ID: 1153354815

View in Genome Browser
Species Human (GRCh38)
Location 18:4123188-4123210
Sequence TGGGTGGTGGGAAGGAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153354807_1153354815 -9 Left 1153354807 18:4123174-4123196 CCAGCCTATGTAGGTGGGTGGTG No data
Right 1153354815 18:4123188-4123210 TGGGTGGTGGGAAGGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153354815 Original CRISPR TGGGTGGTGGGAAGGAGGGG TGG Intronic