ID: 1153364922

View in Genome Browser
Species Human (GRCh38)
Location 18:4245098-4245120
Sequence GCTACGTTGTTAGCTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153364922 Original CRISPR GCTACGTTGTTAGCTGCTAC TGG Intronic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
906561636 1:46762460-46762482 GCTACGTTGTGAGCAGCCCCAGG + Intronic
910498521 1:87861380-87861402 GCTACTATGTTAACTGCAACTGG - Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1077846521 11:6031047-6031069 GCTAAGTTGTTAGCAGCTTTAGG - Intergenic
1077910220 11:6566588-6566610 GCTAGGTTGTGAACTGCTAAAGG + Exonic
1087685867 11:101264514-101264536 GCTAGGTTGTTAGTTGTTCCCGG + Intergenic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG + Intergenic
1111656580 13:91161555-91161577 GCTATGCTGGTAGCTGCAACAGG + Intergenic
1122574988 14:102736363-102736385 GCTACGGTTTTAGGTGCTTCTGG - Intergenic
1127321409 15:57850252-57850274 CCTACTTTATAAGCTGCTACTGG - Intergenic
1141954819 16:87363662-87363684 GCTACATGGTTAAGTGCTACGGG + Intronic
1143891427 17:10105441-10105463 GCTACCATGTTAGATGGTACAGG + Intronic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1154387973 18:13912658-13912680 TCTACGTTGTTTTCTGCTCCCGG + Intronic
925030613 2:647847-647869 GCTGCATTGTCAGCTGCTCCCGG + Intergenic
932158265 2:69437704-69437726 GCTAGGTTTTTAGCTGGTGCTGG + Intergenic
932699460 2:73983703-73983725 GCTAAGCTGTTAGCTGCAGCCGG + Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1176960064 21:15149396-15149418 GCTACGTAGTCAGCTGATAGTGG - Intergenic
1178549393 21:33523363-33523385 GCCACAGTGTTAGTTGCTACTGG - Intronic
950537925 3:13591950-13591972 GTTACATTGTTAGCTTCTCCAGG + Intronic
959470092 3:106739328-106739350 GCTTAGCTGTTAGCTGCTTCAGG - Intergenic
965971503 3:174561630-174561652 GCAAAGTTGTTTGCTGCAACTGG + Intronic
973014520 4:45121146-45121168 ACTACATTTTTAGCTGCTTCTGG - Intergenic
982369337 4:154617293-154617315 GCCACATTGGTATCTGCTACTGG + Intergenic
995820802 5:116229557-116229579 GCAACACTGTTAGCTGCTAAAGG + Intronic
1005166359 6:22926111-22926133 GCTACGTTGATAAATGCTATAGG - Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1045184422 8:99822561-99822583 GCTACTTTGTTAGGTGCTAGAGG - Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1050391640 9:5149166-5149188 TCTAGGATCTTAGCTGCTACAGG - Intronic
1055160108 9:73116145-73116167 GATATTTTGTTTGCTGCTACTGG + Intergenic
1198129709 X:133681563-133681585 GCCACTTTCTTTGCTGCTACTGG - Intronic