ID: 1153356707

View in Genome Browser
Species Human (GRCh38)
Location 18:4144413-4144435
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 4, 1: 27, 2: 70, 3: 175, 4: 438}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153356707_1153356719 15 Left 1153356707 18:4144413-4144435 CCCACAATCACTGTGTTCTCCCT 0: 4
1: 27
2: 70
3: 175
4: 438
Right 1153356719 18:4144451-4144473 GATTTCCTCTCTGAGCCACAGGG 0: 1
1: 0
2: 5
3: 39
4: 246
1153356707_1153356718 14 Left 1153356707 18:4144413-4144435 CCCACAATCACTGTGTTCTCCCT 0: 4
1: 27
2: 70
3: 175
4: 438
Right 1153356718 18:4144450-4144472 CGATTTCCTCTCTGAGCCACAGG 0: 1
1: 0
2: 1
3: 24
4: 229
1153356707_1153356721 25 Left 1153356707 18:4144413-4144435 CCCACAATCACTGTGTTCTCCCT 0: 4
1: 27
2: 70
3: 175
4: 438
Right 1153356721 18:4144461-4144483 CTGAGCCACAGGGCCCCTGCTGG 0: 1
1: 0
2: 7
3: 50
4: 474
1153356707_1153356722 26 Left 1153356707 18:4144413-4144435 CCCACAATCACTGTGTTCTCCCT 0: 4
1: 27
2: 70
3: 175
4: 438
Right 1153356722 18:4144462-4144484 TGAGCCACAGGGCCCCTGCTGGG 0: 1
1: 0
2: 2
3: 46
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153356707 Original CRISPR AGGGAGAACACAGTGATTGT GGG (reversed) Intronic
901096121 1:6681733-6681755 AGGCAGGCCACAGTGAATGTGGG - Intronic
903291531 1:22317386-22317408 AGGGCAGAAACAGTGATTGTGGG + Intergenic
904875914 1:33654468-33654490 AGGGAGAGCACAGTTGTTGCAGG + Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906101626 1:43267587-43267609 GGGGAGAACACAGAGGCTGTGGG - Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
906854477 1:49289832-49289854 AGGAAGAACACAGTAAATATAGG + Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
909209810 1:72808753-72808775 AGGGGGAAGAAAGTGATTGTGGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910321685 1:85953061-85953083 ATGGAGAATACATTGCTTGTTGG - Intronic
910384225 1:86664350-86664372 AGGCAGAGCACAGTGATTACAGG + Intergenic
910384430 1:86665570-86665592 AGGCAGAGCACAGTGATTACAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910476836 1:87616518-87616540 TGGGAGAGCAGAGTGATTATAGG + Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910579878 1:88811652-88811674 AGCCAGAACACAGTCATTCTTGG + Intronic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911019729 1:93374634-93374656 GGGGAGAGCACAGTTATTATGGG + Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
911294454 1:96097630-96097652 AGGGAGGACCCAGTGAATATGGG - Intergenic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
915611422 1:156996441-156996463 AGGGAGGACACAGGGACTCTGGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
916744401 1:167673484-167673506 AGGAAGCTCACAGTGAGTGTTGG + Intronic
917171677 1:172183445-172183467 AAGGAAAATACAGTGATTCTGGG + Intronic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918402634 1:184178720-184178742 AAGGAGATCAGAGGGATTGTTGG - Intergenic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920826876 1:209430889-209430911 AGGGTGAACACGGGGCTTGTTGG - Intergenic
920953768 1:210598630-210598652 AGAAAGATCACAGTGACTGTGGG - Intronic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
921291493 1:213662064-213662086 AGGGAGAACCCAATGTTTCTAGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923062348 1:230487543-230487565 ATGGAGAAAACAGTGGTGGTTGG + Intergenic
923459913 1:234200015-234200037 AGGGACAACACACTGTTGGTGGG + Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
924592951 1:245420927-245420949 AGGCAGCACACAGGGCTTGTTGG + Intronic
924624470 1:245687731-245687753 AGCCAGAACACAGTGCTTGGGGG - Exonic
1064426100 10:15230964-15230986 GGGGAGCACACAAGGATTGTGGG + Intronic
1064891656 10:20181879-20181901 ATGGAGAACAGAGTTTTTGTTGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1066228368 10:33407190-33407212 AAGGAGAACTGAGTGAGTGTGGG + Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1067380576 10:45769504-45769526 AAGGAGAACCCAGGGATTCTGGG + Exonic
1067888274 10:50110156-50110178 AAGGAGAACCCAGGGATTCTGGG + Exonic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069242486 10:66160789-66160811 AGACAGAACACAGTAATAGTGGG - Intronic
1071197147 10:83175048-83175070 AGGAAGAACACAGTCCTGGTTGG - Intergenic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1072544117 10:96421237-96421259 TGGGAGAACACAGGGCTTGCTGG - Intronic
1072844398 10:98813484-98813506 ATGGAGAAGGCAGTGATTTTGGG - Intronic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1073869328 10:107844674-107844696 AGAGAGAATACCGGGATTGTTGG + Intergenic
1073870918 10:107863245-107863267 ACAGAGACCACAGTGAGTGTGGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076193998 10:128502306-128502328 TGAGAGGAGACAGTGATTGTAGG - Intergenic
1076242795 10:128922450-128922472 TTGGAGAATACAGTGATTCTGGG - Intergenic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1076641167 10:131918040-131918062 TGGGATGACACAGTGTTTGTAGG + Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080273818 11:30480722-30480744 AGGAAGAACACAGTTTTTATTGG - Intronic
1080966640 11:37220567-37220589 AGAGAGAATGCAGTGATCGTGGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081522161 11:43892885-43892907 AGGGAGAAAACATTGACTGAGGG + Intronic
1081917776 11:46744517-46744539 ATGGAGGACACTGTGCTTGTGGG + Exonic
1082631442 11:55546858-55546880 AGGAGGAAGAAAGTGATTGTTGG + Intergenic
1082654304 11:55834477-55834499 AGGGAGAAGGGGGTGATTGTCGG - Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1083146067 11:60759862-60759884 AGGGTGAACAGGGTGATGGTGGG - Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1084467686 11:69335826-69335848 AGGGAGGAGACAGTCATTGTTGG - Intronic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086261619 11:84947019-84947041 AGGGAGAGCAAAGTGATGGCTGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087034846 11:93744907-93744929 TGGGAGAACAGGGTGATGGTGGG + Intronic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089393257 11:118116383-118116405 AGGGAGCTCACAGTGGTTGGGGG + Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090439474 11:126713877-126713899 AGGGGGAGCACAGTGCTTGGAGG + Intronic
1090923093 11:131224482-131224504 AGGGATAATACAGGGATTGCAGG + Intergenic
1091091740 11:132777461-132777483 AGGGAGCCCACAGTCATTCTGGG + Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1092657090 12:10697487-10697509 GGGGAAAACACACTGGTTGTAGG - Intergenic
1093696001 12:22161143-22161165 AGGGAGATAACAGGGAGTGTTGG + Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1094795742 12:33970272-33970294 AAGGAAAACAAAGTGATTGAGGG - Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095833194 12:46609347-46609369 AGGGAGAACACACTGAGATTTGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1098739322 12:74151869-74151891 AGGGAGAAAAAAGTCATTGTGGG + Intergenic
1099024395 12:77447602-77447624 AGGGAGAACAAAGCAATTGCAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099764263 12:86961627-86961649 AGGGAGAACACAGCATTTGGGGG - Intergenic
1099781570 12:87202330-87202352 TGAGATAATACAGTGATTGTGGG + Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1100082801 12:90873806-90873828 AGGCAGACCACAGGGATTTTAGG + Intergenic
1100388637 12:94127733-94127755 AAGGAGAACACAGTTTCTGTGGG - Intergenic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1103063215 12:117875608-117875630 AGGGAGAAGGCAGCGATTATGGG - Intronic
1104387235 12:128361554-128361576 AAAGAGTACACAGTGATTGCTGG + Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108574028 13:51776631-51776653 AGGAAGAAGACAGTTAATGTAGG - Intronic
1108741253 13:53340930-53340952 AGGGAGAATACAGTTATTTCAGG + Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1109639560 13:65172005-65172027 AGGAAAAACACAATGATGGTTGG - Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112843570 13:103609684-103609706 AGGAAGAACACAGAGCTTGGGGG - Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115467161 14:33728124-33728146 AGGGAGAAGAGAGTGTTTGCTGG - Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1115801507 14:36999393-36999415 TGGCAGAAAACAGTGATTTTAGG + Intronic
1115887771 14:37992888-37992910 AGTGGGAACACAGGGATAGTTGG + Intronic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116481341 14:45394335-45394357 CAGGAGAACAGAGTGATGGTGGG - Intergenic
1116504906 14:45665908-45665930 AGGAAGAACACAGCAATTGTGGG - Intergenic
1116765844 14:49069923-49069945 GGGGAAAACACAGTGACTGTGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117504546 14:56389109-56389131 AGGGACTACGCAGCGATTGTGGG - Intergenic
1117545097 14:56787093-56787115 AGGGAGAACATAATGATGGGTGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1117870657 14:60197452-60197474 AGGGAGGACAAAGTGACTGTGGG + Intergenic
1117976066 14:61298078-61298100 AAGGGGAACAAAGAGATTGTTGG - Intronic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119746409 14:77047593-77047615 AGGGAGAAAACATTCTTTGTAGG - Intergenic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1120550401 14:85864394-85864416 AGCCAGACCACAGTGAATGTTGG + Intergenic
1122753544 14:103958380-103958402 AGGGAGTAGACAGTGGGTGTGGG + Intronic
1123453748 15:20396194-20396216 AGGGAGAAAAGAGTGAGTGAGGG - Intergenic
1125194201 15:37028067-37028089 AGGCAGAACACAGAGTTTTTAGG - Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1126865414 15:52932051-52932073 AGGGAACACAGAGTGATTATAGG + Intergenic
1127471492 15:59294604-59294626 AGGGAGAACACAGGCCTTCTTGG + Intronic
1128820753 15:70650673-70650695 AGGCAGAACACAGTTATTCCTGG - Intergenic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1129477594 15:75796541-75796563 AGGGAGAATACAGCAACTGTGGG - Intergenic
1130007661 15:80116230-80116252 AGGGAGAAAACACTGATTTTTGG - Intronic
1130275806 15:82475842-82475864 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130336250 15:82959437-82959459 AGGCAGAGCACAGTCATTGCAGG + Intronic
1130430543 15:83842686-83842708 TGTGAAAACAGAGTGATTGTAGG + Intronic
1130468165 15:84203234-84203256 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130496099 15:84470308-84470330 AAGGAGACCACAGTGCTTGCTGG - Intergenic
1130590458 15:85207832-85207854 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1131153802 15:90062707-90062729 AGGGAGAACAGAGTGATACCGGG + Intronic
1133331895 16:4979995-4980017 AGGCAGGACACAGTGATTCAGGG + Intronic
1133417024 16:5614891-5614913 AGGAAGAACACAGGGAGGGTGGG + Intergenic
1134239389 16:12494249-12494271 AGGGAGGACGCAGAGATGGTGGG - Intronic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1141205084 16:81927307-81927329 AGGGAAGACACAGTGATGATAGG + Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1142921259 17:3188875-3188897 AGGAAGAAAACATTTATTGTGGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1147322764 17:39656253-39656275 AGGGAGGACACAGGGACTCTGGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149570684 17:57670204-57670226 AGGGACAACACAGAAATTATTGG + Intronic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151961518 17:77408292-77408314 AGGGAGTCCACAGTGGTTCTGGG + Intronic
1153340489 18:3968625-3968647 AGAGAGAACACAGTAATATTTGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156159689 18:34344582-34344604 AAGGTGAACAGAGTGACTGTGGG - Intergenic
1156357056 18:36350975-36350997 AGGAAGAACACAGTGCTTCTTGG - Intronic
1156977356 18:43238629-43238651 AGGGGCAACACAGTGACTGGAGG - Intergenic
1157169924 18:45393802-45393824 AGTGAGAACTCAGTGAGTGTTGG - Intronic
1157492064 18:48130387-48130409 AGGGAGAAGAAAGTGATGCTAGG + Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1160825143 19:1076453-1076475 AGGTAGAAACCTGTGATTGTTGG + Intronic
1162060909 19:8094638-8094660 AGTGATCACACAGTGATTGCAGG - Intronic
1162624201 19:11871151-11871173 AGGGAGGAGTCATTGATTGTCGG + Intronic
1164588273 19:29491275-29491297 AGTGAGAACAAAGTGATTCTGGG + Intergenic
1165645267 19:37430885-37430907 AGGGAGACCAGAGTGATTGCAGG + Intronic
1165968051 19:39601219-39601241 AGGGAGAACTCACACATTGTTGG + Intergenic
1167007823 19:46787147-46787169 AGGGAGAAGAAAGTGATTTGGGG - Intronic
1167613111 19:50516860-50516882 AGAGAAAACAAAGTGAATGTGGG - Intergenic
1168081284 19:54012272-54012294 AGGGAGAACACAGTTTCTCTAGG - Exonic
1168523898 19:57073698-57073720 AAGGAGCACACAGTGTTGGTGGG - Intergenic
925194883 2:1914832-1914854 ATGGAAAAGACAGTGGTTGTGGG - Intronic
925399601 2:3562695-3562717 AGCGAGAACACAGGGATATTAGG - Intergenic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
926318041 2:11725803-11725825 AGGGAGAAAAAAGTGATTCCGGG - Intronic
926320042 2:11743345-11743367 AGGGAGAGGACAGTGATCCTCGG - Intronic
926481547 2:13403050-13403072 AGGGAGAAAAGAGTGAGTGAGGG + Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928726328 2:34178034-34178056 AAGGAGACCACAGCTATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929182620 2:39059742-39059764 GTGGAGAACACAATGATTCTTGG + Intronic
930042168 2:47134332-47134354 AGGGAGAACACAGGATTTTTAGG - Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931180475 2:59895279-59895301 AAGGAGCACACACTGTTTGTGGG - Intergenic
932275880 2:70451964-70451986 AGGGAGCACACAGAGAGTGCGGG - Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935179688 2:100678254-100678276 AGGGAGCTCACATTTATTGTGGG - Intergenic
935478621 2:103557353-103557375 GGGGAGAACACAGTGATAATGGG - Intergenic
935619278 2:105114605-105114627 GGGGAAAATACAGTGATTTTTGG + Intergenic
936538824 2:113333652-113333674 AGAGAGCACGCAGTGAGTGTGGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937121838 2:119445707-119445729 CGGGAGAAGCCAGTGATTATAGG - Intronic
937379708 2:121365523-121365545 AGGGTGAAGACATTGACTGTTGG - Intronic
937664964 2:124476426-124476448 AGTGACATCACAGTGTTTGTGGG + Intronic
940191328 2:151043103-151043125 AGTGAGACTACAGTTATTGTGGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940803433 2:158157681-158157703 AGGGAGAACACTGGGAGTGGGGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944452078 2:199853409-199853431 AGGGAGAACTTAGTTCTTGTAGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944928906 2:204495822-204495844 AAGGAAAAAAGAGTGATTGTGGG - Intergenic
945066309 2:205950235-205950257 AGCGAGAACACAAAGATTCTAGG - Intergenic
945727911 2:213495566-213495588 AGGGAGATTACATTGATTGAAGG + Intronic
945802365 2:214449442-214449464 TGGGAGAAAAAATTGATTGTAGG + Intronic
946897721 2:224341345-224341367 CATGAGAACACAGAGATTGTGGG - Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947353893 2:229272570-229272592 AGAGAGAACACAATGTTTGTGGG + Intergenic
947389400 2:229623606-229623628 AGGAAGAAGACAGAAATTGTTGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169015800 20:2291758-2291780 GGGGAGAACACAATCATTGTTGG + Intergenic
1169597185 20:7213871-7213893 AGGGAGCACAAAGGGATTGTGGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170460804 20:16574829-16574851 AGGGAAAACCCAGTGATTTCCGG - Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172520697 20:35563691-35563713 AGGGAGAAAACAGTCTTTATTGG - Intergenic
1172703399 20:36865646-36865668 ATGGAGCACACAGTGTGTGTTGG + Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174977115 20:55348622-55348644 GGGGAAAACACAGGGCTTGTGGG + Intergenic
1174998499 20:55599914-55599936 GTGGAAAACACAGTGATGGTGGG + Intergenic
1175063467 20:56264871-56264893 GGGGAGAACAGAGTTTTTGTAGG - Intergenic
1175549412 20:59807351-59807373 AGGAAGATGACAGTGATTGATGG - Intronic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177422732 21:20882535-20882557 AGGTAGAACACAGTGTAGGTGGG - Intergenic
1177439675 21:21105340-21105362 ATGGAGTACACAGTGTTTGAAGG + Intronic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177692699 21:24531890-24531912 AGAGACAACACAGTAATTGTGGG + Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1183010524 22:34943065-34943087 GGGGAGAACACTGTGACTTTGGG + Intergenic
1183247989 22:36708753-36708775 AGGATGAACACAGGGACTGTGGG - Intergenic
1185219960 22:49624261-49624283 AGGGAGGGCACAGTGATGCTCGG + Intronic
1185219995 22:49624415-49624437 GGGGAGAGCACAGTGATGCTCGG + Exonic
950495847 3:13333940-13333962 AGGGAGAAAACAGGGAGTGGCGG + Intronic
950925448 3:16736593-16736615 AGTGAGAACACAGTGGTGCTTGG - Intergenic
950938952 3:16873980-16874002 AGGGAGTACACAGGGACTCTGGG - Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952588958 3:34928217-34928239 AGGGAGAACATACAGATTTTTGG - Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
952935725 3:38397007-38397029 AGAGGGAACACAGACATTGTGGG - Intronic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
956948951 3:74257842-74257864 AGGGAGAAAACAATGGATGTGGG - Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
958868267 3:99526404-99526426 AGGGAGGACACAGAGAATATAGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959791539 3:110367811-110367833 CAGGAGAACAGAGTGATAGTGGG - Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960840933 3:121957918-121957940 AGGGAAAGCACCGTAATTGTGGG + Intergenic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
961764931 3:129202432-129202454 AGGCAGAGCACAGAGATTTTGGG - Intergenic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963145018 3:141984562-141984584 AAGTAGAACAGAGGGATTGTGGG + Intronic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
964052482 3:152412765-152412787 AGGAAGACCACAGTTAGTGTTGG + Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964598037 3:158459013-158459035 ATGGAGGACATACTGATTGTTGG + Intronic
964945061 3:162211577-162211599 AGGGAAAACAGAGTCTTTGTTGG - Intergenic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965412417 3:168348559-168348581 AGGGAGACCACAGTGTTCATAGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966769784 3:183493433-183493455 ATGTACAACACAGTCATTGTAGG - Intronic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968096043 3:195931515-195931537 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096053 3:195931577-195931599 AGGCAGAGCACAGTGATGATGGG + Intergenic
968096064 3:195931639-195931661 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096075 3:195931701-195931723 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096083 3:195931763-195931785 AGGCAGAGCACAGTGATGATAGG + Intergenic
968218459 3:196914930-196914952 AGGAAGAGCAAAATGATTGTGGG + Intronic
968480665 4:831739-831761 AGGGAGAACACGGCCATTGGGGG + Intergenic
970026520 4:11629855-11629877 AGGGAGAACACAGAGAAGGGCGG + Intergenic
970531951 4:16993921-16993943 ACGGAGGACACAATGAGTGTTGG + Intergenic
970570104 4:17371763-17371785 AGTGACAAGACAGTGATTCTGGG - Intergenic
971616800 4:28800915-28800937 TTGGAGATCACAGTGATAGTAGG - Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976082940 4:81376033-81376055 GGGGAGGGCACAGCGATTGTGGG - Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
977725983 4:100297581-100297603 AGGCAGAACAGAATGAATGTAGG - Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978733686 4:112061326-112061348 AGGGACAGCACAGTGATCATGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979111271 4:116761152-116761174 AGGGGAAGCACGGTGATTGTGGG + Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
980638307 4:135538782-135538804 AGGGTGAACAGGGTGATGGTGGG - Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982339723 4:154284589-154284611 AGGGTGAGCATGGTGATTGTGGG + Intronic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
985165468 4:187089865-187089887 AGGCAGAACACAGGGAAGGTAGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986764540 5:10912773-10912795 TGGTAGAAAACAGTGATAGTGGG + Intergenic
987068372 5:14311423-14311445 AGGGAGAACACAGAGAAAGCTGG - Intronic
987537289 5:19205968-19205990 AGGAAGAACACAGCGATTGCAGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988489456 5:31694098-31694120 AGGAACAAAACAGTGCTTGTAGG + Intronic
988616898 5:32783578-32783600 AGGGAGAACAAAGTGAATATAGG + Intronic
988885542 5:35553618-35553640 TGGGAGAACAAAATCATTGTTGG - Intergenic
988930201 5:36029672-36029694 AGGATGAACACAGTGACTGAAGG + Intergenic
988994426 5:36701054-36701076 AGGGAGATGACAGGGATTGGAGG + Intergenic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
990251430 5:53919524-53919546 AGTGAGAAGAAAGTGATTGAGGG + Intronic
990814015 5:59763022-59763044 AGGAAGAACACACTGATTTCAGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992642461 5:78779970-78779992 AGGGAGCAGACAGTGATTAATGG - Exonic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993252514 5:85547858-85547880 AGGGAGAAGGAAGTGAGTGTAGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994000839 5:94777129-94777151 ATGGAAAACACACTGCTTGTCGG + Intronic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995264709 5:110144686-110144708 AAGGAGAAGACAGTGATTAGGGG + Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995421632 5:111974105-111974127 AGGGAAAACACAGTCACGGTAGG - Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
998612671 5:143705859-143705881 AGAGAGAACACAGGGGTTGAAGG + Intergenic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
998958263 5:147458853-147458875 AGGGAGAACACAGTGTATAGGGG + Intronic
999145293 5:149389020-149389042 AGGAAGAACTCAGTAAATGTCGG + Intronic
999279465 5:150355488-150355510 AGGGAGAAGACAGTGTATGTGGG - Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1000608718 5:163352108-163352130 AGGGAGAACCCAGAGAATGTAGG + Intergenic
1004568476 6:16821855-16821877 AGGGAGCACACATAGCTTGTAGG - Intergenic
1004762498 6:18684129-18684151 AGGGAGAAGAAAGTGAGTGAAGG - Intergenic
1005447270 6:25937544-25937566 TGGGAGAACAGATTGATTCTGGG + Intergenic
1007533880 6:42567055-42567077 GTAGAGAAAACAGTGATTGTAGG + Intronic
1008055545 6:46942053-46942075 CTGGAGAACACAGTGCTTGCAGG - Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010314514 6:74430859-74430881 ATGGAGTACATAGTGATGGTAGG - Intergenic
1010596402 6:77769199-77769221 AGAGAGAACATACTGATTATGGG + Intronic
1011340892 6:86313219-86313241 AGGGAGACCACAGCAATTGTAGG + Intergenic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1012827233 6:104162173-104162195 AGGGAGAACGCAGTGACCATGGG + Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013470127 6:110456733-110456755 AGGGAGAACACATCGAGTTTGGG - Exonic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014794606 6:125710324-125710346 AGGGAGAACGCAGGAATTGTGGG + Intergenic
1015002266 6:128232526-128232548 AGGGAGAACTTTGTAATTGTAGG - Intronic
1015105048 6:129526829-129526851 TGGGAGAACAAAGTTATTGAAGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015890822 6:137968050-137968072 TGGGAGATCAAAGTGATGGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016354084 6:143198892-143198914 AAGGAGAAAAGAGAGATTGTGGG + Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017387244 6:153900692-153900714 AGGGAGAACACAGTGAACTGGGG + Intergenic
1018069968 6:160155610-160155632 AGGGAGAAAAGAGTGATGGGAGG + Intronic
1018414869 6:163592015-163592037 AGGGAGCAAACAGTGGTTTTGGG - Intergenic
1019228663 6:170537804-170537826 AGGGAGAACACAGAGAGAGATGG + Intronic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1020465469 7:8473692-8473714 AGGCAGTACACAGTGATTTGAGG + Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021249939 7:18312047-18312069 GGAGAGGACAAAGTGATTGTAGG + Intronic
1021501540 7:21337160-21337182 AGGAAGAACAGAGTGAGGGTAGG - Intergenic
1021640864 7:22735055-22735077 AAGGAGAACACATCAATTGTGGG + Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021859660 7:24893835-24893857 TGGGAGAAGCCAGTGATTCTAGG - Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023489687 7:40725753-40725775 ATCAAGAACACAGTGATTCTGGG - Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1023752708 7:43387171-43387193 AGGGAGAACAATGGGATTGGTGG - Intronic
1024090720 7:45937708-45937730 GGGGAGAACACAGAGGTTGGAGG - Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025196872 7:56940694-56940716 AGGAAGAACACACTGGGTGTGGG + Intergenic
1025675076 7:63636243-63636265 AGGAAGAACACACTGGGTGTGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029705471 7:102273619-102273641 AGGGAGAACCCAATGGTTTTAGG - Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031657735 7:124379452-124379474 AGTGAGACCACAGTGATCATGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033125451 7:138703042-138703064 AGTGAGGACACAGTCATTGTTGG + Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1034946863 7:155267816-155267838 AGGGAGAAGACCATCATTGTGGG - Intergenic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1037913221 8:22756720-22756742 AGGGAGAAGAAAGTGGTTGCTGG + Intronic
1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG + Exonic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1039339300 8:36629302-36629324 GTGGAGAAGACAGTGATTTTTGG + Intergenic
1039414228 8:37379812-37379834 CAGGAGAACACAGGGATTCTAGG + Intergenic
1040290280 8:46120655-46120677 AATGAGACCACAGCGATTGTTGG - Intergenic
1040314292 8:46252819-46252841 AGTGAGAACACAGGGAATGCTGG + Intergenic
1040336735 8:46419881-46419903 AGCGAGACCACACTGAATGTTGG + Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1043066871 8:75583680-75583702 AGGGAGAACACAGGATTTTTAGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1043578321 8:81683247-81683269 AGGGATAAGACATTGATTGAAGG + Intronic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044531667 8:93314586-93314608 GGGGAGAACCCAGAGGTTGTAGG + Intergenic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045062508 8:98422070-98422092 AGGGAGCACACAGGGATGGAAGG + Intronic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046261928 8:111780009-111780031 AGGGAGCAAAAATTGATTGTTGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047352540 8:124089311-124089333 AGGAAGAACACAATAATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048966540 8:139618895-139618917 ATGGAGAACATGGTGACTGTGGG - Exonic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1050644410 9:7703295-7703317 AGGGAGAATACAGTCACTGAGGG - Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052258900 9:26491793-26491815 AGGGAGAACACAGCAGTTGTGGG - Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1052547631 9:29900613-29900635 AAGGAGAACACTGTGCATGTAGG - Intergenic
1053105747 9:35406378-35406400 TAGGAGCACACAGTGCTTGTCGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054486530 9:65730272-65730294 AGTGAGAACACAGCGATGTTTGG - Intronic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055464308 9:76549171-76549193 AGTGAGAACACAAAGATTATAGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056289388 9:85127466-85127488 AGGGAAAACACAGATATTGGGGG - Intergenic
1058086284 9:100752028-100752050 AGGGGTTGCACAGTGATTGTGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058616238 9:106831014-106831036 AGGGAGAACTCAGTGATTCAGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059117594 9:111613554-111613576 AGGGAGCTCACAGGCATTGTGGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1061080330 9:128365891-128365913 AGGGAGAACACGGGGCCTGTGGG - Intergenic
1061233410 9:129328124-129328146 AGGGACAACTCAGTGGCTGTGGG + Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1062454384 9:136628856-136628878 CTGGAAGACACAGTGATTGTGGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186458984 X:9733406-9733428 TGGGAGAAAATAGTAATTGTGGG + Intronic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1186602260 X:11050303-11050325 AAGGAGAACATAGTGATCATGGG - Intergenic
1187052306 X:15707181-15707203 AGCCAGAACACAGTGATTATTGG - Intronic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188232108 X:27677226-27677248 AGAGAACACACAGTGTTTGTGGG - Intronic
1188421225 X:29992518-29992540 AGGGAGGGCATAGTAATTGTGGG - Intergenic
1188609004 X:32072475-32072497 AGAAAGAACACAATGACTGTGGG - Intronic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189109057 X:38268164-38268186 AGTGAGAACTCAGTCATTATGGG - Intronic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190388855 X:49911884-49911906 GGGGAGAACACACTGGTTGGTGG - Intergenic
1191593322 X:62913011-62913033 ATGTAAAAGACAGTGATTGTGGG - Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1192065289 X:67878842-67878864 AGAGAGAACACAAAAATTGTAGG - Intergenic
1192134944 X:68588515-68588537 AGGAAGAACACAGTGACTAGGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG + Intergenic
1192690085 X:73353692-73353714 AGTGAGACCAGAGTGCTTGTTGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193738353 X:85186634-85186656 AAAGAGACCACAGTGACTGTGGG - Intergenic
1193750513 X:85337271-85337293 AGGGAGAGCAAGGTGAGTGTGGG - Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1193931694 X:87561371-87561393 GGGGAAAGCAAAGTGATTGTAGG + Intronic
1193933198 X:87582386-87582408 AGGGATAACACAGCAATTGTGGG + Intronic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196141469 X:112267483-112267505 ATGGAGATCACAGAGATTGGAGG - Intergenic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197435761 X:126425959-126425981 AGGGAGAAAACAGCAATTATGGG - Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198724785 X:139665474-139665496 AGGGAGATCACAGAAACTGTGGG - Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199520797 X:148733042-148733064 AGGTTGAACACAGTTATTGATGG - Intronic
1199685826 X:150264337-150264359 AGTGAGAACCCAGTGTCTGTGGG - Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic