ID: 1153354810

View in Genome Browser
Species Human (GRCh38)
Location 18:4123178-4123200
Sequence TTCCCACCACCCACCTACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153354810_1153354818 -4 Left 1153354810 18:4123178-4123200 CCTATGTAGGTGGGTGGTGGGAA No data
Right 1153354818 18:4123197-4123219 GGAAGGAGGGGTGGAGTCAGGGG No data
1153354810_1153354821 20 Left 1153354810 18:4123178-4123200 CCTATGTAGGTGGGTGGTGGGAA No data
Right 1153354821 18:4123221-4123243 GTTTTAGTGACCAGGGAGCCTGG No data
1153354810_1153354823 28 Left 1153354810 18:4123178-4123200 CCTATGTAGGTGGGTGGTGGGAA No data
Right 1153354823 18:4123229-4123251 GACCAGGGAGCCTGGACTCTGGG No data
1153354810_1153354822 27 Left 1153354810 18:4123178-4123200 CCTATGTAGGTGGGTGGTGGGAA No data
Right 1153354822 18:4123228-4123250 TGACCAGGGAGCCTGGACTCTGG No data
1153354810_1153354820 13 Left 1153354810 18:4123178-4123200 CCTATGTAGGTGGGTGGTGGGAA No data
Right 1153354820 18:4123214-4123236 CAGGGGAGTTTTAGTGACCAGGG No data
1153354810_1153354819 12 Left 1153354810 18:4123178-4123200 CCTATGTAGGTGGGTGGTGGGAA No data
Right 1153354819 18:4123213-4123235 TCAGGGGAGTTTTAGTGACCAGG No data
1153354810_1153354817 -5 Left 1153354810 18:4123178-4123200 CCTATGTAGGTGGGTGGTGGGAA No data
Right 1153354817 18:4123196-4123218 GGGAAGGAGGGGTGGAGTCAGGG No data
1153354810_1153354816 -6 Left 1153354810 18:4123178-4123200 CCTATGTAGGTGGGTGGTGGGAA No data
Right 1153354816 18:4123195-4123217 TGGGAAGGAGGGGTGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153354810 Original CRISPR TTCCCACCACCCACCTACAT AGG (reversed) Intronic