ID: 1153361463

View in Genome Browser
Species Human (GRCh38)
Location 18:4202340-4202362
Sequence CTGGAGCCTCAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 6, 3: 75, 4: 452}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153361463 Original CRISPR CTGGAGCCTCAGAATGAGGA AGG Intronic
900954492 1:5878118-5878140 CTGGTGCCAGAGAGTGAGGAAGG - Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
902173736 1:14633729-14633751 CTGAATCCTCAGAGAGAGGATGG - Intronic
903058651 1:20654324-20654346 CTGGAGCCCAGCAATGAGGAGGG + Exonic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903976493 1:27153826-27153848 CTGGAGCCTGAGAAGGACCAAGG + Intronic
904377235 1:30089639-30089661 CTGGGGGCTCAGAGTCAGGAGGG + Intergenic
905287417 1:36890575-36890597 CTGGTGGCTCAGTATGTGGAGGG + Intronic
905477546 1:38239495-38239517 CTGGAGCCTCAGAACCAAGGTGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
907651207 1:56296424-56296446 ATTGAGGCTCAGATTGAGGAAGG - Intergenic
910427504 1:87131831-87131853 CTGGAACCTCAGACTTAGGCTGG - Intronic
910493163 1:87795392-87795414 CTGGAGGCTCAGAACCAGCAAGG - Intergenic
910624576 1:89292858-89292880 CTGGTGCCTCTCAATGTGGATGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
912262221 1:108121634-108121656 CAGGAGCCTCAGGAAGGGGAGGG + Intergenic
913536229 1:119775316-119775338 CTGGAGCCTGAGGTGGAGGATGG + Intergenic
914220728 1:145679607-145679629 CTGGTGCAACAGAATGAGCATGG + Intronic
914473305 1:148002480-148002502 CTGGTGCAACAGAATGAGCATGG + Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915347219 1:155203637-155203659 CTGGAGCCCCAGAATAAAGATGG + Intronic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915723385 1:158000486-158000508 CTGGAGCTACAGAATGGAGAGGG - Intronic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916662750 1:166937046-166937068 CTGTAGCATCAGAATAAGGATGG + Intronic
916967951 1:169972590-169972612 CTGGAGCCTCTGAATAAAAATGG + Exonic
917345233 1:174022365-174022387 CCGGAGCCTGAGGAAGAGGAAGG - Intergenic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
920183356 1:204146206-204146228 CAGGGCCCTCAGAATGAGGTGGG - Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
921144487 1:212340193-212340215 CTGGATCCTCAGGAAGAGGATGG - Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
922536733 1:226386510-226386532 CTGGAGGCTCAGCATGACCAGGG - Intronic
922822322 1:228493140-228493162 CAGGAGGCTGAGAAGGAGGAGGG + Exonic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923655261 1:235910424-235910446 CAGGGGCCACAGAATGTGGATGG - Intergenic
1062947291 10:1471257-1471279 GTGGAGCTTCAGAAGGAGAACGG - Intronic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1065200008 10:23303875-23303897 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1065641365 10:27785986-27786008 CTGAGACCTCAGAATGTGGAGGG + Intergenic
1067065413 10:43101563-43101585 CTGGAGGCTCAGGATGAAGAGGG - Intronic
1067156584 10:43786080-43786102 CAGGAGCCTCACTCTGAGGACGG + Intergenic
1067470147 10:46530674-46530696 CTGTTGTCTCAGAATGCGGATGG - Intergenic
1067550337 10:47229835-47229857 TTGGAAACTCAGAATCAGGAAGG - Intergenic
1067766979 10:49094196-49094218 CTGGAGCCTCAGAAGCAGTGGGG + Intronic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1069541484 10:69297508-69297530 CAGGACTCTCACAATGAGGAGGG + Intronic
1069550811 10:69362748-69362770 CTGGAGCCTCCGAGTGCAGATGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070560243 10:77560871-77560893 CTGGAGCCTCAGCTTGAAGAAGG - Intronic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1072039064 10:91590482-91590504 CTGGACCCGCAGGATGGGGAGGG + Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1072434673 10:95404179-95404201 CTGGGGCCAGAGAATGAGGTGGG + Intronic
1072617957 10:97062326-97062348 CAAGAGCCTCACACTGAGGAGGG + Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1074520956 10:114223414-114223436 CTGGAGCCCAAGATTGAGGAAGG - Intronic
1074704975 10:116122447-116122469 CTAGGGCCTCAGGCTGAGGAAGG - Intronic
1075393733 10:122112570-122112592 CAGGAGCCTCAGAAAGAAGCTGG - Intronic
1075690424 10:124390261-124390283 CTGGAGGCTCAGAGAGCGGAAGG - Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1075804722 10:125178242-125178264 CTGGTGTCTCAGACTGAAGAGGG + Intergenic
1076457445 10:130610443-130610465 CTGGAGCCTGAGGATGGGGCAGG - Intergenic
1076921813 10:133458280-133458302 CCTGAGCCTCAGACTGCGGAAGG - Intergenic
1078294225 11:10049923-10049945 AATGAGCCTCAGAATCAGGAAGG + Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1080230230 11:30012191-30012213 CTGCTGCCTCAGGATGAGGGCGG - Exonic
1080863144 11:36167996-36168018 CGGGAGTCTAAGAAAGAGGAGGG - Intronic
1081048702 11:38310546-38310568 CTAGAGCCTCAGAAGGAGCGTGG + Intergenic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082820401 11:57541037-57541059 CTGGAGCCGCTGAACCAGGAAGG + Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083826216 11:65205463-65205485 CTGGAGCCTCTGACTCAGAATGG + Intronic
1084216389 11:67648954-67648976 CTGGAGCCTCAGCAAAGGGAGGG + Intronic
1084316271 11:68347650-68347672 CAGGAGCCTCTGAATGATGCGGG + Intronic
1084547301 11:69820801-69820823 CTGGAGCCTCAGACTCTTGATGG + Intergenic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084963652 11:72732185-72732207 ATAGAGCCTGAGAATGAGAAAGG + Intronic
1084974618 11:72790008-72790030 CTGCTGCCTCAGACTGATGAAGG + Intronic
1085254066 11:75162481-75162503 CTGTGACCTAAGAATGAGGAAGG + Intronic
1085336752 11:75702388-75702410 CAGGAGCCAGGGAATGAGGAGGG + Intergenic
1086445602 11:86867546-86867568 CTAGGGTCTCAGAAGGAGGATGG - Intronic
1090051126 11:123380832-123380854 CTCCAGTCCCAGAATGAGGAGGG - Intergenic
1090627768 11:128620926-128620948 CTGGAGCCTCGCAGAGAGGAGGG - Intergenic
1090860822 11:130650963-130650985 CTGTGGACTCAGAATTAGGATGG + Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091747032 12:2999235-2999257 CTGGGGGCTCAGAATGGGGCTGG - Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093179878 12:15954654-15954676 CTGGGGCTTGAGAATGAGGAAGG + Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1096411492 12:51379872-51379894 CTGGGGCCTCAGCCTGAGAAAGG + Exonic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG + Intergenic
1098172625 12:67762238-67762260 CTGTAGCCTGAGACTAAGGAGGG + Intergenic
1099049875 12:77768755-77768777 CTGCAATCTCAGAATGAGGTAGG + Intergenic
1099344044 12:81475815-81475837 CTGGAGGCTGAGAAGGAGAATGG - Intronic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100236676 12:92668568-92668590 CTGGAGCTTCAGAATTCAGAAGG + Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1102123169 12:110458978-110459000 CTGGAGGCTGAGGGTGAGGAAGG - Intronic
1103333292 12:120169953-120169975 CTGGAGCAACAGAATGAAGGAGG + Intronic
1103728023 12:123008511-123008533 CTGAAGCCTCAAAATGGGAATGG - Intronic
1103841603 12:123869706-123869728 GAGGAGCCTGAGAAGGAGGAAGG - Intronic
1104010935 12:124929475-124929497 CAGGTGCCTCAGAGTGAGTAAGG + Intergenic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106456803 13:29934981-29935003 CTGCAGGCTCAGAAAGAGGCAGG + Intergenic
1106662489 13:31814512-31814534 CTGGAGCCTCCATATGTGGAAGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108238419 13:48434475-48434497 CTGGAGCTTCCTAATGGGGAAGG - Intronic
1108493230 13:51001375-51001397 CTGGAGCCTGAGAAGCAGGTTGG + Intergenic
1108493832 13:51005489-51005511 ATGGAGCCTGAGAAAGAGGAGGG - Intergenic
1109076896 13:57846945-57846967 CGTGAGCCTCAGAATCATGATGG + Intergenic
1110171845 13:72510611-72510633 CCGGAGCTTCAGATTGAGGTGGG - Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111959529 13:94794721-94794743 CTGGACCCTCACACTGATGATGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1114451719 14:22830794-22830816 CTGGAGTCTCATAAGGAGAATGG - Intronic
1115360987 14:32502031-32502053 GAGGAGCTTCAGTATGAGGAAGG - Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1118156605 14:63248683-63248705 GTGGAGCCACAGAATGAACAAGG + Intronic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1119325012 14:73754683-73754705 CTGGGGCCTCAGACAGAGGAAGG + Intronic
1119342696 14:73893897-73893919 CTGAAGCCTCAGAATGCAGTCGG + Exonic
1119896073 14:78220902-78220924 CTGTGGCATCTGAATGAGGAAGG + Intergenic
1119956359 14:78802618-78802640 CGGTAACCTCAGACTGAGGAAGG + Intronic
1121496410 14:94394599-94394621 CTGGAGTCTAACACTGAGGAGGG + Intergenic
1121507795 14:94489885-94489907 CTCCATCCACAGAATGAGGAGGG + Intronic
1123674063 15:22690641-22690663 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG + Intronic
1124326071 15:28763633-28763655 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1124339267 15:28879506-28879528 CAGGAGGCTGAGAATGAGGGAGG + Intergenic
1124422230 15:29532986-29533008 CTGGAGCCTCTACAGGAGGAAGG + Intronic
1126382147 15:48059960-48059982 CTGGAGTCTCAGGACGGGGAGGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127361220 15:58246641-58246663 GTGGAGCCTCAGGCTCAGGAAGG + Intronic
1128131451 15:65229778-65229800 CTGGAGCATCATTCTGAGGATGG + Intergenic
1128500411 15:68223308-68223330 CTGGAGCCAGAGAAAGAGAAGGG + Intronic
1130064476 15:80592748-80592770 GTGGGGCCTCAGAATGGGCAAGG - Intronic
1130147365 15:81284353-81284375 CTGGAGCTTCTGAATTAGAAAGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1131923001 15:97350886-97350908 CTGCAGCTTCAGCATGAGGCCGG + Intergenic
1132819928 16:1859910-1859932 CTGGAGCCTCAGCAGGAGCCGGG - Intronic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133018028 16:2953917-2953939 CTGGGGCTTCAGTATGGGGAAGG - Intergenic
1133358964 16:5158465-5158487 CGGGAGCAAGAGAATGAGGAGGG - Intergenic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133898697 16:9953034-9953056 CTTGAGCTTGAGTATGAGGAAGG + Intronic
1134437030 16:14269067-14269089 CTGCATCCTCACAAAGAGGAAGG + Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135632434 16:24046682-24046704 CTGGAGCCTCGGGATGGGGAGGG + Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136062819 16:27738261-27738283 CTGGAGCCAGGGAAGGAGGAAGG + Intronic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1136995874 16:35187821-35187843 CTGGAGCCTCAGAGCCAGGTGGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138341265 16:56290521-56290543 CTGGAGACCCAGAATGAGTTTGG + Intronic
1139532622 16:67550110-67550132 ATGCAGCCTCAGCATGTGGATGG - Intergenic
1139699692 16:68700474-68700496 CTGAAGCCTCAGACTTTGGATGG + Intronic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1140420826 16:74817450-74817472 CTGGTGCCTTAGAAGGTGGATGG + Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141286379 16:82676329-82676351 ATGGTGCCACAGAATGAGGTAGG - Intronic
1141405942 16:83793132-83793154 CAGAAGCCTGAGAGTGAGGAAGG + Intronic
1141497332 16:84419251-84419273 CTGGAGCCTCTGCAGGAGCATGG - Intronic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142112192 16:88338862-88338884 CTGGAGCCTCAGGAGGAGCGTGG + Intergenic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1143642638 17:8207834-8207856 ATGGAGCCTGAGAAGGAGCAGGG + Exonic
1143974042 17:10816873-10816895 CTGCAGCCTCAGAGATAGGAGGG + Intergenic
1144619652 17:16809331-16809353 CTGGAAGCTGAGCATGAGGAAGG - Intergenic
1144893033 17:18506373-18506395 CTGGAAGCTGAGCATGAGGAAGG + Intergenic
1145139184 17:20437919-20437941 CTGGAAGCTGAGCATGAGGAAGG - Intergenic
1146376114 17:32295624-32295646 TTGGTGCCTCAGGGTGAGGAAGG + Intronic
1146583105 17:34057512-34057534 CTGGAGCTTTAGTAGGAGGACGG + Intronic
1147916205 17:43888422-43888444 ATGGAGCCCCAGAGTGAGGGAGG + Intronic
1148044961 17:44737927-44737949 CTGGAGCCTCAGGATACTGAGGG - Intronic
1148087647 17:45004091-45004113 CTGGTGCCTCAGCATGAGGCCGG + Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148805037 17:50259700-50259722 CTGGGGCCACAGAGTGGGGAGGG - Intergenic
1148858033 17:50589781-50589803 CTGGAGCCTCAGCCTGAGCCCGG - Intronic
1148953875 17:51337438-51337460 CAGAAGCCTCAGAATCAGGGAGG - Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1150194538 17:63281931-63281953 CTTGAGCCTCAGAGGGAGCATGG + Intronic
1150351611 17:64449232-64449254 TTCGAGCCTCAGAATGATAAGGG - Intronic
1151019339 17:70595997-70596019 TTAGAGTCTCAGAATGAGGTGGG + Intergenic
1152256535 17:79243276-79243298 CTGGAGTGTCAGAGTGAGCAGGG + Intronic
1152324348 17:79626977-79626999 CTCGAGCCTCAGAATGAAACAGG + Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153727671 18:7974089-7974111 GTGGAGCCTGAGAATGTGGCAGG + Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156360221 18:36378183-36378205 CTGCAGCCTCAGCATGAGATGGG + Intronic
1156490916 18:37495523-37495545 CTGGAGCCTCAGATGGGGCATGG - Intronic
1156874889 18:41997734-41997756 CTTGAGCCTCAGAAAGATTAGGG + Intronic
1157775159 18:50388772-50388794 CTTGAGCATCAGCAAGAGGAAGG - Intronic
1158795381 18:60839546-60839568 AGGGAACCACAGAATGAGGATGG + Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1159550041 18:69885460-69885482 GAGAAGCCTCAGAAGGAGGAAGG + Intronic
1159626842 18:70704999-70705021 TTGGAGCCTCAGGGTCAGGAAGG + Intergenic
1160213815 18:76908492-76908514 CTGGAGCCTCAGCATGTGGTGGG + Exonic
1160345550 18:78129120-78129142 CTGGAGCCCCAGAAGCTGGAGGG + Intergenic
1160462033 18:79046667-79046689 CTGGAGCGACAGCATGAGAAGGG + Intergenic
1160525762 18:79534604-79534626 CGCCAGCCTCAGAATGAGGTGGG + Intergenic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163438871 19:17311532-17311554 CAGGGGCCTCAGGGTGAGGAGGG - Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164884866 19:31769947-31769969 CCGGAGCCTTAGGATGAAGATGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1166714897 19:44960723-44960745 CTGGAGCCTCAGAGGGAAGTGGG + Intronic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
925315799 2:2922188-2922210 CTGGAGGGTCAGCATGAGGCTGG - Intergenic
926309155 2:11662083-11662105 CTGGAGCTGCTGAGTGAGGAGGG - Exonic
926408712 2:12579988-12580010 CTGGAGCCTAAGAGTGAATAAGG + Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
930190093 2:48449301-48449323 CAGTAGCCTCAGAAGAAGGAAGG + Intronic
930539442 2:52686754-52686776 CTGGAGTCTCAGAATGGGGGAGG + Intergenic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931263237 2:60638345-60638367 CTGGAGTCCCTGCATGAGGAGGG + Intergenic
931671113 2:64648707-64648729 CTGGAGCTTTAGAAGGAGGCAGG + Intronic
931848837 2:66233013-66233035 CTTGGTCCTCAAAATGAGGAGGG + Intergenic
932499762 2:72173505-72173527 CTGGAGCTTTGGAAAGAGGAAGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934165385 2:89289637-89289659 CTGGAGCCTCTGAAGGAGCCTGG - Intergenic
934201889 2:89892825-89892847 CTGGAGCCTCTGAAGGAGCCTGG + Intergenic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
934476541 2:94597282-94597304 TTGGAACCTCAGAAGCAGGAGGG + Intronic
935706301 2:105860476-105860498 TAGGCGTCTCAGAATGAGGAGGG + Intronic
935752128 2:106245015-106245037 CTGGAGACTCACAATCAGAAAGG - Intergenic
935912540 2:107912562-107912584 CTGGAGACTCACAATCAGAAAGG - Intergenic
936046676 2:109193959-109193981 CTGGTGCCCCAGAAGGAGCATGG - Intronic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936394877 2:112117838-112117860 CTAGAGCCACATAATGAGTAGGG - Exonic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936853994 2:116935111-116935133 ATGGGGCCTAAAAATGAGGAGGG + Intergenic
938051303 2:128174805-128174827 TTGGATCCTCAGACTTAGGAAGG + Exonic
939489291 2:142857467-142857489 CTGGAGGCTGAGGAGGAGGATGG + Intergenic
940206274 2:151205320-151205342 CTGGATCCCCAGAATCAGGTAGG + Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
942074561 2:172344733-172344755 CTGGTGTCTCAGAATAAGAAGGG - Intergenic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
946536956 2:220640937-220640959 CTGGAGTCTCTGAAGGAGTAAGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947569032 2:231216553-231216575 AAGGAGCCTCAGAGAGAGGATGG + Intronic
947750341 2:232528798-232528820 CTGGGGCCACAGAGTGGGGAAGG - Intronic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948907632 2:240987249-240987271 CTGGAGCCTGAGGAGGGGGAGGG + Intronic
948917520 2:241042897-241042919 CTGGAGTCTGCGAAGGAGGATGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1170589745 20:17762741-17762763 CAGGAGCCTTGGAAGGAGGAGGG - Intergenic
1170693556 20:18636966-18636988 CTGGAGTGTCTGGATGAGGAAGG + Intronic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172405705 20:34687323-34687345 CTTGGGTCTCAGATTGAGGAGGG - Intergenic
1172612544 20:36262586-36262608 CTGGTGCTCCAGACTGAGGAAGG - Intronic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173858509 20:46266853-46266875 CTGGAGCCCCAGATTCAGTAAGG + Intronic
1175176596 20:57116080-57116102 CTGGAGCCTGGGAATGCGGGAGG - Intergenic
1175315837 20:58045982-58046004 ATGGGGCCTCAGGAGGAGGAAGG - Intergenic
1176079680 20:63266006-63266028 CTGGGGTCTCAGGATGAAGACGG + Intronic
1176292748 21:5054991-5055013 CTGGATCCTCAGGATGTGGATGG - Intergenic
1177009102 21:15709841-15709863 CAGGATCCTGAGAATGAGGTTGG - Intergenic
1177267710 21:18805880-18805902 TTCGAGTCTCAGAATGGGGAGGG + Intergenic
1177386327 21:20413580-20413602 CTGGAACCTAAGGATGAAGAGGG - Intergenic
1178746068 21:35251442-35251464 CTTAAGCCATAGAATGAGGATGG - Intronic
1179043132 21:37822491-37822513 CTGAAGCCTCTGAATGGGTACGG + Intronic
1179864512 21:44208659-44208681 CTGGATCCTCAGGATGTGGATGG + Intergenic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1181322927 22:22022619-22022641 CTGCAGCCTGAGGAGGAGGAAGG - Intergenic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1183545442 22:38452806-38452828 CTGGCCCCTCAGAGTGAGGAGGG - Intronic
1183896958 22:40977159-40977181 CTGGAGCCTCAGAACCAGGAGGG + Intergenic
1184509737 22:44926432-44926454 CTGGGGCATCTGAGTGAGGACGG - Intronic
1185364526 22:50431296-50431318 GTGGAGCCTCCGCATGAGAACGG + Exonic
950400296 3:12764634-12764656 CTGGAGGCCCAGGATGAGTAAGG - Intronic
950413050 3:12851378-12851400 GTGGAGCCACAGAATGGGGGAGG + Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951932325 3:27982180-27982202 CAGGAGCATCAGTGTGAGGAAGG - Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952314635 3:32221938-32221960 CTGAAGCCTCAGCTTCAGGAAGG + Intergenic
953278927 3:41533108-41533130 TGGGAGCCTCAGTATGGGGAGGG - Intronic
954245046 3:49324732-49324754 ATTGAGCCTCAAAATGAAGATGG - Exonic
954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG + Intronic
954661435 3:52228949-52228971 CTGGAGCCCAGGAAGGAGGATGG + Exonic
954834695 3:53455602-53455624 GTGGAGCTGCATAATGAGGATGG - Intergenic
955088772 3:55729072-55729094 CTGCAGCCTCAGAACAGGGAGGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
957963289 3:87288738-87288760 CGGAGGCCTCAGAATGATGAGGG - Intergenic
958772630 3:98443984-98444006 CTGGTGCCTGAGTATGAGGATGG + Intergenic
959591949 3:108091151-108091173 CTGGAGCCTGCGACTGGGGAGGG - Intergenic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960258041 3:115532787-115532809 CTGGAACATGTGAATGAGGATGG - Intergenic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961716486 3:128861181-128861203 GTGGAGCCACAGAATGCGGGAGG - Intergenic
961791864 3:129382086-129382108 CTAGAACCTCAGATGGAGGAAGG + Intergenic
961805209 3:129484200-129484222 GTGGAGCCACAGAATGGGGGAGG + Intronic
961805887 3:129489045-129489067 CTAGAACCTCAGATGGAGGAAGG + Intronic
962464375 3:135643005-135643027 TTGGAGTCTCACAATGAGGCGGG + Intergenic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968124856 3:196151521-196151543 CTAGAGCCTCAGAAGGAGCATGG - Intergenic
969066525 4:4486240-4486262 CTGGAGCCTTAGAATGATTTTGG - Intronic
969230794 4:5828907-5828929 CTGGGGCATCACAAAGAGGAAGG + Intronic
971082617 4:23231913-23231935 CTGGAGCCTCCAAATGAGAAGGG - Intergenic
971209837 4:24605251-24605273 CTGGTGCCTCAGTATGAGGCTGG - Intergenic
971451691 4:26806916-26806938 CTAGAGCCTCAGAGGGAGGCTGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
974270674 4:59647183-59647205 CTGTAGCCTCAGGGTGAGGTGGG + Intergenic
977223762 4:94370381-94370403 CTGGAGGCTCTGAATGAGGCAGG + Intergenic
977626785 4:99196491-99196513 CTGCAGCCCCAGAAAGAGAATGG - Intergenic
977678303 4:99771537-99771559 CTGGAGCCTCTGAATATGGTAGG - Intergenic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979701997 4:123679753-123679775 CTGCATTCTCAGAATTAGGATGG - Intergenic
980983313 4:139672206-139672228 CTAGAGCTTCAAAATGAGGCTGG - Intronic
981166710 4:141567730-141567752 CTGTAGGATCAGAATGGGGAGGG - Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981933828 4:150218113-150218135 CTTGAGCCTCAGAAGGAACAGGG - Intronic
982714515 4:158792800-158792822 CTGCAGCCTTAGAATGGAGAAGG + Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
985655118 5:1127424-1127446 CTGGAGCCGCAGAAGTTGGAAGG + Intergenic
985665874 5:1181289-1181311 CAGAAGCCTCAGAAGGAGAAGGG - Intergenic
985717014 5:1468346-1468368 CTGGAGCCTCAGAACGGGCCGGG + Intronic
985717367 5:1470225-1470247 CTGGAGCCTCAGAATAGGCCAGG + Intronic
986449767 5:7852269-7852291 CAGGTGCCTCAGAATGAGAGAGG - Intronic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
987241330 5:16003279-16003301 ACGGGGGCTCAGAATGAGGAAGG - Intergenic
987325416 5:16807816-16807838 AAGGAGCGTCACAATGAGGAGGG - Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989632362 5:43498585-43498607 CTGGACGCTGAGGATGAGGAAGG - Intronic
991091267 5:62696119-62696141 CTGGAGTGTCATAATGAGGCCGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991513856 5:67412070-67412092 CTTGAAACTCAGAATGAAGATGG + Intergenic
992162412 5:74016139-74016161 GTGGAGTTTCAGACTGAGGAGGG - Intergenic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992638862 5:78751430-78751452 GAGGAGCCTCAGAATGGGAAGGG + Intronic
992726167 5:79609351-79609373 CTGCAGCCCCAGAAAGAGAATGG - Intergenic
992998425 5:82355421-82355443 CTTGGGCCTCAGATTGAAGAAGG + Intronic
995188981 5:109300610-109300632 GAGGAGCCTCAGAATGAACAGGG - Intergenic
997471669 5:134120705-134120727 CTGGAGCCAAGGGATGAGGAGGG - Intronic
998172696 5:139881851-139881873 CTGGGGCTTCAGAAAGAAGAGGG - Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001880556 5:175240482-175240504 CTGGTGTCGCAGACTGAGGAGGG - Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003327786 6:5105875-5105897 TTGGAGCCTCAGCCTAAGGATGG - Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1005812587 6:29528815-29528837 CTGGAGGCTCAAAATGAGCAGGG - Intergenic
1005881841 6:30068144-30068166 CTGGAGCTTGAGAATGAGAGAGG + Intronic
1006735149 6:36268080-36268102 CTGGGGCTGGAGAATGAGGAAGG - Intronic
1007627572 6:43255043-43255065 CTGCAGCCTCGGAATGTGGCCGG + Exonic
1008496946 6:52143730-52143752 CCTGAGCCTCAGAAGGATGAGGG - Intergenic
1008927275 6:56900131-56900153 CTGGAGTTCTAGAATGAGGATGG - Intronic
1011626029 6:89284609-89284631 CAGGAGCCACAGAATGTGGACGG + Intronic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1015060280 6:128956124-128956146 ATGGAGCCACAGGATGAAGATGG + Intronic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015534931 6:134258183-134258205 CTTGAGCCCAGGAATGAGGAGGG - Intronic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015890795 6:137967913-137967935 CTGGAGCATCAGAGTGATGATGG - Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016051640 6:139536259-139536281 CTTCAGCCTCAGGATGAGGGCGG + Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016469082 6:144356074-144356096 CTGGAACCTCAAAAGGGGGAAGG + Intronic
1016619883 6:146096362-146096384 ATGGAGCCTAAGTAAGAGGAAGG + Intronic
1016622454 6:146128007-146128029 CTGGAACCTCAGAATGTGGCTGG + Intronic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1018033965 6:159866395-159866417 CTGGAGTCTGAGCATGGGGAGGG - Intergenic
1019444005 7:1061488-1061510 CGGGAGCCTGGGGATGAGGACGG - Intronic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1024624927 7:51198891-51198913 GTAGAGCCCCAGACTGAGGAGGG + Intronic
1024919513 7:54543008-54543030 CTGGTGCCTGACAATGAGGTGGG + Intronic
1026614870 7:71892745-71892767 CTCAAGCCTGTGAATGAGGAGGG - Intronic
1026842682 7:73679243-73679265 CCGGAACCTCAGAAGGAAGAGGG + Intergenic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1029361264 7:100090021-100090043 CAGGAGCTTCACATTGAGGAAGG + Intronic
1029806854 7:103007137-103007159 CTGGAGTCCCAAAAAGAGGAAGG + Intronic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1031297307 7:120017405-120017427 CTGGAGCCTCAGGATAATGAAGG + Intergenic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031861955 7:126990166-126990188 CTGGGGCCTGGGAATGAGTATGG - Intronic
1033229921 7:139588669-139588691 CTGGAGGCTGAGGACGAGGAGGG + Intronic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1038316788 8:26491180-26491202 CTGGAGCCTCAGCCTGACAAAGG - Intronic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038399622 8:27273117-27273139 ATGGTGTCTCAGAAAGAGGAGGG + Intergenic
1039201661 8:35101341-35101363 TTAGAGCCTCAGAAGGAGGACGG - Intergenic
1039627472 8:39068767-39068789 CTGGGACCTCAGTATGAGGTAGG + Intronic
1039914087 8:41846833-41846855 CTTGAGGCTCCTAATGAGGAGGG - Intronic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042810771 8:72823040-72823062 CTGGCTCCTAAGAAGGAGGAAGG + Intronic
1042999194 8:74736582-74736604 CTTGAGTCTCAGAATGGGGCTGG + Intronic
1043173716 8:76998155-76998177 TTGGAACCTGAGAATGTGGATGG + Intronic
1043785379 8:84391765-84391787 CTGAAGTCTCAGAATGAGCTAGG - Intronic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1046292351 8:112179741-112179763 CTGGAGCCTTACAATCATGATGG + Intergenic
1046664089 8:116980072-116980094 CTCAAGCCTCAGAAGGAGCAGGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047216618 8:122881168-122881190 CTGATGCCTCAGGATGAGGGAGG - Intronic
1047560282 8:125979963-125979985 CTGGAGACTCAGAATTTGGGAGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048968205 8:139629075-139629097 CTGGGTCCTCATAATGAGAAGGG - Intronic
1049691780 8:143964537-143964559 CTGGAGCCTCCGAAGGAGCGTGG + Intronic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051963715 9:22800754-22800776 GTGGAGCCCAAGACTGAGGAAGG + Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052975182 9:34405001-34405023 CTGGAGCCTGAGGAGGAGGATGG + Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053475498 9:38379335-38379357 CTGGAGCCTCAGAAAGGAGCAGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1055113291 9:72580934-72580956 CTGAAACCTCTGACTGAGGATGG - Intronic
1055273179 9:74584809-74584831 CAGGAGCCACAGAATGAGTCTGG + Intronic
1055329375 9:75167598-75167620 CTGTAGACTCAGTGTGAGGATGG - Intergenic
1055693788 9:78861125-78861147 CTGGAGCCTGAGTAGCAGGATGG - Intergenic
1056554190 9:87675641-87675663 CTGGAGCCTCAGGGTCAGGATGG + Intronic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058713391 9:107701156-107701178 CTTGTGCCAGAGAATGAGGAGGG - Intergenic
1059119201 9:111627006-111627028 CTGGGGCCTCTGAGGGAGGAGGG + Intergenic
1059258777 9:112955933-112955955 CTGGAGTCTCAGAGAGAGGCTGG - Intergenic
1059491691 9:114673061-114673083 CTGGACTCTCAGAAGGACGAAGG + Intergenic
1059636923 9:116180130-116180152 TTGGAGTCACAGAATGTGGATGG + Intronic
1061126865 9:128682641-128682663 CTTGAGCCTCAGAGACAGGATGG + Intergenic
1061423518 9:130485012-130485034 CTGGGGGCTCAGGAAGAGGAGGG + Intronic
1061587847 9:131579939-131579961 CTGGTGCCTCAGAGTCAGGCAGG + Intronic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062095596 9:134701634-134701656 CAGGAGCCTCAGCACGAGGCTGG - Intronic
1062364466 9:136202303-136202325 CTGGAGCCGCAGGATGGGGAAGG - Intronic
1062599756 9:137314546-137314568 CTGGAGCCTGTGACTGAGGGTGG + Intronic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186750761 X:12619488-12619510 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1189995442 X:46633010-46633032 ATCCTGCCTCAGAATGAGGAAGG - Intronic
1190408969 X:50115665-50115687 GGGTAGCTTCAGAATGAGGATGG - Intergenic
1191861282 X:65668071-65668093 CTGGAACCTGAGAAAGAGGCAGG - Intronic
1191945665 X:66531815-66531837 GTGGAGCCCAAGACTGAGGAAGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197163299 X:123347612-123347634 ATGGAGCCTCCGAGTGGGGAGGG - Intronic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197828203 X:130613264-130613286 CTGGTGCCACAGAATGAGCCAGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198102562 X:133434809-133434831 CTGTAGCCTGAGACTGAGGCAGG - Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198740893 X:139841635-139841657 CTGTAGTCTCAGCATGGGGATGG - Intronic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic
1201979826 Y:19894388-19894410 CTGGAGTATCTGAATGAGAAGGG + Intergenic