ID: 1153354807

View in Genome Browser
Species Human (GRCh38)
Location 18:4123174-4123196
Sequence CACCACCCACCTACATAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153354807_1153354818 0 Left 1153354807 18:4123174-4123196 CCAGCCTATGTAGGTGGGTGGTG No data
Right 1153354818 18:4123197-4123219 GGAAGGAGGGGTGGAGTCAGGGG No data
1153354807_1153354815 -9 Left 1153354807 18:4123174-4123196 CCAGCCTATGTAGGTGGGTGGTG No data
Right 1153354815 18:4123188-4123210 TGGGTGGTGGGAAGGAGGGGTGG No data
1153354807_1153354817 -1 Left 1153354807 18:4123174-4123196 CCAGCCTATGTAGGTGGGTGGTG No data
Right 1153354817 18:4123196-4123218 GGGAAGGAGGGGTGGAGTCAGGG No data
1153354807_1153354820 17 Left 1153354807 18:4123174-4123196 CCAGCCTATGTAGGTGGGTGGTG No data
Right 1153354820 18:4123214-4123236 CAGGGGAGTTTTAGTGACCAGGG No data
1153354807_1153354816 -2 Left 1153354807 18:4123174-4123196 CCAGCCTATGTAGGTGGGTGGTG No data
Right 1153354816 18:4123195-4123217 TGGGAAGGAGGGGTGGAGTCAGG No data
1153354807_1153354821 24 Left 1153354807 18:4123174-4123196 CCAGCCTATGTAGGTGGGTGGTG No data
Right 1153354821 18:4123221-4123243 GTTTTAGTGACCAGGGAGCCTGG No data
1153354807_1153354819 16 Left 1153354807 18:4123174-4123196 CCAGCCTATGTAGGTGGGTGGTG No data
Right 1153354819 18:4123213-4123235 TCAGGGGAGTTTTAGTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153354807 Original CRISPR CACCACCCACCTACATAGGC TGG (reversed) Intronic