ID: 1153354822

View in Genome Browser
Species Human (GRCh38)
Location 18:4123228-4123250
Sequence TGACCAGGGAGCCTGGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153354810_1153354822 27 Left 1153354810 18:4123178-4123200 CCTATGTAGGTGGGTGGTGGGAA No data
Right 1153354822 18:4123228-4123250 TGACCAGGGAGCCTGGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153354822 Original CRISPR TGACCAGGGAGCCTGGACTC TGG Intronic