ID: 1153354822 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:4123228-4123250 |
| Sequence | TGACCAGGGAGCCTGGACTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1153354810_1153354822 | 27 | Left | 1153354810 | 18:4123178-4123200 | CCTATGTAGGTGGGTGGTGGGAA | No data | ||
| Right | 1153354822 | 18:4123228-4123250 | TGACCAGGGAGCCTGGACTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1153354822 | Original CRISPR | TGACCAGGGAGCCTGGACTC TGG | Intronic | ||