ID: 1153357869

View in Genome Browser
Species Human (GRCh38)
Location 18:4157812-4157834
Sequence CTGTGAGTAAGTGGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 1, 2: 0, 3: 44, 4: 359}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153357869 Original CRISPR CTGTGAGTAAGTGGGGAAGC TGG Intronic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900625105 1:3604383-3604405 CTGGGAGTTGGTGGGGAACCTGG - Intronic
901023666 1:6267853-6267875 ATGTGAGTCAGTGGTGAATCAGG - Intronic
901360386 1:8693825-8693847 CTGGGAGTTAGGGGGGATGCGGG + Intronic
902891851 1:19450016-19450038 CTGTGAGTAAGTGGGACTACGGG - Intronic
903210479 1:21815313-21815335 CTGTGTGTAAGTGTGCAAGGCGG - Intronic
903392852 1:22976912-22976934 CCGGTAATAAGTGGGGAAGCTGG - Intergenic
904425044 1:30417577-30417599 CTTTGAGTAAGACCGGAAGCTGG - Intergenic
904957585 1:34297969-34297991 CTCTGAGTGAGTGGGAAATCTGG - Intergenic
905967037 1:42107311-42107333 TGGTGAGTATGTGGGTAAGCTGG - Intergenic
906746927 1:48228593-48228615 CAGTGAGTAAATGGTGAAGTGGG - Intronic
906870866 1:49479436-49479458 GTGGGAGGAAGTAGGGAAGCAGG - Intronic
907304767 1:53507357-53507379 GTGTGAGTAAGGGGTGGAGCTGG + Intronic
907437579 1:54459296-54459318 ATGTGAGGTAGTAGGGAAGCAGG - Intergenic
907546572 1:55265228-55265250 TTGTGAATAACTGAGGAAGCTGG + Intergenic
907716403 1:56930355-56930377 CTGTGAGGTAGTGGCAAAGCTGG - Intronic
907795138 1:57708578-57708600 CAGTTAGTCAGTGGTGAAGCTGG + Intronic
907934406 1:59029515-59029537 CTGTGAAGATGTGGGAAAGCTGG - Intergenic
908276848 1:62482283-62482305 CTGTTAGTAAGTGGTGGAGTGGG + Intronic
909415120 1:75397737-75397759 CTGCTAGTAAGTGGGGAACCTGG + Intronic
911496323 1:98636210-98636232 CTGAGAGTAAGAAGGGAGGCTGG + Intergenic
912332471 1:108832150-108832172 TCATGAGTAAGTGGGAAAGCTGG + Intronic
912852766 1:113141217-113141239 GTGTGAGGAGGTGGGGAAGAGGG - Intergenic
913241096 1:116830134-116830156 CAGTGAGTAAGTGGCAGAGCTGG - Intergenic
915681152 1:157583093-157583115 CAGTGAGTAAGTTGAGGAGCTGG - Intronic
915950736 1:160188417-160188439 ATGTGAGTGAGGTGGGAAGCAGG + Intergenic
916168649 1:161984633-161984655 ATGTGAGGGAGTGGGGAAGGGGG + Intronic
916487027 1:165269073-165269095 ATGGGAGTAAGTGGTGAAACAGG - Intronic
917348003 1:174048899-174048921 CTGTGAGTTAGGGGAGAAGATGG - Intergenic
918534835 1:185562283-185562305 CTGTGCATATGTGGGGAAGGGGG + Intergenic
919618374 1:199835413-199835435 CAGAGACCAAGTGGGGAAGCTGG + Intergenic
919800991 1:201354543-201354565 CAGTTAGTAAGTGGCAAAGCTGG - Intergenic
920204931 1:204284365-204284387 CTGGGAGTAATAGGGTAAGCTGG + Intronic
920305069 1:205013508-205013530 CAGTGAGTTAGTGGCAAAGCTGG + Intronic
920374494 1:205500435-205500457 CTGTGAGTCATTGGGACAGCAGG - Intergenic
921707862 1:218345158-218345180 CTGTGGGTAAGGGAGGAAGGAGG - Intergenic
921828412 1:219700099-219700121 CAGGGAGTAAGGGGAGAAGCGGG + Intronic
922740558 1:228012015-228012037 CCGTGAGTCAGAGGGGCAGCTGG - Intronic
1062840398 10:666102-666124 CTGTGAGTTCGTGGGAAAGAAGG + Intronic
1063346017 10:5313110-5313132 CTGTGAGTAAGTGGCAGGGCTGG - Intergenic
1064020736 10:11806472-11806494 TTGCTAGTAAGTGGGAAAGCAGG - Intergenic
1064346515 10:14537432-14537454 CTTAGAGCAAGTGAGGAAGCTGG - Intronic
1064388739 10:14922740-14922762 CTGTTAGTAAGTGGCGGAGCTGG + Intronic
1065381615 10:25096543-25096565 CGGTGAGTTAGTGGGGTGGCAGG - Intergenic
1067785448 10:49242406-49242428 CAGTGAGTTGGTAGGGAAGCCGG - Intergenic
1067998870 10:51308219-51308241 CTGTGAGTAATTGTGGTGGCAGG + Intronic
1068675377 10:59764457-59764479 CTGCTAGTAAGTGATGAAGCAGG - Intergenic
1068881612 10:62055280-62055302 TAGTTAGTAAGTGGGGAATCTGG - Intronic
1068963194 10:62886115-62886137 CAGTGAGTCAGGAGGGAAGCTGG + Intronic
1069946122 10:71986986-71987008 CAGAGAGTAAGTGGGAGAGCTGG + Intronic
1071857319 10:89638958-89638980 CTGGAAGAATGTGGGGAAGCAGG - Intronic
1072314407 10:94188009-94188031 CTGTGAGTACCTAGGGAAGGGGG - Intronic
1072442538 10:95469743-95469765 CAGAGAGTAAATGGTGAAGCTGG + Intronic
1072863527 10:99032443-99032465 CAGGGAGTAAGTGGGGATCCTGG - Intronic
1073066394 10:100761944-100761966 ATGTGAGTTGGTGGGGAAGGAGG - Intronic
1073191176 10:101651472-101651494 TTGTGAGAAAGTGGTGAATCAGG + Intronic
1074053147 10:109898162-109898184 CAGCTAGTAAGTGGGGAACCAGG - Intronic
1074440067 10:113470491-113470513 CAGGGAGGATGTGGGGAAGCAGG + Intergenic
1074478683 10:113797606-113797628 CAGTGAGTAAATGGGGAGGGTGG - Intergenic
1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG + Exonic
1074868017 10:117556082-117556104 CTGGGAGAAAGCAGGGAAGCGGG - Intergenic
1075527118 10:123196304-123196326 CAGTGAAGAAGTGGGGAAACTGG - Intergenic
1076065616 10:127445389-127445411 CTGTCAGTGGGTGGGGAGGCTGG + Intronic
1076376506 10:129991571-129991593 CGGTGAGGATGTGGGGAAACTGG + Intergenic
1076436260 10:130444740-130444762 ACATGAGTAAGTGGGGAAGATGG - Intergenic
1076436870 10:130452566-130452588 CTCAGAGTGAGTGTGGAAGCTGG - Intergenic
1076622506 10:131801084-131801106 CTGTGAGCGAGTAGGGAAGCAGG + Intergenic
1076659372 10:132045153-132045175 TTGTGAGGATGTGGGGAAACTGG - Intergenic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078425103 11:11243501-11243523 CTGGCAGTAAGTGGTGGAGCAGG - Intergenic
1078476432 11:11634185-11634207 CAGTGAGGAAGTTGAGAAGCAGG - Intergenic
1078555199 11:12319601-12319623 ATGAGAGTAAGTGGGGGAGGAGG + Intronic
1078654149 11:13222511-13222533 CTGTGAGTCAGAGGGGAGGTTGG - Intergenic
1079984120 11:27182311-27182333 CAGTGATTAAGGGTGGAAGCAGG + Intergenic
1083259921 11:61517372-61517394 CTGTGAGTGAGTCGGGCAGAAGG + Intronic
1083594172 11:63911145-63911167 CTGTGGGTAAGTGGGGAGCTGGG - Intergenic
1083925361 11:65802921-65802943 CGGTGAGCAAGTGGTGAAGCTGG + Intergenic
1084676008 11:70635060-70635082 TGGTGAGTATGTGGGGAAACTGG + Intronic
1085187355 11:74587713-74587735 CTGCTAGTAAGTGGTAAAGCTGG + Intronic
1085393175 11:76192971-76192993 AAGTGAGTTAGTGGGGGAGCTGG + Intronic
1087465068 11:98494153-98494175 CTGTGAGTAAAATGGGAGGCAGG + Intergenic
1088327182 11:108612964-108612986 CTGCCAGTAAGTGGCAAAGCTGG + Intergenic
1089375991 11:117995229-117995251 CAGCTAGTAAGTGGTGAAGCTGG + Intronic
1089531418 11:119132292-119132314 CAGCTAGTAAGTGGTGAAGCTGG + Intronic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1091242733 11:134064769-134064791 CTTTGAGGATGTGGAGAAGCAGG - Intergenic
1091326951 11:134698370-134698392 CTGTGAGGAGGTGAGGCAGCTGG - Intergenic
1091390058 12:120711-120733 CTTTGAGAAAGTAGGGAAACAGG - Intronic
1092005387 12:5064987-5065009 CAGTTAGTAAGTGGCAAAGCAGG - Intergenic
1092525328 12:9306281-9306303 ATGTGCATTAGTGGGGAAGCTGG - Intergenic
1092541945 12:9425536-9425558 ATGTGCATCAGTGGGGAAGCTGG + Intergenic
1093164147 12:15786577-15786599 ATGTTAATAAGAGGGGAAGCTGG + Intronic
1093205667 12:16245987-16246009 CTTTGATTAATTGAGGAAGCTGG + Intronic
1093704014 12:22254803-22254825 CTTTGAGTGAGTGGGAAAACGGG - Intronic
1094063182 12:26336216-26336238 CTGAGAATGAGTGGGGAGGCTGG - Intergenic
1095500251 12:42829857-42829879 CTGCTAGTAAGTGGTGAAGCAGG + Intergenic
1095522948 12:43089073-43089095 CTTTGAGTAAGTAGGGAAGGTGG + Intergenic
1095683246 12:45003089-45003111 CTGTGAGTGAGAGGGAGAGCAGG - Intergenic
1095794474 12:46202875-46202897 ATGTGAGTAAATGTTGAAGCTGG + Intronic
1095989728 12:48026457-48026479 CTGGGAGAAGGTGGGGGAGCAGG - Intergenic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1097661341 12:62434921-62434943 CTGTGTCTGAGTGGGGAAGCAGG + Intergenic
1097864979 12:64552523-64552545 CTGTCAGGAGGTGGGGTAGCGGG - Intergenic
1097967217 12:65594370-65594392 CTGGGAGTAAGAGGATAAGCTGG + Intergenic
1098477770 12:70925159-70925181 CAGTTGGTAAGTGGTGAAGCTGG + Intergenic
1098603351 12:72360588-72360610 TGGTGAGGATGTGGGGAAGCAGG + Intronic
1100394170 12:94170397-94170419 GTGTGAGCAAGTGTGGAAACAGG - Intronic
1101435271 12:104658919-104658941 CTGCTAGTAAGTGGTGAAGCTGG + Intronic
1101522145 12:105493878-105493900 CTGCTAGTAAGTGGCAAAGCTGG - Intergenic
1102398556 12:112609085-112609107 CTGTGAGGATTTGGGGAAGATGG - Intronic
1103796569 12:123507065-123507087 TGGTGAGAAAGTGGGGCAGCTGG + Intronic
1104299028 12:127547108-127547130 CAGCCAGTAAGTGGCGAAGCAGG - Intergenic
1104991458 12:132625995-132626017 ATGTGAGTCAGAGGGGCAGCAGG + Intronic
1105533319 13:21240578-21240600 CTGAGAGTAGGTGGAGAGGCTGG + Intergenic
1107734500 13:43384028-43384050 CTGTTAGTGAGTGGTGCAGCCGG - Intronic
1110299768 13:73912857-73912879 CTGTGAGTGAGGGGAGAAGAAGG - Intronic
1110468908 13:75835338-75835360 CTGTGAGTATTTGGAGAAGTAGG + Exonic
1111901319 13:94202716-94202738 ATGTCAGTAACTGGGGAAGTGGG + Intronic
1112678724 13:101736799-101736821 CAGTTAGTAAGTGGCGAAGCAGG + Intronic
1113295966 13:108959032-108959054 CAGTGAGTAGGTGGGGAGGGTGG + Intronic
1114257822 14:21017792-21017814 CAGAGAGGAAGTGGGGAAGGGGG + Intronic
1114628228 14:24143207-24143229 CTGTGAGAAAGAGGGGATTCAGG - Intergenic
1114628517 14:24145156-24145178 CTGTGAGAAAGAGGGGATTCAGG + Intronic
1118073466 14:62271450-62271472 CTGGGGCTAAGTGGGGAAACTGG - Intergenic
1119176837 14:72574731-72574753 CTAGGAGGAAGTGGGGAAGGAGG + Intergenic
1120817171 14:88873196-88873218 CTGCAAGTCAGTGGGGAAGAAGG - Intronic
1121101791 14:91254427-91254449 CTGTGAGGATGTGGGGCAGAGGG - Intergenic
1122262508 14:100531360-100531382 CTGTCTGTGGGTGGGGAAGCTGG + Intergenic
1124485469 15:30111067-30111089 ATGTGAGTATGTTGGGGAGCTGG - Intergenic
1124518107 15:30386200-30386222 ATGTGAGTATGTTGGGGAGCTGG + Intronic
1124540546 15:30580053-30580075 ATGTGAGTATGTTGGGGAGCTGG - Intergenic
1124615279 15:31237072-31237094 CTTTGAGTCAGGGGGCAAGCAGG - Intergenic
1124758107 15:32427528-32427550 ATGTGAGTATGTTGGGGAGCTGG + Intergenic
1124833956 15:33177433-33177455 CTGTTAGTAATTGGCAAAGCTGG - Intronic
1125554299 15:40571517-40571539 CAGTGAGGAACAGGGGAAGCTGG + Intronic
1125732402 15:41900574-41900596 CGGTGAGTCAGTGGTGGAGCAGG + Exonic
1125895941 15:43301829-43301851 CTGAGAGTCAGGGGAGAAGCTGG + Intronic
1128264721 15:66255718-66255740 CAGTTAGTAAGTGGTGGAGCAGG - Intergenic
1129310943 15:74708578-74708600 CTGAGAGGAGATGGGGAAGCTGG - Intergenic
1129469941 15:75747322-75747344 CTGCGAGTAAGTGGGGTGGAGGG - Intergenic
1130169298 15:81495258-81495280 CTGCGAGTAAGTGGTAGAGCTGG - Intergenic
1130961190 15:88659632-88659654 CTGGGGGACAGTGGGGAAGCAGG - Intergenic
1131563812 15:93467541-93467563 ATGTGAGTAAGCCTGGAAGCAGG - Intergenic
1132136388 15:99344308-99344330 CAGTTAGTAAGTGAGGAAGCAGG + Intronic
1132406608 15:101545262-101545284 GTGTGAGACAGTGAGGAAGCCGG + Intergenic
1133668968 16:7998947-7998969 AGGTGACTCAGTGGGGAAGCAGG - Intergenic
1134138072 16:11693056-11693078 CTGTAAGTTTGTGGGGAAGAGGG - Intronic
1136122966 16:28152398-28152420 CAGTTAGTAAGTGGTGGAGCTGG - Intronic
1137501346 16:49013811-49013833 CTGCCAGTAAGTGTGAAAGCTGG + Intergenic
1138332179 16:56224036-56224058 CTGAGGCTCAGTGGGGAAGCGGG + Intronic
1138436058 16:57000723-57000745 CTGTGAGTCAGTGATGATGCAGG - Intronic
1138566247 16:57835082-57835104 CTGTGAGTAAGAACGGAGGCGGG + Intronic
1138744170 16:59344036-59344058 CAGTTAGTAAATGGTGAAGCAGG - Intergenic
1141137459 16:81475627-81475649 CTGTGAGCAAATGGGGCAGAGGG + Intronic
1143097912 17:4488294-4488316 CTGTCCTGAAGTGGGGAAGCTGG + Intergenic
1144649456 17:16998107-16998129 CTGAGAGTCAGAGGGGAGGCTGG - Intergenic
1144658608 17:17053688-17053710 CTGTGATTTTGTGGGCAAGCTGG + Intronic
1145224676 17:21118073-21118095 GTGTGTGTCAGTGGGGAGGCGGG + Intergenic
1145733214 17:27209419-27209441 CTGTCAGTAAGTGGCCAAGCTGG - Intergenic
1146087237 17:29840888-29840910 CAGTCAGTAAGTGGTGAAGCTGG + Intronic
1146226038 17:31066973-31066995 CTGTTAGTAAGTGGCCAAGCTGG + Intergenic
1146406891 17:32546432-32546454 CTGTGAGCAAGTCCAGAAGCAGG + Intronic
1147315300 17:39617557-39617579 TGGTGAGCAAGTGGTGAAGCTGG - Intergenic
1147331833 17:39703915-39703937 CTGTGAGCAAGAGGAGCAGCTGG + Intronic
1148384990 17:47228002-47228024 GTGTGAGTAAGTGGGCCAGAAGG + Intergenic
1149363831 17:55920853-55920875 CTGTGAGGTATTGGGGAAGTAGG - Intergenic
1149916306 17:60613424-60613446 CTCTCAGTAAGTGGAGAAGCTGG - Intronic
1151148428 17:72063464-72063486 CTGCTTGTAAGTGGTGAAGCTGG + Intergenic
1151277404 17:73045974-73045996 GTGTGAGTGAGTGGTGATGCTGG - Intronic
1151430106 17:74056480-74056502 CTGTGGGTAAGAGGAGAAGGAGG + Intergenic
1151470734 17:74316162-74316184 CTTTGAGTACGGGGGGCAGCTGG - Intergenic
1151804967 17:76399562-76399584 CTGGGAGGAAGTGGTGGAGCTGG + Exonic
1152535275 17:80947236-80947258 CTGGGAGAAAGGGGAGAAGCTGG + Exonic
1152982452 18:291237-291259 CTGGTGGTAAGTGAGGAAGCTGG + Intergenic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1153407142 18:4753545-4753567 CTGTCAGTGAGAGGTGAAGCCGG - Intergenic
1153759429 18:8316393-8316415 CGGTGAGTAAGTGGAAATGCAGG + Intronic
1154325866 18:13389930-13389952 CTGTGAGCAAGTGGGGAGGAAGG - Intronic
1155249300 18:23940024-23940046 CAGCCAGTAAGTGGTGAAGCAGG - Intronic
1155687800 18:28577006-28577028 CTGTGTATAAGTGCAGAAGCTGG + Intergenic
1156747497 18:40410121-40410143 CAGTGATTGAGTGTGGAAGCAGG - Intergenic
1157192830 18:45595792-45595814 GTGTGTGGAAGTGAGGAAGCCGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158733050 18:60046922-60046944 CTGTGAGTAAGTGAAGAAGATGG + Intergenic
1160515280 18:79476113-79476135 GTGTGAGTCAGTGGGGAGGCTGG + Intronic
1160999535 19:1903134-1903156 CACTGAGTAAGTGGGACAGCTGG - Intergenic
1161468695 19:4445893-4445915 CTGCCAGTAAGTGGGAAAGCAGG + Intronic
1162057670 19:8074382-8074404 CTGTGAGGCAGTGGGAGAGCAGG + Intronic
1162424012 19:10583180-10583202 CAGTGAGGAAGCAGGGAAGCTGG + Intronic
1162827102 19:13259721-13259743 CTGTTAGTAAATGGGAAAGAGGG + Intronic
1163677598 19:18663096-18663118 CTTTGAGTCCCTGGGGAAGCAGG - Intronic
1164472468 19:28547592-28547614 GAGTGAGGAAGTGGGCAAGCAGG - Intergenic
1164789072 19:30960640-30960662 CCGTGAGTAAGTGGCAGAGCTGG + Intergenic
1165328339 19:35126776-35126798 CTGTGGGGAGGTGGGGAGGCAGG + Intronic
1165707384 19:37986202-37986224 CAAGGTGTAAGTGGGGAAGCCGG - Intronic
1165733131 19:38159128-38159150 ATGCGAGAAAGTGGGGAGGCTGG - Intronic
1165925684 19:39324881-39324903 ATGTTAGGGAGTGGGGAAGCAGG + Intergenic
1166106215 19:40599385-40599407 CAGGGACTAAGTGGGGAAGGAGG - Intronic
1166148282 19:40851954-40851976 CAGGGAGTAAGTGAGGGAGCTGG + Intronic
1166152425 19:40883739-40883761 CAGGGAGTAAGTGAGGGAGCTGG + Intronic
1166177756 19:41086906-41086928 CAGGGAGTAAGTGAGGGAGCTGG - Intergenic
1166633723 19:44431017-44431039 CTGTGAGGCAGTGGTGGAGCTGG + Intronic
1166651939 19:44581427-44581449 CGGGGAGTAAGGGAGGAAGCGGG - Intergenic
1166738563 19:45100555-45100577 CAGTGGGTAAGTGGTGGAGCTGG + Intronic
1167667074 19:50828593-50828615 CTGTACCTAAGTGTGGAAGCTGG - Intronic
925720068 2:6818432-6818454 CTGCCAGTAAGGGTGGAAGCAGG - Intergenic
926593154 2:14761123-14761145 CAGTGAGCAAGTGGGGAGGTCGG - Intergenic
926994905 2:18724361-18724383 ATGTGAGTAAGTGGGGACTGCGG + Intergenic
927017838 2:18985155-18985177 CGGTGAGTATGTGGAGAAACTGG - Intergenic
928074102 2:28247282-28247304 CTGTGAGTTAGTGAGGGAGCAGG - Intronic
928261911 2:29775664-29775686 CAGCTAGTAAATGGGGAAGCAGG - Intronic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
929745462 2:44652943-44652965 ATGTGAATAAGAAGGGAAGCAGG - Intronic
930806073 2:55492058-55492080 CTGTGAGGAAGTAAGGAAGGTGG + Intergenic
931277612 2:60756998-60757020 TTGTGGGTAGGTGGGGAAGCAGG - Intronic
931762176 2:65427884-65427906 CTGTGAGTAACTGAAGGAGCTGG - Intronic
931991054 2:67790851-67790873 CTGTGAGTTAGGGAGGAAGCTGG - Intergenic
932304694 2:70693726-70693748 GTCTGAGGAAGTGGGGGAGCTGG - Intronic
932501521 2:72187020-72187042 GTGTGAGTAAGTGTGGAGTCCGG + Intronic
932943462 2:76197627-76197649 ATGTGAGTGAGTGTGGAAGCAGG + Intergenic
936053960 2:109246727-109246749 CTGGGAGGCAGTGGGGATGCCGG + Intronic
936489425 2:112957534-112957556 CTGGCAGTAAGTGGCTAAGCTGG - Intergenic
938025419 2:127943729-127943751 GTGTGAGTCAGTGGGTGAGCAGG + Intronic
938589882 2:132726338-132726360 ATGTGAGCAAGAGGGGAAACTGG - Intronic
938803513 2:134785324-134785346 CAGCGAGTAAGTGGGCAAGCTGG + Intergenic
939986653 2:148835360-148835382 ATGTTAAGAAGTGGGGAAGCAGG - Intergenic
940349461 2:152665607-152665629 CAGGGAGCAAGTGAGGAAGCTGG - Intronic
941090264 2:161167120-161167142 GTGTGAGTAATTTGGGAGGCAGG - Intronic
944193079 2:197024021-197024043 CTGTGAGTATGTGGGGAGACAGG + Intronic
944931529 2:204525248-204525270 CTGGGGATAAGTGGGGAAGTGGG + Intergenic
944992438 2:205253492-205253514 CTGGAAGTACCTGGGGAAGCAGG + Intronic
946594214 2:221288351-221288373 CTGTGAGTAAGCTTGGAAGCTGG - Intergenic
948362488 2:237432851-237432873 TAGTGAGTAAGTGGGGAGGCAGG + Intergenic
948577263 2:238962899-238962921 CTGCTAGTAAATGGGGAAGTTGG + Intergenic
1168854707 20:1000660-1000682 CAGTTGGTAACTGGGGAAGCTGG + Intronic
1168978555 20:1986236-1986258 CAGTGAGTAAGTGGCAAAGCTGG + Intronic
1169414808 20:5406783-5406805 CAATGAGGAAGAGGGGAAGCGGG - Intergenic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1171140112 20:22733732-22733754 CTGTGAGCAATTGGAGAAGAAGG - Intergenic
1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG + Intronic
1172876738 20:38169055-38169077 CAGTCAGGAAGTGGGAAAGCAGG + Intergenic
1172883844 20:38218422-38218444 CTGCAAGGAAGTGGGGGAGCTGG - Intronic
1173308633 20:41875648-41875670 CAGTGAGGAAGCGGTGAAGCAGG - Intergenic
1173799591 20:45886765-45886787 CTCTGAGGCAGTGGGGAAGGAGG - Exonic
1175048682 20:56132414-56132436 CTGAGATTAATTGAGGAAGCGGG - Intergenic
1175113339 20:56664465-56664487 CTGTGGGTAAGAGTGGAAGCCGG + Intergenic
1175890183 20:62312533-62312555 CTGTGGGGAAGCGGGGATGCGGG + Intronic
1176251080 20:64120257-64120279 CTGTGAGTAGGACGGGAGGCTGG + Intergenic
1176257824 20:64161596-64161618 CTTTGTGTGAGTGGGGGAGCAGG - Intronic
1176378759 21:6101344-6101366 CTGCAAGGAAGTGGAGAAGCCGG - Intergenic
1177418765 21:20828042-20828064 CTGTGAGCAAGTGGGGTAGAGGG + Intergenic
1179744716 21:43436893-43436915 CTGCAAGGAAGTGGAGAAGCCGG + Intergenic
1180068839 21:45426026-45426048 CTGTGAAAAGGTGGGGAAGCAGG - Intronic
1180196065 21:46195017-46195039 CTGGGAGACAGTGGGGCAGCTGG + Intronic
1180218769 21:46344610-46344632 CTGTGAGCAAGTGGGTCACCTGG + Intronic
1180900655 22:19369547-19369569 CTCTGAGGAAGTGGGGGACCTGG + Intronic
1183561034 22:38573077-38573099 TTGTGGGTAAGTGGGGAACATGG + Intergenic
1183633313 22:39046295-39046317 CTGTGAGGAGGTGGGGATGAGGG + Intronic
1183689986 22:39382991-39383013 CGGTGAGTGAGTGGCAAAGCTGG + Exonic
1184266024 22:43346523-43346545 CTGTGCCTCGGTGGGGAAGCTGG + Intergenic
1184462318 22:44646131-44646153 CTGTAAGGAAATGGGGAGGCGGG - Intergenic
949385195 3:3494129-3494151 ATGTGAGTATGTGTGTAAGCAGG + Intergenic
949385472 3:3497300-3497322 CTGTGAGTATGTGGCTGAGCTGG - Intergenic
949396799 3:3623046-3623068 CAGTGAGGAAGTGGGGAAAGTGG - Intergenic
949483006 3:4511709-4511731 CAGTGAGTAAGTGGCAGAGCTGG + Intronic
949585559 3:5433450-5433472 CAGTGAGTAAGTGTTGAAGCTGG + Intergenic
949861030 3:8504925-8504947 CAGCTAGTAAGTGGGGGAGCTGG - Intronic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
950013259 3:9738751-9738773 TTGTGAGAAAGTGGTGGAGCTGG - Intronic
950099259 3:10347083-10347105 CTGAGACCAAGGGGGGAAGCAGG - Intronic
950931179 3:16790477-16790499 CTGTAAGAATTTGGGGAAGCAGG - Intergenic
950931998 3:16799381-16799403 CTGTGAGGAAGTTGGAGAGCAGG - Intergenic
951549067 3:23858784-23858806 TTGTGAGAAAGTGGGGAGGAGGG - Intronic
953313134 3:41900038-41900060 ATGTGAGTATGTTGGGGAGCTGG + Intronic
955525553 3:59816150-59816172 CTGTGAGACTGTGGGCAAGCTGG + Intronic
956437411 3:69247281-69247303 CTGGGGCTAAGTGGGGAAGGTGG + Intronic
957962891 3:87281481-87281503 CATTCAGTAAGTGGTGAAGCTGG + Intergenic
959917774 3:111837020-111837042 CTCACAGTAAGTGGTGAAGCAGG - Intronic
961398940 3:126620582-126620604 ATGTGAATAACTGGGGAATCTGG + Intronic
961635787 3:128331478-128331500 CATTGAGGAAGTGGGGAAGAGGG - Intronic
964171587 3:153776585-153776607 TTGTGAGGATGTGGGGAAACTGG - Intergenic
964878061 3:161392377-161392399 GTGAGTGTGAGTGGGGAAGCTGG + Intergenic
964886708 3:161491853-161491875 CTGTGTTTAAATCGGGAAGCAGG + Intergenic
965074354 3:163957562-163957584 TTGTGAGTAAGTGGGGAAGCAGG - Intergenic
966508343 3:180732296-180732318 CAGTTAGTAAGTGGTGAAGATGG + Intronic
966890499 3:184404344-184404366 CTGTTAGTAAGTGGCTGAGCTGG + Intronic
967120340 3:186377268-186377290 CAGTGACTAAGTGGTGGAGCTGG + Intergenic
968065372 3:195755885-195755907 GTGTGTGTAAGTGGTGAAGGAGG + Intronic
969145777 4:5123085-5123107 CTGTGGGGAGGTGGGGAAGTTGG - Intronic
969405857 4:6991374-6991396 CGGCGGGCAAGTGGGGAAGCTGG - Intronic
970276875 4:14410611-14410633 CTCTCAGCAAGTGGGAAAGCTGG + Intergenic
970899759 4:21145169-21145191 CTGTGAGTAGGTGGAGTTGCAGG - Intronic
972774444 4:42228327-42228349 ATGTGATGAAGTGGAGAAGCAGG - Intergenic
972944646 4:44239337-44239359 CAGCCAGTAAGTGGGCAAGCTGG - Intronic
974945342 4:68520510-68520532 TTGTGAGTAAATTGGGAAGGAGG - Intergenic
974955274 4:68631928-68631950 TTGTGAGTAAATTGGGAAGGAGG - Intronic
975855207 4:78617378-78617400 CTGTCAGTATCTGGGAAAGCAGG - Intergenic
976512888 4:85931235-85931257 CTGTGAATAGGTGGGGTAGGTGG + Intronic
976745465 4:88398927-88398949 CTGTTAGTAAGTGGTAGAGCTGG + Intronic
977969208 4:103193095-103193117 CTTAGAGTAAGTGGGTAGGCTGG + Intronic
979749537 4:124261192-124261214 CTGTGAGAATGTGGGGCAACTGG + Intergenic
980693729 4:136329172-136329194 TTGTGAGCCAGTGGGGAAGTGGG + Intergenic
980807142 4:137828316-137828338 CAGAGAGGAAGTGGGGAAGGAGG + Intergenic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
986325322 5:6668796-6668818 CTGTGTGTAAGTGGAGAACTTGG + Exonic
986593403 5:9394613-9394635 CTGGGAGGAGGTGGGGGAGCAGG + Intronic
986760911 5:10878868-10878890 CAGTCAGGAAGTGGAGAAGCTGG + Intergenic
987575390 5:19721891-19721913 TTGTGATTAAGTTGGGAAGGTGG + Intronic
988414264 5:30926213-30926235 TTGTGAGGAAGTAGGGAAGAGGG - Intergenic
990228283 5:53681700-53681722 CTATAAGGAAATGGGGAAGCAGG - Intronic
990673444 5:58158311-58158333 ATGTCAGTAATAGGGGAAGCTGG - Intergenic
992011960 5:72537346-72537368 CAGAGATTAAGTGGCGAAGCTGG + Intergenic
997144313 5:131415861-131415883 TTGTGTGTAAGTTGGTAAGCTGG + Intergenic
997230068 5:132235819-132235841 CTGTGGGTGAGTGGGGGAGAAGG + Intronic
999395234 5:151223087-151223109 CTGTGAGGCAGAGGGGAAGAAGG - Intronic
999514203 5:152284642-152284664 CTGTGAGGCAGTAAGGAAGCAGG + Intergenic
1000115511 5:158149911-158149933 CTGTGAGGATGTGAGGATGCAGG + Intergenic
1001404070 5:171463173-171463195 CAGTTATTAAGTGGTGAAGCTGG + Intergenic
1001778421 5:174346711-174346733 CGGAGAGCAAGTGGGGAGGCAGG - Intergenic
1002168971 5:177364677-177364699 GTGGGAGATAGTGGGGAAGCTGG + Intronic
1002372741 5:178767992-178768014 CTGTGAGTCAGGGGGTAAACAGG + Intergenic
1002784805 6:392739-392761 CTGCGAGTGAGTGCGGAAGGAGG + Intronic
1003944873 6:11065682-11065704 CTGTGAGGGAGTGAGGAAGCAGG - Intergenic
1004308491 6:14522699-14522721 AGGTGAGGAAGTGGGGAGGCAGG - Intergenic
1004433533 6:15567853-15567875 CAGCTAGTAAGTGGTGAAGCAGG - Intronic
1006381005 6:33697151-33697173 CTCTGAGTCAGTGGGGATGAGGG + Exonic
1006612197 6:35300912-35300934 CTGATAGTCAGTGGGGAAGGAGG - Intronic
1006690057 6:35875581-35875603 CTGAAAGTAAGTGTGGAGGCAGG + Intronic
1007013588 6:38441006-38441028 CTGTGGAGAAGTGGAGAAGCTGG + Intronic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1008058928 6:46976290-46976312 CAGTTAGTAAGTGATGAAGCTGG + Intergenic
1008357014 6:50566584-50566606 CAGTTAGCAAGTGGTGAAGCTGG - Intergenic
1008625065 6:53307307-53307329 CAGCTAGTAAGTGGTGAAGCAGG - Intronic
1008700975 6:54098923-54098945 CTGCTATTAAGTGGGAAAGCTGG + Intronic
1009960564 6:70515817-70515839 ATGTAAATAAGAGGGGAAGCTGG + Intronic
1011832989 6:91395806-91395828 CTGTGTGTGACTGGGGAGGCAGG + Intergenic
1011971906 6:93236004-93236026 CTGTGATGGACTGGGGAAGCAGG - Intergenic
1014281181 6:119444008-119444030 CTGTGAGAAGGTGGTTAAGCTGG + Intergenic
1015590037 6:134814345-134814367 CTGGAAGGAAGTGAGGAAGCAGG + Intergenic
1016944457 6:149515705-149515727 TAGTGGGTAAGTGAGGAAGCAGG - Intronic
1019040227 6:169097916-169097938 CTGTGAGTCAGCGGGGACTCAGG - Intergenic
1019503248 7:1376146-1376168 CTGTAAGGAGGTGGGGATGCCGG - Intergenic
1019509251 7:1409099-1409121 CCGTGAGTGATTGGGGCAGCTGG + Intergenic
1020193964 7:6022693-6022715 CTGTGAGCATTTGGGGAAGGGGG + Exonic
1021292128 7:18858867-18858889 CTGTGAGTTAGAAGGGAAGTAGG - Intronic
1021437071 7:20630707-20630729 GTGTGAGTAAATGGGCAACCTGG + Intronic
1021796973 7:24265594-24265616 CTGGGAGAAAGTGTGGAACCAGG - Intergenic
1026848533 7:73710940-73710962 CTGAGAAAAAGTGGGGAAGCAGG + Intronic
1026879516 7:73899910-73899932 CTGTGAGTCAGTGGGGCAGATGG - Intergenic
1027629148 7:80580626-80580648 CTGTGAGTTAGTGGGGGACCAGG + Intronic
1028516955 7:91688261-91688283 CTGGTAGAAAGTGAGGAAGCAGG + Intergenic
1028896384 7:96046532-96046554 TAGTGAATAAGTGGGGAAACTGG + Intronic
1031664893 7:124471912-124471934 CTGTCAATAACTGGGAAAGCAGG - Intergenic
1031976247 7:128095410-128095432 CTGTGAGCAGGTGGGGAAGAAGG + Intergenic
1033420475 7:141200613-141200635 CAGTGAGAAAGTGGTGATGCCGG + Intronic
1033705647 7:143882906-143882928 CTGGGAGGAAGTGGGGAGGAGGG - Intronic
1034560557 7:151877046-151877068 CTGTGCCCAAGTGGGGAATCTGG + Exonic
1035023108 7:155810131-155810153 CCGGGAGTAAGTGGGGCTGCAGG + Intronic
1035153864 7:156896547-156896569 AAGTGAGGAAGTGGGGAAGAGGG + Intergenic
1037434012 8:18843948-18843970 CTGTCAGGAAATGGGCAAGCTGG + Intronic
1037505427 8:19524786-19524808 CTGTCATTGAGCGGGGAAGCTGG - Intronic
1038300832 8:26346082-26346104 CTGTGAATGGGTGGGGAAGGTGG - Intronic
1042802176 8:72731144-72731166 GAGTGAGTGAGTGGGGAAGATGG + Intronic
1043478068 8:80624830-80624852 CAGTTAGTAAATGGTGAAGCTGG + Intergenic
1047268182 8:123328728-123328750 CTGTGAGAAGGTGGAGAAGTGGG + Intronic
1047785173 8:128147208-128147230 CTGTGAGTGAGCTTGGAAGCAGG - Intergenic
1048270273 8:133022692-133022714 CTAGGAGTCAGTGGGGAAGATGG - Intronic
1051506527 9:17832885-17832907 CTGTGAGCATGTGGCAAAGCTGG - Intergenic
1052319327 9:27150698-27150720 CTGTGAGGCAGTGGGGGTGCAGG - Intronic
1053414916 9:37941422-37941444 CTGTTAGTATGTGGCGGAGCTGG + Intronic
1054910614 9:70451970-70451992 CTGAGCTTAAGTGTGGAAGCTGG + Intergenic
1055383056 9:75730116-75730138 TGGTGAGAAAGTGGGGAAGTGGG + Intergenic
1055730664 9:79276752-79276774 CTGCTAGTAAGTGGTGAAGCTGG + Intergenic
1056941873 9:90962855-90962877 CTTTGAGTAAGAGGGCAAGATGG - Intergenic
1057312223 9:93949642-93949664 CTGTGGGTCAGTGGGGAAGTTGG - Intergenic
1059456171 9:114401674-114401696 CAGCAAGGAAGTGGGGAAGCAGG - Intergenic
1059635167 9:116163278-116163300 CTGTGTGGGAGTGGGGATGCAGG + Intronic
1062312671 9:135947676-135947698 CTGGGAGGATTTGGGGAAGCCGG - Intronic
1062381464 9:136288803-136288825 CTGTGAGGAAGTGGGGAGATGGG + Intronic
1062448257 9:136604738-136604760 CAGCAAGTCAGTGGGGAAGCTGG + Intergenic
1186373371 X:8969656-8969678 CTGCTACTAAGTGGGGAAACTGG - Intergenic
1186580394 X:10811468-10811490 CAGTGTGTAAGTGGAGAAGCTGG + Intronic
1189974567 X:46448260-46448282 CTGAGACTAAGTGAGGAAGCTGG - Exonic
1190246972 X:48697016-48697038 CTGGGGCTAAGTGGGGACGCAGG + Intronic
1191665438 X:63697472-63697494 CAGTGAGTAATTAGGAAAGCTGG + Intronic
1192035363 X:67557136-67557158 GTGGGAGCAAGGGGGGAAGCAGG + Intronic
1192593912 X:72386733-72386755 CAGCTAGTAAGTGGTGAAGCTGG + Intronic
1193344310 X:80387780-80387802 CAGTAAGCAAGTGGCGAAGCTGG + Intronic
1194247773 X:91537117-91537139 CTGTGAGGAGCTGTGGAAGCGGG - Intergenic
1194278841 X:91922323-91922345 CAGTTAGTAAGTGGTAAAGCTGG + Intronic
1194808897 X:98365508-98365530 CTGGGAGTAATTGGGAGAGCTGG + Intergenic
1195976758 X:110535353-110535375 ATCTGAGTAAGTAGGGAAGTTGG + Intergenic
1196786317 X:119424412-119424434 TAGTAAGTAAGTGGCGAAGCTGG + Intronic
1197885509 X:131213615-131213637 CTGTGTGTGAGTGTGGAGGCGGG - Intergenic
1198428228 X:136540863-136540885 CTGTTAGTAAGTGATGGAGCTGG - Intronic
1198705964 X:139448321-139448343 CTGTGTGTAAGTGGAGAACTTGG + Intergenic
1199296717 X:146167554-146167576 CTGTGAGTAAGTGTGAAAACTGG + Intergenic
1199383044 X:147192812-147192834 CTATGAGTAAAATGGGAAGCAGG + Intergenic
1200123538 X:153802581-153802603 CTCTGAGTCACTGGGGAAACAGG + Exonic
1200566791 Y:4778646-4778668 CTGTGAGGAGCTGTGGAAGCGGG - Intergenic
1200596320 Y:5145824-5145846 CAGTTAGTAAGTGGTAAAGCTGG + Intronic
1202166690 Y:21996659-21996681 CAGTGAGTAACTGAGTAAGCAGG + Intergenic
1202224669 Y:22589714-22589736 CAGTGAGTAACTGAGTAAGCAGG - Intergenic
1202318445 Y:23605946-23605968 CAGTGAGTAACTGAGTAAGCAGG + Intergenic
1202552322 Y:26064111-26064133 CAGTGAGTAACTGAGTAAGCAGG - Intergenic