ID: 1153365361

View in Genome Browser
Species Human (GRCh38)
Location 18:4249541-4249563
Sequence CAGTAACCGTTCAGTAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153365360_1153365361 15 Left 1153365360 18:4249503-4249525 CCAAATGAGTCAGGCAACACTTT 0: 1
1: 0
2: 0
3: 12
4: 167
Right 1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG 0: 1
1: 0
2: 0
3: 1
4: 73
1153365359_1153365361 16 Left 1153365359 18:4249502-4249524 CCCAAATGAGTCAGGCAACACTT 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG 0: 1
1: 0
2: 0
3: 1
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153365361 Original CRISPR CAGTAACCGTTCAGTAATGA TGG Intronic
906357950 1:45124033-45124055 CAAAAACCCTTCAGAAATGAAGG + Intronic
916252562 1:162753298-162753320 CAGGAACTGTTGAGAAATGAAGG + Intronic
917693803 1:177497029-177497051 AAATTACCCTTCAGTAATGAAGG + Intergenic
918479174 1:184959138-184959160 CAGGATCAGTTCAGAAATGAGGG - Intronic
923778680 1:237002147-237002169 CAGCAACAGGTCAGTGATGAAGG - Intergenic
1064379246 10:14825668-14825690 CAGTATCATTCCAGTAATGAAGG + Intronic
1071087281 10:81877459-81877481 CATTAACTCTTCAGTGATGATGG + Intronic
1080318049 11:30972367-30972389 AAGTTACCCTTCATTAATGAAGG + Intronic
1086436603 11:86787241-86787263 AAGTAATAGCTCAGTAATGAAGG - Intergenic
1088338489 11:108736038-108736060 CATTAACCCTTCAGCAAAGACGG - Intronic
1093203071 12:16213251-16213273 TAGTAAGTGTTCAGTAAAGATGG - Intronic
1094083503 12:26563644-26563666 CAGTAAATGTTAAGTAAGGAGGG - Intronic
1096340024 12:50790021-50790043 CAGAAACCTTTGAGGAATGATGG + Intronic
1102855218 12:116287705-116287727 CAGTAACCGTTGTGAAATGCTGG - Intergenic
1108161926 13:47649519-47649541 AAGTAACCTTTCAGTAACTATGG - Intergenic
1111462003 13:88557319-88557341 CAGTACCAATTAAGTAATGAAGG - Intergenic
1113033331 13:106018662-106018684 TGGTAACAGTTCAGTAATGCTGG + Intergenic
1119671492 14:76522792-76522814 CAAAAACCCTTCAGGAATGAAGG - Intergenic
1119762783 14:77164137-77164159 CAGTAAACTTACAGTAATGGTGG + Intronic
1131250460 15:90826975-90826997 CAGTAACCGTGGAGTAAGGTGGG - Intergenic
1136180907 16:28551262-28551284 CAGCAACATTTCAGTTATGATGG - Intergenic
1142158264 16:88542885-88542907 CTGTAAATGTTCATTAATGAGGG + Intergenic
1147366310 17:39961679-39961701 AAGGAAACGTTCAGTAAAGATGG + Intergenic
1147976278 17:44249994-44250016 CAGTAACCATCCTGTAATGTGGG + Exonic
1150276122 17:63899023-63899045 CAGTAATGCTTCAGGAATGACGG - Intergenic
1151094674 17:71482858-71482880 CAATAAATGTTCAGTAATTATGG + Intergenic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1154254672 18:12772094-12772116 CAGAAGGAGTTCAGTAATGAAGG - Intergenic
1159700941 18:71625662-71625684 CATTAACTGTTCAGTGATGTGGG - Intergenic
1160702315 19:513605-513627 CAGTAGGTGTTCAGTAATGCAGG - Intronic
1167166912 19:47804702-47804724 CAGTACCTGATCAGTGATGAAGG - Intronic
1167174925 19:47859062-47859084 CAGTACCTGATCAGTGATGAGGG + Intergenic
928664149 2:33533717-33533739 CAGGAACCGGTCAGAAATCAGGG - Intronic
943442366 2:187941841-187941863 CAGAAACTGTTGAGTAATGTGGG - Intergenic
945354659 2:208825518-208825540 AAGTTACCCTTCAGAAATGACGG + Intronic
948181861 2:235988638-235988660 CTGTAACTTTCCAGTAATGAGGG + Intronic
1168885732 20:1252910-1252932 CAGAAACCCTTCTGAAATGAAGG - Intronic
1173896372 20:46554056-46554078 CACTGACCTTTCTGTAATGATGG - Intergenic
1174372419 20:50100650-50100672 CAGCTTCCATTCAGTAATGAAGG - Intronic
949090858 3:27364-27386 AAGAAACCTGTCAGTAATGATGG + Intergenic
951986550 3:28627714-28627736 CCCAAACCCTTCAGTAATGAAGG + Intergenic
954624674 3:52016040-52016062 CAGCAGCCGCTCAGTAATTAGGG + Intergenic
956428769 3:69163875-69163897 CAGTAGCCCTTCAATTATGATGG - Intergenic
962194310 3:133347027-133347049 CGATAAAGGTTCAGTAATGAAGG - Intronic
962596637 3:136953006-136953028 CAGTAATCATTGAGTAAGGATGG + Intronic
963882925 3:150548152-150548174 CAGAAGCAGTTCAGTATTGATGG - Intronic
967020969 3:185522291-185522313 CAACAACACTTCAGTAATGAGGG - Intronic
971890547 4:32515386-32515408 CAGAAAACTTTCAATAATGAGGG - Intergenic
983363168 4:166753540-166753562 TAGTAATAGTTCAGTAATTAGGG - Intronic
983724624 4:170905335-170905357 TAATAACCTTTCAGTACTGAAGG - Intergenic
987871516 5:23624926-23624948 ATATAACTGTTCAGTAATGATGG + Intergenic
988366915 5:30311367-30311389 CAGGAAACTTTCAGTAATGATGG - Intergenic
993680199 5:90868351-90868373 CAGCAGCCTTTCATTAATGAGGG - Intronic
1002579537 5:180199358-180199380 CAGGATCCGGTCAGTGATGAAGG - Intronic
1005111670 6:22288562-22288584 CAGCAACCCTTCAGTGGTGAGGG + Intronic
1010410652 6:75557710-75557732 CAGCATCCGTTCATTCATGATGG - Intergenic
1010807762 6:80259049-80259071 CTGAAACAGTTCAGTATTGAAGG + Intronic
1014818748 6:125961921-125961943 CAGAATCCCTTCAGAAATGAGGG + Intronic
1014853322 6:126368351-126368373 CAGTAAAGGTTCTGTAATTAAGG + Intergenic
1016860970 6:148718497-148718519 GAGGAAACGTTCAGTCATGATGG + Intergenic
1023298228 7:38739194-38739216 CAAGAACCATTCAGTAATGTAGG - Intronic
1026287551 7:68976598-68976620 CAGGAAACTTTCAGTCATGATGG + Intergenic
1028897700 7:96060843-96060865 CAATGACGCTTCAGTAATGAAGG + Intronic
1030194116 7:106836349-106836371 CAGCAATTGTTCACTAATGAGGG - Intergenic
1030861089 7:114630433-114630455 CAGTAGCAGTTCATTAATCAGGG - Intronic
1035951560 8:4027559-4027581 CAGGAACCATGCAGTTATGATGG - Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1056505490 9:87254300-87254322 TAGTAAACGTTCAGTAAACAGGG - Intergenic
1061404041 9:130383826-130383848 CAGTAAGTGCTCAGTAATGGTGG - Intronic
1185789975 X:2921822-2921844 CTGTAACAGTTGAGTACTGATGG - Intronic
1191113270 X:56825075-56825097 CCGAAACCCTTCAGGAATGAAGG - Intergenic
1199929117 X:152500516-152500538 CAGTAATCATACAGTAAAGAAGG - Intergenic
1201284337 Y:12366120-12366142 CTGTAACAGTTGAGTACTGATGG + Intergenic
1201297923 Y:12480672-12480694 CAGTCACCCTTCAGTATTCATGG - Intergenic
1202085511 Y:21132791-21132813 CAGGAAACATTCAGTCATGATGG + Intergenic