAAGAAATTGG + Intergenic
1116605927 14:46994990-46995012 CAATATTAAAATAAAAAATTTGG + Intronic
1116711713 14:48376397-48376419 CTATTGTAAAATAAATCACTTGG - Intergenic
1117050581 14:51855890-51855912 CAATCAAAAAATAAAGAACTAGG + Intronic
1117309177 14:54505099-54505121 ACATTTCAAAATCAAGACCTTGG + Intergenic
1117408580 14:55428877-55428899 CGATTTTAAAATTCAGAACATGG - Exonic
1117463255 14:55967750-55967772 CCATTCTTGAATAAAGAACTTGG + Intergenic
1117582481 14:57166366-57166388 CCATTTCAAAAAAAAGAAAAAGG + Intergenic
1117800777 14:59442625-59442647 CCATTTCCAAAGACAGAACTGGG + Intronic
1117818899 14:59627974-59627996 CCAATTTAAAAAAAAAAAATGGG - Intronic
1118678655 14:68216247-68216269 CCAGTTTAAAATAAAGAAATAGG - Intronic
1118829214 14:69413915-69413937 TCAATTCAAATTAAAGAACTGGG - Intronic
1118879976 14:69817721-69817743 CCGTCTCAAAAAAAAGAACTTGG - Intergenic
1118931401 14:70244931-70244953 CCAGATTAAAACAAAGAGCTAGG + Intergenic
1119324997 14:73754603-73754625 CCATTTGAAAATGAAGGATTCGG + Intronic
1119639180 14:76301848-76301870 CCATTTTAAAATCAAGTTATTGG - Intergenic
1119923840 14:78472757-78472779 CTATTTTAAGATAAAGGACAGGG + Intronic
1119975761 14:79022336-79022358 CCAATTTAAAAAAAAGAATTGGG - Intronic
1120380545 14:83773502-83773524 CCATTAAAACAAAAAGAACTGGG - Intergenic
1120512774 14:85435384-85435406 TGATTTTAAAATAATGTACTTGG - Intergenic
1120568108 14:86084083-86084105 ATTTTTTAAAATAAAGAATTGGG + Intergenic
1120572693 14:86141559-86141581 CCATTTTACAATCAAAGACTAGG - Intergenic
1121091521 14:91186211-91186233 ACATTTTTAAATAAAAAAATTGG - Intronic
1121409972 14:93743111-93743133 CAATTTTAAAACCAAGAACATGG - Intronic
1121474530 14:94185190-94185212 CCATTTTACATTAGGGAACTTGG - Intronic
1122725720 14:103750387-103750409 GCATTTTAAAGAAATGAACTAGG + Intronic
1122760792 14:104023991-104024013 TCATTTTAGAATAAAGTATTAGG + Intronic
1123420888 15:20130551-20130573 CCATTTAAAAATATATAAATAGG - Intergenic
1123444965 15:20322959-20322981 CCATTTTAAAATATATAAATAGG + Intergenic
1123530113 15:21137080-21137102 CCATTTAAAAATATATAAATAGG - Intergenic
1125003905 15:34796943-34796965 CCAGTTAAAAATAGAAAACTGGG + Intergenic
1125915495 15:43483311-43483333 AACTTTTAAAATAAAAAACTTGG + Intronic
1125965835 15:43874897-43874919 CCATCTTAAAAAAAAGAAAAAGG + Intronic
1126055070 15:44722634-44722656 CCACTTTAAAAAAACAAACTAGG + Intergenic
1126357558 15:47812374-47812396 CCATTTTAATATGAGGAAATTGG + Intergenic
1126429609 15:48567424-48567446 CCAGTTTAAAAAAAATAAATTGG + Intronic
1126745511 15:51822273-51822295 CCATCTCAAAAAAAAAAACTGGG + Intergenic
1127102132 15:55577167-55577189 CCATTTTTACATAAACAACAGGG - Intronic
1127192516 15:56545837-56545859 CCATTTTTAAAATAATAACTTGG - Intergenic
1127464463 15:59230813-59230835 ACGTTTTAAAATAAATAAGTGGG - Intronic
1127526811 15:59800879-59800901 CTATTTTAAAAACAAGAAATTGG + Intergenic
1127559818 15:60124970-60124992 ACATTGCAACATAAAGAACTTGG + Intergenic
1128631154 15:69268900-69268922 CCATTTAAAACAAAAGAGCTAGG - Exonic
1130718212 15:86357790-86357812 CAATTTTAAAATTAAAAAGTTGG + Intronic
1131657600 15:94477741-94477763 CCATTTTAATTTCTAGAACTCGG - Intronic
1131719490 15:95152003-95152025 CCATTTTAAAGTTAACAATTCGG + Intergenic
1132166704 15:99599720-99599742 TCATTTTAAAATATAAACCTTGG + Intronic
1132180823 15:99751575-99751597 ACATTTTAAAAATAAGAAATGGG - Intergenic
1133018978 16:2958045-2958067 CCCATTTAAAATAAAAAAATAGG + Intergenic
1133185226 16:4091373-4091395 CACTTTTAAAATGAGGAACTTGG - Intronic
1133434331 16:5766284-5766306 GCACTTTAAAATACAGATCTGGG + Intergenic
1133752735 16:8737176-8737198 TTATTTTAAAATAAACATCTTGG + Intronic
1134054207 16:11159012-11159034 CCTTTTGAAAATTAAGAAGTGGG - Intronic
1134096445 16:11421894-11421916 CCGTTTTAAAGTATACAACTCGG - Intronic
1134392420 16:13831772-13831794 CTATTTTAAAATACAGATTTTGG - Intergenic
1134897134 16:17898330-17898352 ACATTTAAAAACAAAGAACTTGG - Intergenic
1135386881 16:22050258-22050280 ATATTTTAAATTAAAGTACTTGG - Intronic
1135513450 16:23109260-23109282 CCATTTTCCAATATAAAACTAGG + Intronic
1135554870 16:23427856-23427878 ACATTTAAAAATAACGAATTTGG - Intronic
1135764507 16:25165965-25165987 CCAGTTCAAAACAAAGAACTGGG - Intronic
1136721791 16:32325639-32325661 CCATTTAAAAATATATAAATAGG - Intergenic
1136840173 16:33531918-33531940 CCATTTAAAAATATATAAATAGG - Intergenic
1137435650 16:48452552-48452574 TCATTATAAATAAAAGAACTGGG - Intergenic
1137509904 16:49090067-49090089 GGATTTTAAAATAAATAATTGGG - Intergenic
1137569352 16:49554975-49554997 GCACTTTAAAATTAAGAGCTTGG + Intronic
1137785340 16:51133684-51133706 CCTTTTTAAAAAAAAAAGCTGGG + Intergenic
1138394916 16:56696388-56696410 CCACTTTAAAAGTAAGACCTTGG - Intronic
1138668577 16:58594491-58594513 CCCTTTTAAAATATATAATTTGG - Intronic
1138957064 16:61984211-61984233 CCTTATTAAAATAAAGAGTTGGG - Intronic
1139030874 16:62878810-62878832 CCATTCTAAAAGGAAGAAATTGG - Intergenic
1139033242 16:62911248-62911270 CCATTTCAAATGAAAGAAATTGG + Intergenic
1139224432 16:65220460-65220482 CCATTTTAGAAATAAGAAATTGG - Intergenic
1140854207 16:78963735-78963757 CCATTTTAAGATACAGAAAGTGG + Intronic
1141562958 16:84882127-84882149 TGATTTAAAAATAAAGAGCTGGG + Intronic
1203004641 16_KI270728v1_random:192131-192153 CCATTTAAAAATATATAAATAGG + Intergenic
1203136192 16_KI270728v1_random:1728250-1728272 CCATTTAAAAATATATAAATAGG + Intergenic
1203150340 16_KI270728v1_random:1832208-1832230 CCATTTAAAAATATATAAATAGG - Intergenic
1142815928 17:2425387-2425409 CCAGTTTAATGCAAAGAACTAGG + Intronic
1143051112 17:4126652-4126674 CTATTTTAAAAAGCAGAACTGGG + Intronic
1143421357 17:6795328-6795350 CAATTATAAAATTAACAACTGGG + Intronic
1143886256 17:10067247-10067269 CCATCTCAAAAAAAAGAAGTGGG - Intronic
1144565508 17:16355796-16355818 CAATTTAAAAATGAAGAACATGG + Intergenic
1144929114 17:18843232-18843254 GCATTGTAATATAAAGAAGTTGG + Intronic
1145031841 17:19510409-19510431 CCAATTTTAAATAGAGACCTTGG - Intronic
1145294857 17:21580600-21580622 CCATTTTTAAATATATAAATAGG - Intergenic
1145368978 17:22292576-22292598 CCATTTTTAAATATATAAATAGG + Intergenic
1146431643 17:32801786-32801808 GCATTTAGAAATCAAGAACTGGG - Intronic
1146713736 17:35065785-35065807 CCACTTTAAAAGGAAGAACTAGG - Intronic
1146742586 17:35299439-35299461 CCATGTTAAATTAAAGGATTGGG - Intergenic
1147053035 17:37811696-37811718 CCATTCAAAAATAAATAAATGGG - Intergenic
1147241455 17:39093395-39093417 TTATTTTTAAATAAACAACTGGG - Intronic
1148203415 17:45764932-45764954 TCTTTATAAAATAAAGATCTTGG - Intergenic
1149045540 17:52240466-52240488 CATTTTTGAAATGAAGAACTGGG + Intergenic
1149060730 17:52418462-52418484 CTATTATAAAATAAATAAATTGG + Intergenic
1149371774 17:56001675-56001697 CCAGTTTACAACAAAGAACAGGG - Intergenic
1149678836 17:58489407-58489429 CCATCTCAAAATAAATAAATTGG + Intergenic
1150010434 17:61497769-61497791 ATTTTTTAAAATAAAGAACCTGG - Intergenic
1150475881 17:65474515-65474537 CAAATTTAAATTAAGGAACTTGG + Intergenic
1150554870 17:66245391-66245413 AGCTTTTAAAATAATGAACTGGG - Intronic
1151492145 17:74439025-74439047 ACATTTTAAAAGTAAGAACCAGG - Intronic
1151872847 17:76848284-76848306 CCATTTAAAAATATACAATTCGG - Intergenic
1151913315 17:77099043-77099065 CCATTGCAATAAAAAGAACTTGG - Intronic
1152493161 17:80651578-80651600 CCATTTTAAAGTGTACAACTTGG + Intronic
1153351683 18:4087806-4087828 CCATTTTAAAATAAAGAACTAGG - Intronic
1153547433 18:6222585-6222607 AGATTTTAAAATAAAAAGCTAGG + Intronic
1154125329 18:11687976-11687998 ACATTTTTAAATCAAGAAGTTGG - Intergenic
1154208808 18:12361346-12361368 CCATTTCAAAATAAAAAACAAGG + Intronic
1154374536 18:13798211-13798233 ACATTTTAAAATAAAGAGGCCGG + Intergenic
1155488013 18:26368180-26368202 ACATTTTCAAATAGAGAACCAGG + Intronic
1155662103 18:28261563-28261585 CCATTTAAAGATAAACAATTAGG - Intergenic
1155874320 18:31066108-31066130 CCATTTTAAAATGATGAAAATGG + Exonic
1156007452 18:32460347-32460369 GCATTTTAAATTCAATAACTTGG + Intronic
1156040911 18:32821894-32821916 TATTTTTAAAAAAAAGAACTAGG - Intergenic
1156111559 18:33733219-33733241 GCATTTGAAAATAAAACACTGGG - Intronic
1156214383 18:34980919-34980941 CCATATTAAAAGTAAGAAGTTGG + Intronic
1156323678 18:36052978-36053000 CCATCTCAAAAAACAGAACTAGG + Intronic
1156632435 18:38985840-38985862 TCATTCCAAAATAAAGAAATTGG - Intergenic
1156644190 18:39140272-39140294 CCGTTTTAGAATAAAGATCTTGG + Intergenic
1157245330 18:46048971-46048993 CCATTTGAAAGTAAAGAAGTAGG - Intronic
1157355575 18:46930800-46930822 CCATGTTAAAAAAAATAAATAGG + Intronic
1157737174 18:50060132-50060154 CCATTTTAAAGTGAACAATTTGG - Intronic
1158205131 18:54984589-54984611 CAATTTGGAAATAAATAACTGGG + Intergenic
1158411858 18:57212828-57212850 CCATTTTAAAGTATACAATTTGG + Intergenic
1158551597 18:58440645-58440667 CAATTTTAAAATAAAGAAACAGG - Intergenic
1158669551 18:59462682-59462704 CCATTTAAAAAAAAAAAATTAGG - Intronic
1159204846 18:65236254-65236276 TCAATTTAAATTAAAGGACTAGG + Intergenic
1159369564 18:67513699-67513721 CCATTTTAATATCAACAACTTGG - Exonic
1159718965 18:71861323-71861345 CCATTTTAAAATAATTGATTAGG - Intergenic
1160709757 19:545645-545667 CCATCTTAAAAAAAAAAAATAGG - Intronic
1161131662 19:2593298-2593320 CCTTTTTTAAAAAAAAAACTTGG + Intronic
1161617315 19:5278780-5278802 GCTTTTTAAAATAAACTACTAGG + Intronic
1161763534 19:6192421-6192443 ACATTTTTAAAAAAGGAACTTGG - Intronic
1162755098 19:12853278-12853300 CCATTTTAAAATGAACAATTCGG + Intronic
1163864059 19:19757611-19757633 CCATTCTAAAAGGAAGAAATTGG + Intergenic
1164132170 19:22373653-22373675 TTATTTTGAAATAAAGTACTTGG - Intergenic
1164278347 19:23745023-23745045 CCTTTTAAATATAAAGAATTTGG - Exonic
1164299687 19:23950880-23950902 CCACTTTAAAATAATGACATAGG + Intergenic
1164926623 19:32135699-32135721 CCATTTTAAAATGAACAATTCGG - Intergenic
1165404046 19:35619287-35619309 TCACTTAAAAATTAAGAACTGGG + Intronic
1165439136 19:35814273-35814295 CCATTTTAAAAAAAGAAAATAGG - Intergenic
1165909442 19:39215946-39215968 TGATTTTAAAATAAGGAAATTGG - Intergenic
1166692517 19:44831925-44831947 CCATTTTAAAATAAAGTCCATGG + Intergenic
1166711940 19:44943367-44943389 CCATTTTAACATAAAGTACATGG - Intronic
1166973465 19:46588003-46588025 GCATTTTTACATAAACAACTGGG - Intronic
1168550106 19:57285708-57285730 CCACTGAAAAATAAAAAACTGGG - Intronic
1202690429 1_KI270712v1_random:83876-83898 CCATTTTAAAATATATAAATAGG - Intergenic
925029367 2:637226-637248 CCATTTTATAGTCAATAACTTGG - Intergenic
925078695 2:1042150-1042172 CCATTTTAAAAAAGAAAATTTGG - Intronic
925255760 2:2485695-2485717 CCATTTTAGAAAAGTGAACTAGG - Intergenic
925494677 2:4433857-4433879 TCTTTTTAAAAAAAAAAACTTGG + Intergenic
925532464 2:4879771-4879793 CCATTTTCCAATATGGAACTGGG - Intergenic
926011105 2:9408637-9408659 CGATTTAAAAATAAATAAATTGG - Intronic
926314367 2:11698339-11698361 GGATTTTTAAATACAGAACTCGG - Intronic
926556479 2:14363852-14363874 CAATTGAAAAATAAAGAACGAGG - Intergenic
927018004 2:18987491-18987513 CCATTTTAAAATAGATAATAGGG - Intergenic
927073503 2:19553382-19553404 CTTTTTTTCAATAAAGAACTAGG + Intergenic
927685366 2:25167352-25167374 CCATTTAAACATGAAGAATTTGG + Intronic
928444878 2:31324983-31325005 ACAGTTGAAAATAAAGAAATGGG + Intergenic
928477382 2:31643554-31643576 CTATTTATAAATAAAGATCTAGG - Intergenic
928517420 2:32057030-32057052 GTTTTTTAAAATAAAGAATTTGG - Intergenic
928528962 2:32170990-32171012 CCATTTAAAAATAAAGAGTGTGG + Intronic
928804521 2:35133870-35133892 CCCTGTTCAAGTAAAGAACTGGG - Intergenic
928886436 2:36154144-36154166 CTTTTTTAATATAAAGAAGTTGG - Intergenic
929038085 2:37714930-37714952 TCCTTTTAACATAAAGAACAAGG - Intronic
929096896 2:38271293-38271315 CCATTTTAAAATCAGGAACAAGG - Intergenic
929249787 2:39740219-39740241 CTTTTTTAAAATAAAAAATTGGG + Intronic
929259526 2:39849494-39849516 CCATATTAAAATGCAGAATTGGG + Intergenic
929418029 2:41763515-41763537 CCCTTCTACAATAAAGGACTTGG + Intergenic
929790028 2:45015257-45015279 CCCTTTAAAAATGTAGAACTCGG - Intergenic
929871291 2:45761512-45761534 CCATTTTATCAGAAAGAACGGGG + Intronic
930080576 2:47444164-47444186 CTAATTTGGAATAAAGAACTAGG + Intronic
930153651 2:48082893-48082915 CCATTTTAAAATACCAAAGTGGG + Intergenic
930427591 2:51231695-51231717 CCATTTTTAAATAAAGCATCTGG - Intergenic
930640516 2:53850050-53850072 CCATCTTAAAAAAAAGAAAAGGG + Intergenic
931146534 2:59525800-59525822 TCATTAGAAAAAAAAGAACTAGG - Intergenic
931428465 2:62191822-62191844 CCATTTTTAAAAAAAGACATGGG + Intergenic
931496598 2:62813803-62813825 CCATTTCAAAAGAGAGAAATAGG - Intronic
931593733 2:63916166-63916188 ACATTGTAAAATAAAGATATTGG - Intronic
932499010 2:72164912-72164934 GTATTTTAAAATCAAGATCTGGG - Intergenic
932622248 2:73271633-73271655 CCATCTCAAAAAAAAGAAGTTGG - Intronic
932757819 2:74421082-74421104 CAATTTTAAAATAAAGAAAACGG - Intronic
932827199 2:74952552-74952574 CCCTGTTAAAATAAATAATTGGG + Intergenic
933020522 2:77184904-77184926 CCACATGAAAATAAAGAACATGG - Intronic
933117113 2:78487904-78487926 ACATTTTAAAACAAGAAACTAGG - Intergenic
933204325 2:79488003-79488025 CACTTTAAAAATGAAGAACTAGG - Intronic
933572484 2:84029678-84029700 GCCTTTTAAAATAAACAACCAGG - Intergenic
933696081 2:85218584-85218606 CTATATTAAAATCATGAACTAGG + Intronic
933955986 2:87372129-87372151 CCATTTTAAAGTATATAAATAGG + Intergenic
934240139 2:90264160-90264182 CCATTTTAAAATATATAAATAGG + Intergenic
934273053 2:91552591-91552613 CCATTTTAAAATATATAAATAGG - Intergenic
934662563 2:96150905-96150927 CCATATGCAAATGAAGAACTGGG + Intergenic
934891549 2:98074804-98074826 CCATTTCAAAAGACAGAAGTTGG + Intergenic
935086124 2:99847113-99847135 CGATTTAAAAATATAAAACTTGG - Intronic
935428634 2:102948946-102948968 TCATTTTGAGATAAAGCACTTGG + Intergenic
935706589 2:105862590-105862612 CATTTCTAAAACAAAGAACTTGG - Intronic
935719154 2:105964789-105964811 TCATTTTATAATAAAGAAGAAGG - Intergenic
936585657 2:113756065-113756087 TCATTTTAAAAGAAACAGCTGGG + Intronic
937515444 2:122649834-122649856 CCATTTTAAAGGAGAGAAATTGG + Intergenic
937918858 2:127115890-127115912 CCATTTTTAAATAGATAATTAGG - Intergenic
938196716 2:129335011-129335033 CTATTTAAAAATAAAGAAACTGG + Intergenic
938494303 2:131785245-131785267 CCATTATAAAAGAGAGAAATTGG + Intergenic
938714922 2:134010416-134010438 CCATTTTTAATTAAAGTAATTGG - Intergenic
938841010 2:135163498-135163520 CTTGTTTAAAATAAACAACTAGG - Intronic
939596627 2:144132385-144132407 CCATTAAAAAATAAACAATTTGG - Intronic
939756727 2:146122705-146122727 CCAGTTTGAAGTAAGGAACTGGG + Intergenic
940295236 2:152115844-152115866 CTATTTAAAAATCAAGAAATAGG + Intergenic
940606709 2:155933696-155933718 GCAATTTCACATAAAGAACTAGG - Intergenic
940738682 2:157482220-157482242 CAATATTAAAATAGAGAAGTTGG + Intronic
940768679 2:157817697-157817719 CTATTTTAAAAGAAAAAATTAGG + Intronic
941614580 2:167704531-167704553 CTACTTTAAAAAAAAAAACTAGG + Intergenic
941752855 2:169151582-169151604 GCCTTTTAAAATAACAAACTCGG + Intronic
941856661 2:170238099-170238121 TAATTTTAAAGTAAATAACTTGG - Intronic
942099228 2:172561955-172561977 CCATTTTAGAATGTAGAACTCGG + Intronic
942567870 2:177284670-177284692 CAATTTAAAAAAAAAGAATTAGG - Intronic
942802537 2:179892244-179892266 GCTTTTTAAAATACAAAACTGGG + Intergenic
942894481 2:181035380-181035402 ACATTTTAAAATAAAGAACATGG - Intronic
943212087 2:184979916-184979938 CCTTTTTAAAATAAAATACCTGG - Intergenic
943212866 2:184990085-184990107 CCATTCAAAAAGAAAGAAATAGG - Intergenic
943216642 2:185045184-185045206 CCATTTAAAAAAACACAACTGGG + Intergenic
943260690 2:185658198-185658220 CCATGTTAATATAAACAATTTGG + Intergenic
943580236 2:189675250-189675272 CCATTATATAGTAAAGAACCTGG + Intronic
943695232 2:190921486-190921508 AAATTTTAAAATAAAAAATTGGG - Intronic
943705697 2:191031868-191031890 CAATTTTAATGAAAAGAACTGGG - Intronic
943938005 2:193949396-193949418 CTATTTTATAATGAAGAAATTGG + Intergenic
944513775 2:200490504-200490526 CCAAATTAAAGTCAAGAACTCGG - Exonic
944996008 2:205294614-205294636 TCACTTTAAAATAAAGTATTTGG + Intronic
945553692 2:211252724-211252746 GCATTTTAAACTATATAACTTGG - Intergenic
945818906 2:214638891-214638913 TCATCTTAAAAAAAATAACTGGG + Intergenic
946119790 2:217500064-217500086 CCATTTTAAAGTATACAATTCGG - Intronic
947375867 2:229494406-229494428 CCATTCCAAAAGGAAGAACTAGG + Intronic
947757311 2:232576196-232576218 CCATCTCAAAAAAAAAAACTGGG + Intronic
947790476 2:232864469-232864491 CCAATGTTAACTAAAGAACTTGG - Intronic
948015502 2:234687146-234687168 ACAATTTAAAATAAAAGACTGGG - Intergenic
949012818 2:241691141-241691163 CCATTTAAAAAAAAGGACCTGGG + Intergenic
1169103137 20:2969552-2969574 CCTTTTAAAAATAAATAAATAGG + Intronic
1170443433 20:16401278-16401300 TCATCTTGAAATGAAGAACTAGG - Intronic
1170512275 20:17090382-17090404 CTATTTTTAAATAAAACACTGGG + Intergenic
1170639743 20:18140861-18140883 CCATCTCAAAATAAATAAATAGG - Intronic
1170745324 20:19093648-19093670 ACATCTTAAAAGAAAGAAGTGGG + Intergenic
1171324703 20:24281266-24281288 ACAATTTAAATTAAAGAACGTGG + Intergenic
1172310029 20:33910747-33910769 TCTTTTTGAAATAAAGAACCAGG - Intergenic
1172468000 20:35171368-35171390 CCATTTTTAAAAAATGAAATAGG - Intergenic
1172759998 20:37315026-37315048 CCATTTCTCAATAAAGAACATGG + Intronic
1173397865 20:42697354-42697376 CCACTGTAAAATAAAACACTGGG - Intronic
1173751602 20:45481002-45481024 CCATTTTAACCTAAAGAAGAAGG + Intronic
1174633240 20:51976813-51976835 ATAGTTTAAAATAGAGAACTGGG + Intergenic
1174715131 20:52749556-52749578 CCATTTTAAAATAAGATTCTGGG + Intergenic
1174913246 20:54629348-54629370 TAATTTCAAAATAAAGCACTTGG + Intronic
1174978996 20:55370475-55370497 TCATTTTACAATAAAGAAAATGG - Intergenic
1174983272 20:55421316-55421338 CCAATTAAAAATAAACAAATTGG + Intergenic
1175369057 20:58474753-58474775 CCATTTTAAAGTGAACAATTTGG + Intronic
1177304218 21:19291794-19291816 CAATTTTAAAAGAAAGAAACAGG - Intergenic
1177329359 21:19636333-19636355 ACATTTTAAAATAATGAAAGGGG + Intergenic
1177641022 21:23845201-23845223 CCATTCTAAATGAAAGAAATTGG + Intergenic
1177773557 21:25544064-25544086 CCATTTCAAAATGAAGAAATAGG + Intergenic
1177865753 21:26511570-26511592 CCATTTTAAAAGCCAGCACTTGG - Intronic
1178832603 21:36069321-36069343 CCATCTTAAAATGAAGAAACAGG - Intronic
1180027310 21:45174399-45174421 TCTTTTTAAAATAAAAAATTAGG + Intronic
1180550990 22:16540675-16540697 CCATTTTAAAATATATAAATAGG + Intergenic
1180907043 22:19421499-19421521 CCATTTGGAAAAAAACAACTGGG - Intronic
1181336345 22:22133397-22133419 GCATTTTTACATAAAAAACTGGG + Intergenic
1181353009 22:22273243-22273265 CCATTTTAAAATATGTAAATAGG - Intergenic
1181450703 22:23018147-23018169 CCATTTCAAAAAAAAGAAAAAGG + Intergenic
1182015185 22:27033212-27033234 CCACTTTAAAATGATGAAATTGG - Intergenic
1182640750 22:31765294-31765316 CCATTTCAAAAAAAAGAAAAAGG - Intronic
1183735941 22:39644988-39645010 CCGTCTTAAAAAAAAGCACTGGG - Intronic
1183816803 22:40308716-40308738 CTATTTTGAAGTACAGAACTTGG + Intronic
949135588 3:561127-561149 CCATTTTAAAATGAAGCTCCTGG - Intergenic
949352370 3:3137207-3137229 ACACATTGAAATAAAGAACTTGG + Intronic
949479376 3:4478917-4478939 ATTTTTTTAAATAAAGAACTAGG + Intergenic
949722234 3:7003378-7003400 TCATTTTAAGATAAATAAATAGG + Intronic
949858480 3:8483805-8483827 CAATTTTAAAATAATTACCTGGG - Intergenic
950678123 3:14566858-14566880 CCACTGTAAAATTAAGAAGTTGG + Intergenic
951031469 3:17886533-17886555 TCATTTTAAAATAAAGGAGCAGG - Intronic
951059115 3:18183867-18183889 GCACTTTAAAATAAAGATATCGG - Intronic
951133444 3:19075467-19075489 CCATTCCAAAAGAAAGAAATTGG - Intergenic
951142946 3:19188706-19188728 TTATGTTAAAATAAAGAACTAGG + Intronic
951190967 3:19771027-19771049 CCATTTGTAAATAAACTACTAGG - Intergenic
951400942 3:22230779-22230801 ACAATTTAAATTAAAGAACATGG - Intronic
951507514 3:23464639-23464661 ACATTTTAAGATAAAGAAATAGG - Intronic
952592846 3:34978316-34978338 CCATTATCAAAGAAAGACCTAGG - Intergenic
952845543 3:37685087-37685109 CCATTTTAACATAAAGAACAAGG - Intronic
953649017 3:44782982-44783004 CTTTTTTAAAATAAACAAATAGG + Intronic
953727634 3:45414439-45414461 ACATTTTCAACTAAAGAAATAGG - Intronic
954054934 3:48014817-48014839 CCACTTTTAAATTAAGAAATAGG - Intronic
954094476 3:48314073-48314095 CCATTTTAAAGTGAACAAATTGG - Intronic
954103178 3:48393620-48393642 CTATTTTAAAATAAAAATCCAGG + Intronic
954601881 3:51876541-51876563 CTATTTGAAGATAAAGATCTTGG + Intergenic
955127313 3:56126208-56126230 CCATTTTAAAAAATGAAACTTGG - Intronic
955585408 3:60472287-60472309 CCTTTATAAAATAAAAAAGTGGG - Intronic
955634041 3:61006103-61006125 ACATTTGAAAATAAAGAGCTTGG + Intronic
955940059 3:64138899-64138921 CAATATTTAAATAAAGAAATTGG + Intronic
956470795 3:69564960-69564982 CCACTTTAAAATAAATAAGCAGG - Intergenic
956724553 3:72146277-72146299 CCTTTTACAGATAAAGAACTGGG - Intergenic
956781919 3:72610519-72610541 CCATTTCAAAAAAAAGAATTAGG + Intergenic
957148455 3:76454598-76454620 TCATTTTACAATGAAGAAATTGG - Intronic
957516649 3:81262978-81263000 CCATTGTAAAATCAAGAGGTTGG - Intergenic
957741396 3:84274551-84274573 CAATTTTAAAATACTGAACTAGG - Intergenic
958052195 3:88362793-88362815 CCACGTTAAAATAAAGCACTAGG - Intergenic
959023504 3:101214609-101214631 CCATTCTAAAAGGAAGAATTTGG - Intergenic
959148042 3:102573381-102573403 CCATCCTAAATTTAAGAACTTGG + Intergenic
959183114 3:103007463-103007485 CCATTCCAAAAGAAAGAAATTGG + Intergenic
959285236 3:104400100-104400122 CAATTCTAAAAAAAAGAACAAGG + Intergenic
959395621 3:105834353-105834375 TCATTTTTAAATAAAGAAATAGG + Intronic
959433465 3:106284230-106284252 CCATTCTAAAATGGAGAAATAGG - Intergenic
959642029 3:108650871-108650893 CCGTTTTAAAAAAAGGAAATAGG + Intronic
959660726 3:108864862-108864884 ACATTTTAAAATAATAAATTAGG + Intergenic
959790650 3:110357340-110357362 GCATTTTTGACTAAAGAACTTGG + Intergenic
959857072 3:111172002-111172024 ATATCTTAAAATAAAGAAATTGG + Intronic
959954295 3:112217369-112217391 CCATTTTAAAAGAAAAAACAGGG + Intronic
960040923 3:113149121-113149143 CTATTTTAAGATAAAGAAAGAGG + Intergenic
960220840 3:115106554-115106576 CAATTTTAAAATAGATGACTAGG - Intronic
960499979 3:118425930-118425952 CCCTTTTAAAATGTACAACTTGG - Intergenic
960776546 3:121262773-121262795 CCATTCTAAAAGGAAGAATTAGG + Intronic
961949663 3:130736257-130736279 TCATTTTAAATTACAGAACGGGG - Intronic
961952619 3:130765913-130765935 ACATTTTAAAAAAATGAAATAGG + Intergenic
961980071 3:131068033-131068055 TCATTTGAAAACAAAGAACTGGG - Intronic
962366589 3:134790243-134790265 CTCTTTTAAAAAAGAGAACTTGG + Intronic
963264289 3:143224766-143224788 CTATTTGAAAATCAAGAACATGG + Intergenic
963388316 3:144625254-144625276 CCATCTTAAGTAAAAGAACTAGG - Intergenic
963416403 3:145000814-145000836 CAATAGTAAAATAAAAAACTAGG + Intergenic
963741128 3:149082949-149082971 CCATTTAAAAATAATGAACGTGG + Intronic
964425174 3:156545259-156545281 GCATTTTAAAAAAATGAAATAGG + Intronic
964499093 3:157328458-157328480 TCATTTTAAAATAAGCAATTAGG - Intronic
964855015 3:161137483-161137505 ACATTACAAAATAAAGCACTTGG - Intronic
965146986 3:164918229-164918251 CTATTTTGAAATAAGAAACTTGG + Intergenic
965232152 3:166068522-166068544 CCATTTGAAAATAAAACCCTGGG + Intergenic
965310488 3:167121387-167121409 CCATTCAAAAATAAAGTATTTGG - Intergenic
965702624 3:171473641-171473663 CCATTTTAAAACAAATATTTAGG + Intergenic
965770127 3:172173325-172173347 CCATTTAAAAATAAAAACCAAGG + Intronic
965939622 3:174163031-174163053 CCACTTTAAAATGAAGATCCAGG - Intronic
965978150 3:174651795-174651817 CCATTTAAAAATAAAGAAGGTGG - Intronic
966173658 3:177111986-177112008 CCTTTTAAAAAATAAGAACTAGG + Intronic
967012559 3:185450287-185450309 AAATTTAGAAATAAAGAACTTGG + Intronic
967622474 3:191650443-191650465 CCATTCCAAAAGAAAGAAATTGG + Intergenic
968784461 4:2609534-2609556 GCATTTTACACTAAGGAACTGGG + Intronic
969061008 4:4434731-4434753 CCAGTTAAAAATAAATAATTAGG + Intronic
969395748 4:6919917-6919939 CTATTTCAAAATAAATAAATAGG - Intronic
970035722 4:11733593-11733615 CAATTGTAAAATGAAAAACTTGG - Intergenic
970670856 4:18395288-18395310 CCATTTTACAAAGGAGAACTTGG - Intergenic
971842088 4:31866137-31866159 CCATTTAAAAATCTAGAAGTCGG + Intergenic
971847851 4:31943935-31943957 CCAATTTCAAATAATGAACTTGG + Intergenic
971969543 4:33604154-33604176 CCATTCCAAAAGAAAGAAATTGG + Intergenic
972118402 4:35668160-35668182 AGATTTTAAAATTAAGACCTTGG - Intergenic
972392472 4:38626688-38626710 CTACTTTTAAATAAAGAATTAGG - Intergenic
972962258 4:44468006-44468028 CCATTTTAAAATAACTAAAAGGG + Intergenic
973564936 4:52175534-52175556 CCATTCTAAAAGAAACAACATGG - Intergenic
974540979 4:63235019-63235041 AAATTTTTAAATAAAGTACTGGG - Intergenic
974754325 4:66183947-66183969 CAATTCCAAAAGAAAGAACTAGG + Intergenic
974973948 4:68866533-68866555 CCATTTTAAAAGAAAAAAAATGG - Intergenic
975307425 4:72865855-72865877 CCATTCTAAAAGAGAGAAATTGG - Intergenic
975567689 4:75776438-75776460 CTATTGTAAAATGAAAAACTGGG + Intronic
975648737 4:76570868-76570890 ACATTCTAAAATTAAGAAATGGG + Intronic
975887848 4:78986465-78986487 TCATTTTAAAAATAATAACTTGG + Intergenic
976057995 4:81091581-81091603 ACATTTTAAAATAAAACACTAGG - Intronic
976467249 4:85384714-85384736 CCATTTAAAAATAAACACATTGG - Intergenic
976870669 4:89789853-89789875 TCATTTTAATATTAAGAACTAGG - Intronic
976987976 4:91326791-91326813 CCATTCCAAAATAAAGGAATTGG + Intronic
977142875 4:93397224-93397246 CCCTTTTAAAAATAATAACTAGG - Intronic
977293271 4:95186205-95186227 CCATTTTAAAATAAGGGTCCAGG + Intronic
977316178 4:95450736-95450758 CCTTTTTCAAATAAGCAACTTGG - Intronic
977356327 4:95952049-95952071 CCATTCCAAATTAAAGAAATTGG + Intergenic
977630834 4:99240837-99240859 ACATTTTAAAATAAATAAAAAGG - Intergenic
977924888 4:102688757-102688779 CCATTTTAGGATATAGCACTAGG - Intronic
978044310 4:104107322-104107344 CCATTTCAAAAGAGAGAAATTGG - Intergenic
978197596 4:105989414-105989436 ACATTTTAATAAAAATAACTTGG - Intronic
978275775 4:106947957-106947979 CCATTTTAAAGTAAACTGCTCGG + Intronic
978308625 4:107360920-107360942 CCATTTTAAATATAAGAACATGG + Intergenic
978481396 4:109194948-109194970 ACATTTTAAAATAAAGTAATTGG + Intronic
979122525 4:116921096-116921118 CCATTCAAAAATGAAGAAATTGG - Intergenic
979152262 4:117334197-117334219 ACATATTGAAATAAAGAATTGGG - Intergenic
979453722 4:120902968-120902990 CCATTTCATACCAAAGAACTTGG - Intronic
979600436 4:122581586-122581608 ACATTTTAAAAAACAGAAATAGG - Intergenic
979771515 4:124530713-124530735 CCATTTTTAAAAAAATAAATAGG + Intergenic
979815599 4:125099772-125099794 CCATCTTAAAATATATACCTTGG + Intergenic
979843213 4:125472203-125472225 TCATTTTAAATGAAAAAACTTGG + Intronic
979897567 4:126178678-126178700 CATTTTTAAAAGAAAAAACTGGG - Intergenic
980091924 4:128452049-128452071 TAATTTTAAAATATATAACTGGG + Intergenic
980109891 4:128625079-128625101 TCAATTAAAAATAAAGCACTGGG + Intergenic
980546067 4:134263341-134263363 CCATTTAATTATAAAGAAATTGG + Intergenic
980676528 4:136090531-136090553 TAATTTTAAAATAATGCACTTGG - Intergenic
980780858 4:137490254-137490276 CCAATTTAAAAACTAGAACTTGG - Intergenic
980932993 4:139199162-139199184 CCGTTTCAAAATAAATAAATAGG + Intergenic
980940497 4:139269927-139269949 CAATTTTTAAATAAGGTACTTGG - Intronic
981140947 4:141268550-141268572 TTATTTTAAAATAATGAAGTTGG - Intergenic
981603812 4:146521850-146521872 CGATTGTAAAGTAAAGACCTGGG + Exonic
981952818 4:150430804-150430826 CCATTCCAAAGTAATGAACTGGG + Intronic
982538128 4:156632139-156632161 CTAATTTAAAATAATGAATTTGG + Intergenic
982805334 4:159755664-159755686 CCATTTCAAAAGGAAGAAATTGG - Intergenic
982893159 4:160881686-160881708 CTATTTTAAAATAAAGATTTTGG - Intergenic
983436133 4:167718184-167718206 CATTTTTAAAATCAAAAACTGGG - Intergenic
983481001 4:168273866-168273888 CTATTTAAAAATAATGAACATGG - Intronic
983675112 4:170283022-170283044 ACATTTAGAAATAAAGAACTCGG + Intergenic
983724401 4:170902466-170902488 CCATTTTGAAAAAAAGAATGAGG + Intergenic
984129162 4:175851590-175851612 CCATTTTACACTAGAGAACTAGG - Intronic
984853645 4:184174855-184174877 ACATTTTAAGATAAAGAAACTGG - Intronic
985142482 4:186856649-186856671 CCATTTTTACTTAAGGAACTTGG - Intergenic
985331355 4:188839916-188839938 CCATCATAAAATAAAGTACTTGG - Intergenic
985845360 5:2341236-2341258 CCATTCTAAACATAAGAACTGGG - Intergenic
985943421 5:3157097-3157119 CCATTTGTAAATAAAGGTCTGGG + Intergenic
985995587 5:3595502-3595524 CCTTTTTAACAAAAACAACTTGG - Intergenic
986663939 5:10083628-10083650 CGATTTTAAAAAAAAAACCTTGG - Intergenic
986789739 5:11148283-11148305 CCATTTAAAAGTGAACAACTCGG - Intronic
986821938 5:11476966-11476988 CCACTTTAACATAAAAAACTGGG + Intronic
987494371 5:18623889-18623911 TCATTTAAGAATAAAGAAATAGG + Intergenic
987588849 5:19896054-19896076 AAATTTTAAAATAAAGAGCTTGG + Intronic
987873986 5:23656081-23656103 CAATAGTAAAATAAAGTACTGGG + Intergenic
988151015 5:27380126-27380148 TCATTTTAAAATAAAATACAGGG + Intergenic
988556168 5:32237809-32237831 CCTTTTTGAAATAAAGCACAGGG - Intronic
988623008 5:32842705-32842727 CCAGTATAAAATAAAAATCTGGG - Intergenic
989392007 5:40910682-40910704 CCACTTAAAAATTAAGAACATGG - Intronic
989768559 5:45115481-45115503 GCATGGTCAAATAAAGAACTTGG + Intergenic
990221040 5:53588978-53589000 CCATCTTAAAAAAAAAAATTAGG + Intronic
990299885 5:54439546-54439568 CCTTTTTATAAAAAAGAAATAGG + Intergenic
990342437 5:54836661-54836683 CTTTTTTAAAAAAAAGTACTGGG - Intergenic
990377321 5:55184622-55184644 CCACCATAAAATAAAGAATTGGG + Intergenic
990501466 5:56400537-56400559 CACTTTTAAAACAAAGAACATGG + Intergenic
990767686 5:59205024-59205046 CCATTCTAACATAAGGAACTAGG + Intronic
990833117 5:59983022-59983044 CTTTTTTAAAATTAGGAACTTGG + Intronic
991618979 5:68525691-68525713 GAATTTTAAAATAAAGAAGCAGG + Intergenic
992291060 5:75280687-75280709 CCATTTTTAAATTTAGAAATGGG + Intergenic
993292098 5:86086925-86086947 CGATTTTAAAAGAAGGAATTTGG + Intergenic
993337437 5:86678438-86678460 CCATTCTAAAATAAAACTCTTGG - Intergenic
993497968 5:88629221-88629243 CCATTTTATCTTGAAGAACTAGG - Intergenic
993740270 5:91530096-91530118 CTATTTGAAGAAAAAGAACTAGG - Intergenic
994378704 5:99044284-99044306 CCATTTCAAAATAAACAAATAGG - Intergenic
994503049 5:100604318-100604340 CCATTTTTAGTTTAAGAACTGGG - Intergenic
994863218 5:105226382-105226404 ACATTTTACAAGAAAGCACTGGG + Intergenic
995006578 5:107203854-107203876 CAATTTTAAAAATAATAACTGGG + Intergenic
995849220 5:116527001-116527023 AGATTTAAAAATACAGAACTTGG - Intronic
996229588 5:121045276-121045298 CCATTTTAAAAGAAAGAACCTGG + Intergenic
996269448 5:121585235-121585257 CCATTCTAAAATGGAGAAATGGG + Intergenic
996397796 5:123031257-123031279 GCAGTTTAAAATAAAGAGATAGG + Intronic
996816287 5:127576238-127576260 CAATTTTAAAAGATATAACTGGG + Intergenic
997644256 5:135469940-135469962 CCATTTCATTATACAGAACTAGG - Intergenic
998098734 5:139414063-139414085 CCATTTTATAATACAAAACTAGG - Exonic
998240354 5:140436800-140436822 CCATTATAAAATAAAAATGTGGG + Intronic
998355352 5:141530728-141530750 CTACTTAAAAATAAAGCACTAGG + Intronic
998978895 5:147678604-147678626 CAATATTAAAATCAAGAAATTGG + Intronic
999068494 5:148717034-148717056 CCATTTCAAATGAAAGAAATTGG - Intergenic
999367208 5:151030944-151030966 CCATTGTAAAAGAGGGAACTGGG + Intronic
999471266 5:151857279-151857301 CCATTTTTCAATCAGGAACTTGG - Intronic
999582276 5:153052251-153052273 CCAATTGAAAATAAACATCTGGG - Intergenic
1000717670 5:164666625-164666647 CCATTTCAAACTAGTGAACTTGG + Intergenic
1000724705 5:164754873-164754895 CCATTTTAACAATAATAACTTGG + Intergenic
1000867360 5:166531108-166531130 CCATTTCGAAAGAAAGAATTTGG - Intergenic
1000890753 5:166799084-166799106 CAATTCTAAAATTAAGAAATGGG - Intergenic
1001068189 5:168557422-168557444 CCATATTAAAGGAGAGAACTTGG - Exonic
1001308252 5:170591416-170591438 CAATTTTTAAAAAACGAACTGGG - Intronic
1001447819 5:171799640-171799662 CCATTTTAAAGTAGACAATTCGG - Intergenic
1001501318 5:172237643-172237665 CCTTTGTTAAATAAATAACTGGG + Intronic
1001609448 5:172988434-172988456 CCATTTTAAAATGAGGAAATGGG - Intronic
1001609457 5:172988529-172988551 CCATTTTAAAAAGAGGAAATGGG - Intronic
1001693969 5:173655848-173655870 CCAGTTGACAATAAAGATCTGGG + Intergenic
1002305683 5:178281358-178281380 CAATTTTGAAATGAAGGACTCGG - Intronic
1002352502 5:178592788-178592810 CCATTTTACAGTAAAGGTCTGGG + Intergenic
1002620211 5:180482869-180482891 CCATTTTAAAGTATACAATTCGG - Intergenic
1002667809 5:180839383-180839405 CCATTTTAAACTAAGGGATTAGG - Intergenic
1002755709 6:157800-157822 CCATTTTGAAAAAAAAAATTTGG + Intergenic
1002908258 6:1468523-1468545 CCGTTTTAAGGTAAAGATCTTGG + Intergenic
1004213231 6:13674101-13674123 ACATTTTAAAATAAGCAACAAGG + Intronic
1004759349 6:18648705-18648727 CCATCTTAAAAAAAAAAAATAGG + Intergenic
1005145255 6:22682790-22682812 CAATTTTAAAAGAAAGAAAAAGG + Intergenic
1005411850 6:25557472-25557494 AAATTTTAAAATAATGAAATAGG - Intronic
1005474313 6:26192357-26192379 TCATTTTAAACTGAATAACTAGG - Intergenic
1005630698 6:27704919-27704941 ACTTTTTAAAATAACGAGCTAGG - Intergenic
1005665648 6:28050905-28050927 CCAATTTAAAAAAAAGTTCTGGG + Intergenic
1005666344 6:28061325-28061347 TCATTTTAAAATCAAGAATTTGG - Intergenic
1006301723 6:33197001-33197023 CATTTTTAAGATGAAGAACTCGG + Intronic
1006469261 6:34217542-34217564 CCATTTAAAAAAAAAAAAATTGG + Intergenic
1006484045 6:34323220-34323242 CCATTTTAAAATTTAGATTTGGG - Intronic
1006637510 6:35471140-35471162 CCATTTAAAAAAAAAAAACAAGG - Intergenic
1006961050 6:37930611-37930633 TCATTATAAAATGAAGGACTTGG + Intronic
1007060320 6:38933859-38933881 CAAATGTAAAATAAAGAAATTGG + Intronic
1007192058 6:40027790-40027812 CCATTTTAAAATAAGGAAATAGG - Intergenic
1007214021 6:40222039-40222061 CCATATTCAGATAAAGAAATTGG - Intergenic
1007770751 6:44190233-44190255 CAATTTTAAAATATATATCTTGG + Intergenic
1008084668 6:47231740-47231762 CCATTTTTAATTAAAGTAATTGG + Exonic
1008149615 6:47934655-47934677 TTATTTTAAAATAAAGCATTTGG + Intronic
1008150631 6:47947134-47947156 CCCATTAAAAATAAAGAAATAGG - Intronic
1008378322 6:50816361-50816383 CCACGTTAAAAAAAATAACTAGG + Intergenic
1008840802 6:55901369-55901391 ACTTTTTAAAATAGAAAACTTGG - Intergenic
1009383843 6:63065633-63065655 CCATTTTATAATTGTGAACTTGG - Intergenic
1009576874 6:65475593-65475615 CCATTTTCAAATTAACATCTGGG + Intronic
1009719268 6:67444599-67444621 CTATTCTAAATAAAAGAACTAGG - Intergenic
1009802954 6:68565618-68565640 CCACTTTAAAAGAAAAAATTTGG - Intergenic
1009848040 6:69158920-69158942 CTATAATAAAATATAGAACTAGG - Intronic
1009947595 6:70357668-70357690 CCTTTTTAGAATAAAGCAGTTGG + Intergenic
1009955867 6:70452393-70452415 CCATATTAAAATAATAAAGTTGG - Intronic
1010261538 6:73822723-73822745 CCATTTTAAAATGAAAATATGGG + Intronic
1010352679 6:74893579-74893601 CAATTTTTAAAAAAAGAACATGG - Intergenic
1010751981 6:79626115-79626137 CCATTCTAAAATTAAAATCTGGG + Intergenic
1010885023 6:81225826-81225848 ACATTTAAAAATAAATAAATGGG - Intergenic
1011140027 6:84142732-84142754 ACATTTAAAATTAAAGACCTAGG + Intronic
1011713386 6:90078310-90078332 CCATGTTTAAATAAAAAACAGGG + Intronic
1012004628 6:93697163-93697185 CAATTTTAAAAGAAAGAATTAGG + Intergenic
1012270508 6:97204488-97204510 GCATTTTAAAAGAATCAACTAGG + Intronic
1012318913 6:97817532-97817554 CCTTTTTAAAAATAAGAAGTAGG + Intergenic
1012491848 6:99790874-99790896 CCATTTTAAAATACACCAGTAGG - Intergenic
1012830869 6:104202060-104202082 CCATTTTAAAAGGGAGAAATTGG - Intergenic
1013513328 6:110863246-110863268 CCAACTTAAAAAAACGAACTTGG - Intronic
1013823637 6:114184895-114184917 CCATTTCAAAAGACAGAAATGGG - Intronic
1014092418 6:117418854-117418876 CCTTTTTAAAATTAAGAGCAGGG + Intronic
1015453150 6:133393715-133393737 CCATTTTCAAATAAATGTCTTGG + Intronic
1015520511 6:134126090-134126112 CAATTTTAAAATGTAGTACTTGG + Intergenic
1016193813 6:141306308-141306330 AAATTTTAAAATAAAGATTTAGG + Intergenic
1016206149 6:141471200-141471222 CCATTTTAAAATAGCGGCCTGGG - Intergenic
1016486393 6:144544284-144544306 CCATTTTAAAGTGAACAATTTGG + Intronic
1016541443 6:145170408-145170430 CCATCATAAAATAAAGGACCAGG + Intergenic
1016971175 6:149765478-149765500 CCATTTTAAAATATAAATTTTGG - Intronic
1017456838 6:154608430-154608452 TCACTTAAAAATGAAGAACTTGG - Intergenic
1017585437 6:155916571-155916593 CCCTGTTAAAATAAAAAACAGGG - Intergenic
1018276824 6:162141369-162141391 CCATTGAAAAATAAAGCATTAGG - Intronic
1018418997 6:163625904-163625926 CCAGTTTTATTTAAAGAACTTGG + Intergenic
1018450396 6:163901907-163901929 ACATTTTAAAATAAAAAATCAGG + Intergenic
1018489493 6:164277175-164277197 CTATGTTAAAATAAAAAATTTGG - Intergenic
1018493753 6:164326150-164326172 CCATTCTAATATGAAGTACTAGG + Intergenic
1018510607 6:164520429-164520451 CCATTTCAAAAGACAGAAATTGG - Intergenic
1018524366 6:164691265-164691287 CCATTATAAAATGTAGAATTAGG - Intergenic
1018571114 6:165210966-165210988 ATTTTTTAAAATAAACAACTTGG + Intergenic
1019785900 7:2977247-2977269 CCATTTTAAAATCAATAACCTGG - Intronic
1019886851 7:3912814-3912836 CCATGTATAAATAAAGAAATCGG - Intronic
1020425549 7:8062104-8062126 CTATACTAAAATAAAAAACTTGG + Intronic
1020536939 7:9410957-9410979 CCATTTAAAAATAAACCCCTAGG + Intergenic
1021130076 7:16900653-16900675 CATGTTTAAAATAAAGAAATGGG - Intergenic
1021396365 7:20153525-20153547 CCAGATTACCATAAAGAACTGGG - Intronic
1021555908 7:21917543-21917565 CTTTTTTAAAACAAAGAATTGGG - Intronic
1021584819 7:22196824-22196846 GCAGTTAGAAATAAAGAACTAGG + Intronic
1021651139 7:22834681-22834703 CTCTTTTAAAATAAACAAATCGG + Intergenic
1021664810 7:22966125-22966147 CCATTTTGCAATAAACAAATAGG + Intronic
1021667602 7:23001520-23001542 TCATTTTAAAATAAATTGCTAGG + Intronic
1021747838 7:23760966-23760988 CCATATTAACATTTAGAACTAGG - Intronic
1022048752 7:26644519-26644541 GCATTTTGAAATATAGAAGTTGG - Intronic
1022203677 7:28142442-28142464 CCACTTTAAAATAAAGACTTAGG + Intronic
1022490592 7:30814812-30814834 CCATTTGAAAAGAAAGATTTGGG - Intronic
1023105725 7:36761486-36761508 CCATGTTAATATAAACAACAAGG + Intergenic
1023415797 7:39931179-39931201 ACATTTAAAAAAAAACAACTTGG + Intergenic
1023649732 7:42356595-42356617 CCTATTTATAATAAAGAAATAGG + Intergenic
1023792656 7:43765550-43765572 CAATTTAAAAATAAATAAATAGG - Intronic
1024336477 7:48211798-48211820 CCACTGTAAAATAAAGTACCAGG - Intronic
1024368104 7:48546619-48546641 CCATTTTAATATATGCAACTGGG + Intronic
1026983753 7:74541599-74541621 CTATCTTAAAATAAATAAATAGG + Intronic
1027835368 7:83235053-83235075 CCATTTTAAGACACAGATCTAGG + Intergenic
1027853962 7:83485359-83485381 CCTTTTACAAATAAAGAAATAGG + Intronic
1027921351 7:84399581-84399603 CCACGTTAAAATAAAGCACCAGG + Intronic
1028074931 7:86500925-86500947 CCATTTAAAAATAAATGACTGGG + Intergenic
1028194166 7:87886221-87886243 CACTTTTTAAATAAAGTACTAGG - Intronic
1028212976 7:88098222-88098244 GTATTTTAAAATAAAGAGATAGG + Intronic
1028265874 7:88724671-88724693 TCATTTTATAAGAAAGAACATGG - Intergenic
1028428922 7:90723711-90723733 CCATTTTAAAATACAGTGGTAGG - Intronic
1028598222 7:92569782-92569804 GCATTTTAAAATAGAGAAAATGG + Intronic
1029908764 7:104121291-104121313 CCACTTGATATTAAAGAACTTGG - Intergenic
1029912352 7:104166994-104167016 ACTTTTTAAAATAAGGAAATAGG - Intronic
1030236373 7:107267746-107267768 ACAATTTAAAAAAAATAACTGGG + Intronic
1030276490 7:107727017-107727039 CCGTTCAAAAATAAAGAAATAGG + Intergenic
1030483980 7:110142231-110142253 CCATTTTAAAGTGAACAATTCGG - Intergenic
1030497001 7:110312821-110312843 ACATTTTAAAAAAATGAACAGGG + Intergenic
1030546078 7:110897063-110897085 CCAATTTTAAATAAAGAATCTGG + Intronic
1030630408 7:111889187-111889209 ACATTTTAAAATAAATAACCTGG - Intronic
1030712381 7:112765114-112765136 ACATTTTAAAAACAATAACTAGG - Exonic
1030717321 7:112824659-112824681 CCATATAAAAAAAAAGACCTTGG - Intronic
1031552444 7:123131921-123131943 CCATTTTAAAATAATGACAATGG + Intronic
1031617929 7:123903266-123903288 CCATTCTAAAAGGAAGAAATTGG + Intergenic
1031672447 7:124566321-124566343 ACATTTTTGAATCAAGAACTGGG + Intergenic
1032114512 7:129105280-129105302 CCATTTTAAAATAAATATGTGGG + Intergenic
1032422872 7:131797090-131797112 CCATTTTAAAATACAGAAATTGG + Intergenic
1032552033 7:132793033-132793055 CTTTTTTAAAAAACAGAACTTGG + Intronic
1032596549 7:133246528-133246550 CCATTTGAAAATATACAATTTGG + Intergenic
1033291252 7:140084886-140084908 ATATTTTAAAATACAGAAATTGG + Exonic
1033616720 7:143023498-143023520 CCATTCCAAAAGAAAGAAATAGG - Intergenic
1034348365 7:150400760-150400782 CCATTTTAAAATGATAAACCTGG + Intronic
1035001953 7:155619611-155619633 TCATTTGAGAATAAAGGACTTGG - Intronic
1035019838 7:155794374-155794396 TTATTTTAAATTACAGAACTGGG + Intergenic
1035087339 7:156271817-156271839 CCTTTTTAAAAGAAAGGGCTAGG - Intergenic
1035163629 7:156969876-156969898 CCATTTTCAAATAACTATCTTGG + Exonic
1035957015 8:4091917-4091939 ACATTTTTAAATAGAGAACTGGG - Intronic
1036403002 8:8427028-8427050 GCATTTAAAAATAAAATACTAGG + Intergenic
1037437908 8:18883228-18883250 CTCTTTTAAAATAAAAAAGTAGG - Intronic
1037523196 8:19700157-19700179 CCATTTTAAAATAAGAAATAAGG + Intronic
1038605067 8:28993045-28993067 CCAAGTTAAAAAAAAAAACTAGG - Intronic
1038696490 8:29811292-29811314 CCATCTTAAAATAAAGAGATTGG - Intergenic
1039561318 8:38514407-38514429 CAGTTTTAAAATAAATACCTGGG + Intronic
1040050257 8:43006621-43006643 CCATGTTAAAAAATAGAAATTGG - Intronic
1040646172 8:49399586-49399608 CTCATTTAAAATAAATAACTTGG - Intergenic
1040721736 8:50332440-50332462 ACATTTTAAAAAAAAAAACAAGG - Intronic
1040746395 8:50647757-50647779 TCATTTTAAGATAAATAATTTGG - Intronic
1040750436 8:50699140-50699162 CCTTTTTAAAAAAAAGCACAGGG - Intronic
1040943223 8:52853633-52853655 CCAATTGGAAAAAAAGAACTAGG - Intergenic
1041123965 8:54615700-54615722 TCATTTAAAAATAAAGATCTAGG - Intergenic
1041247279 8:55900857-55900879 GCATTTTAAGATAAAGAGTTAGG - Intronic
1041405066 8:57489834-57489856 TTATTTGAAAATAATGAACTTGG - Intergenic
1041685731 8:60642829-60642851 CCATTTTAATATAAACAACTTGG - Intergenic
1042057757 8:64784863-64784885 CCATTTAAAAAATAAGAAATTGG + Intronic
1042372785 8:68011018-68011040 CAAATTTTAAATAAAGAACATGG + Intronic
1042396467 8:68296614-68296636 CCATCTTAGAGGAAAGAACTCGG - Intergenic
1042406890 8:68415968-68415990 TCATTTTAGAATAAGGAAATTGG - Intronic
1042873379 8:73418231-73418253 ACATTTTTAAATCAAGAACATGG - Intergenic
1043445031 8:80311020-80311042 CCATTTTAAGATAAAGAACAAGG - Intergenic
1044052537 8:87525412-87525434 CCAATTAAAAATAATTAACTGGG - Intronic
1044536251 8:93359340-93359362 GCCTTTTAAAATAGAAAACTGGG + Intergenic
1044612000 8:94100693-94100715 GCATTTTAAATTGAAGAAATTGG - Intergenic
1044852574 8:96443387-96443409 CCATTTTAAAGTATACAATTTGG + Intergenic
1045133581 8:99187275-99187297 GCATTTTAAAATAGTTAACTAGG - Intronic
1045135140 8:99208733-99208755 CTGTTTTAAAATTAAGAATTAGG - Intronic
1045281680 8:100754769-100754791 CCATCTCAAAATAAATAAATAGG - Intergenic
1045340000 8:101245096-101245118 CCATTTTCAAATAGATAACTTGG + Intergenic
1045414819 8:101955228-101955250 CCCTTCTAAAATATAAAACTAGG - Intronic
1045712526 8:105001744-105001766 CCATCTTAAAATATAGAAATAGG + Intronic
1046117959 8:109807000-109807022 CAATTCTAAAATGAAGAAGTTGG + Intergenic
1046406901 8:113785783-113785805 GACTTTCAAAATAAAGAACTAGG + Intergenic
1046798308 8:118396593-118396615 TCATTTTAAAGTTAAGAAATGGG + Intronic
1047194629 8:122710409-122710431 CCATATCAAAATAAAGAACCTGG + Intergenic
1047846355 8:128809877-128809899 CCATTCCAAAAGAAAGAAATAGG - Intergenic
1047849008 8:128836219-128836241 CCATTTTAAAATAAATGAATTGG + Intergenic
1047962441 8:130020518-130020540 CCATTTTAAAGTGAACAATTGGG - Intergenic
1047985086 8:130224591-130224613 CCCTTTTAAAAAAAATAAATGGG + Intronic
1048058721 8:130895071-130895093 CAATTTGAAAACAAAGAAGTGGG - Intronic
1048199269 8:132358219-132358241 CCACTTTAGAATGAAGAAGTGGG + Intronic
1048796998 8:138159752-138159774 TAATTTTAAAAAAAAGAATTTGG + Intronic
1050548960 9:6732677-6732699 CCATTTTACAATAGAGGGCTGGG - Intronic
1051207179 9:14700370-14700392 TCATTTTACAATAAAGACATGGG - Intergenic
1051297782 9:15615638-15615660 CTTTTTTAAAAAAAAGAACCTGG - Intronic
1052156117 9:25192769-25192791 GGATTGTAAAATGAAGAACTAGG + Intergenic
1052572971 9:30252672-30252694 CAATTTTAAAGTAAAGAAATAGG + Intergenic
1053109625 9:35446883-35446905 CCATTTTGAAAAAAAATACTAGG + Intergenic
1053328749 9:37183767-37183789 TCATTTATAAATAAAGAAATAGG + Intronic
1054769730 9:69072180-69072202 CCATTTAAAAATGAATAATTTGG - Intronic
1055011021 9:71565562-71565584 TCTTTTTGAAATAAGGAACTTGG + Intergenic
1055620325 9:78118834-78118856 CTATTTAAAAAAAAAAAACTTGG - Intergenic
1055995337 9:82151668-82151690 TCATTCTACAATAAAGAAGTTGG - Intergenic
1056440886 9:86620000-86620022 CCATTTTAGAGTGAACAACTCGG + Intergenic
1056559404 9:87717125-87717147 CCATTTTAAATTAAGGGGCTAGG + Intergenic
1056686965 9:88774799-88774821 CCAGTTAAAAATCAAGTACTGGG - Intergenic
1057137832 9:92706512-92706534 CCATTTTAAAAGGGAGAAATAGG + Intergenic
1057574933 9:96234740-96234762 CCATTTTAGGGTAAAGATCTTGG - Intergenic
1057849637 9:98555359-98555381 CCATTTTAAAATAATAGATTAGG - Intronic
1058052410 9:100420242-100420264 CCATTTTAAAATCAACAAAGTGG + Intergenic
1058489716 9:105484339-105484361 ACTTTTTAAAATAAAGAAATAGG - Intronic
1058665573 9:107312339-107312361 CCATTTAAAAGTAACAAACTAGG - Intronic
1059082513 9:111265537-111265559 CCATTGCAAAAGAAAGAAATTGG + Intergenic
1059189600 9:112311952-112311974 TCTTTTTAAAATAAAGATGTGGG - Intronic
1059526722 9:114998591-114998613 CCATTTTAAAAAAAGGATGTTGG - Intergenic
1059586051 9:115607565-115607587 AAATTTCATAATAAAGAACTTGG - Intergenic
1059601499 9:115783816-115783838 CCATTTTAAATGGAAGAAATTGG - Intergenic
1060357969 9:122928471-122928493 ACAGTTCAAAAAAAAGAACTAGG - Intronic
1060379204 9:123150392-123150414 GAATTTTAAAATCAAGATCTGGG + Intronic
1061170429 9:128949630-128949652 CCATCTCAAAATAAATAAATAGG - Intronic
1203623796 Un_KI270749v1:150728-150750 CCATTTAAAAATATATAAATAGG + Intergenic
1186588787 X:10905603-10905625 AAAATTTAAAATATAGAACTTGG - Intergenic
1186674017 X:11796963-11796985 CTATTACAAAATAATGAACTAGG + Intergenic
1187017988 X:15349596-15349618 GTATTTTAAAATACAGAATTGGG + Intronic
1187180441 X:16938955-16938977 CCATTCAAAAAAAAAGAAATTGG + Intergenic
1187430110 X:19215147-19215169 CCATTTTAAAGTGAACAATTTGG + Intergenic
1188345417 X:29058369-29058391 CCATCTTAAAATAAAAAAAAGGG + Intronic
1188812979 X:34675261-34675283 ACATTTAAAAATAACTAACTAGG - Intergenic
1189141319 X:38609759-38609781 TCATTTGAAAATAAAAAACTTGG + Intronic
1189420953 X:40857182-40857204 CCGTGTTAAAACAAAAAACTTGG - Intergenic
1189537637 X:41952855-41952877 CCATTTTAAAATTTAAAACACGG - Intergenic
1192086913 X:68108325-68108347 CTATTTAAAAACAAAAAACTGGG + Intronic
1192506887 X:71691754-71691776 GCATTTTAAAATAAACAAACAGG + Intergenic
1192519810 X:71789792-71789814 GCATTTTAAAATAAACAAACAGG - Intergenic
1192551507 X:72058326-72058348 CAATTTAAAAAAAAAGAACTGGG - Intergenic
1193098389 X:77579118-77579140 CCATAGTAGAATAAAGCACTAGG + Intronic
1193144874 X:78066336-78066358 CTATTTTAAAACAAACAACTTGG - Intronic
1193208745 X:78780302-78780324 CCATTTTAAGATGAAGAAAATGG - Intergenic
1193271900 X:79538165-79538187 CCATTCTAAATGAAAGAAATTGG - Intergenic
1193829585 X:86273286-86273308 TCATTTTAAAATAAACAAATAGG - Intronic
1194093405 X:89604558-89604580 CTGTCTTAAAATAAAGAAATTGG - Intergenic
1194199636 X:90938827-90938849 CCATTTTAATTGAAAGAAATTGG + Intergenic
1194328149 X:92546166-92546188 CCATTACACAATAAAGAACTTGG - Intronic
1194984499 X:100475928-100475950 ACATTTGGGAATAAAGAACTAGG - Intergenic
1194988107 X:100513125-100513147 ACATTTCAAAATAAAGAAGTTGG - Intergenic
1195814137 X:108867236-108867258 TCATTTCAAAAGAAAGAAATTGG + Intergenic
1195994361 X:110716893-110716915 CCATTTCATGATAAGGAACTGGG - Intronic
1196283746 X:113855663-113855685 TCATGTTAAAATACAGAACCAGG + Intergenic
1196386830 X:115163895-115163917 GCATTTTAAAAGAAGGACCTAGG - Intronic
1196861491 X:120033193-120033215 CCATTTTAGGGTAAAGATCTTGG - Intergenic
1196861754 X:120035184-120035206 CCATTTTAAGGTAAACATCTTGG - Intergenic
1197082388 X:122434998-122435020 CCATTTTAAAAAACAGATCTGGG - Intergenic
1197604154 X:128564728-128564750 CCATTTTAGGATAAAGAAAGTGG + Intergenic
1197845894 X:130802262-130802284 CCATTTTAAAAAAAATAATGTGG - Intronic
1197990787 X:132314840-132314862 AATTGTTAAAATAAAGAACTGGG + Intergenic
1198223820 X:134627137-134627159 CCATTTTCAAATGGAGAACTGGG - Intronic
1198382678 X:136099216-136099238 CCATTAAAAAAAAAACAACTAGG - Intergenic
1198410451 X:136362027-136362049 TCATTTCAAAATAACGACCTTGG + Intronic
1198821658 X:140654619-140654641 TCATTTTAAAAGAAACATCTAGG + Intergenic
1199412965 X:147546429-147546451 CCATTCAGAAATAAAGAAATTGG + Intergenic
1199429371 X:147741530-147741552 TCATTTTAAAGTAATAAACTGGG + Intergenic
1199907478 X:152248199-152248221 TCAATTTAAAAAAAAAAACTGGG + Intronic
1200446035 Y:3260667-3260689 CTGTCTTAAAATAAAGAAATTGG - Intergenic
1200545625 Y:4515244-4515266 CCATTTTAATTGAAAGAAATTGG + Intergenic
1200636858 Y:5665367-5665389 CCATTACACAATAAAGAACTTGG - Intronic
1200697627 Y:6375044-6375066 CCACATAAAAATAAAGAACATGG + Intergenic
1200825998 Y:7641899-7641921 CAATATTAAAATAAAGAAGCAGG + Intergenic
1200905876 Y:8481509-8481531 TTATTTTAATATAAAGAAGTAGG - Intergenic
1200916349 Y:8574602-8574624 CCATAGAAAAATAAAGAACACGG - Intergenic
1200931134 Y:8698126-8698148 CCATATAAAAATAAAGTACATGG + Intergenic
1200931429 Y:8700514-8700536 CCACATAAAAATAAAGAACAAGG + Intergenic
1201036485 Y:9789655-9789677 CCACATAAAAATAAAGAACATGG - Intergenic
1201256216 Y:12110750-12110772 CCATCTCAGAATAAAGCACTTGG + Intergenic
1201963020 Y:19703080-19703102 ACTTTTCAAAATAAAAAACTGGG + Intergenic