ID: 1153354817

View in Genome Browser
Species Human (GRCh38)
Location 18:4123196-4123218
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153354810_1153354817 -5 Left 1153354810 18:4123178-4123200 CCTATGTAGGTGGGTGGTGGGAA No data
Right 1153354817 18:4123196-4123218 GGGAAGGAGGGGTGGAGTCAGGG No data
1153354807_1153354817 -1 Left 1153354807 18:4123174-4123196 CCAGCCTATGTAGGTGGGTGGTG No data
Right 1153354817 18:4123196-4123218 GGGAAGGAGGGGTGGAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type