ID: 1153368760

View in Genome Browser
Species Human (GRCh38)
Location 18:4289165-4289187
Sequence AAGGACTGGCTGAATGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 344}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153368759_1153368760 -10 Left 1153368759 18:4289152-4289174 CCTAGGAACAAAGAAGGACTGGC 0: 1
1: 0
2: 0
3: 13
4: 181
Right 1153368760 18:4289165-4289187 AAGGACTGGCTGAATGAAGATGG 0: 1
1: 0
2: 0
3: 29
4: 344
1153368755_1153368760 16 Left 1153368755 18:4289126-4289148 CCTTCTGAGGGCAAGCTGCTCAC 0: 1
1: 0
2: 1
3: 12
4: 166
Right 1153368760 18:4289165-4289187 AAGGACTGGCTGAATGAAGATGG 0: 1
1: 0
2: 0
3: 29
4: 344
1153368753_1153368760 28 Left 1153368753 18:4289114-4289136 CCTATTTCAGAGCCTTCTGAGGG 0: 1
1: 0
2: 2
3: 31
4: 227
Right 1153368760 18:4289165-4289187 AAGGACTGGCTGAATGAAGATGG 0: 1
1: 0
2: 0
3: 29
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153368760 Original CRISPR AAGGACTGGCTGAATGAAGA TGG Intronic
900735781 1:4298634-4298656 ATGGAGTGGGTGAATGAGGAGGG + Intergenic
902243079 1:15101583-15101605 AAGGCCTGGCTGAATGACATTGG + Exonic
903489246 1:23715384-23715406 AAGGACAAACTGAATGCAGAGGG - Intergenic
903745476 1:25584046-25584068 ACGGTCTGGGTGGATGAAGAAGG - Intergenic
904519514 1:31083820-31083842 AAAGAAAGGCTGAATGAACAGGG + Intergenic
904907640 1:33909992-33910014 AAGTTCTGGCTGAATGACTATGG - Intronic
906063557 1:42963570-42963592 AGGGACTGTCTGCATGGAGAGGG - Intergenic
906110873 1:43321255-43321277 AAGGACCAGCTGAAATAAGAAGG - Exonic
907805639 1:57816711-57816733 AAGAAGTGGATGAGTGAAGAAGG - Intronic
907997101 1:59644017-59644039 AAGGACTAGCTTAAGGAACATGG - Intronic
908793050 1:67802231-67802253 AAGGAATGGATGAAGGAAGAAGG + Intronic
909624673 1:77702292-77702314 AAAGACTGGGTAAATGAAGATGG + Intronic
909938755 1:81586313-81586335 AAGGAATCTCTGCATGAAGAAGG - Intronic
911021369 1:93391350-93391372 AAGGACTTGCTGTATGAATCTGG - Intergenic
912139339 1:106702733-106702755 AAGAACTGGATGAAGGAAAAGGG - Intergenic
913047436 1:115086436-115086458 AAGGACTGGTAGAATGGAGCTGG - Intronic
915366282 1:155318497-155318519 AAGGACTGTGTGTATGAATATGG + Intronic
915436818 1:155912769-155912791 AAGGACTTCATGAATGAAGCGGG - Intergenic
915492722 1:156260286-156260308 AATGGCTCACTGAATGAAGAAGG + Intronic
915631576 1:157156753-157156775 CAGAACAGGCTGCATGAAGATGG - Intergenic
915995347 1:160556989-160557011 AAGGACTTCCTAGATGAAGAAGG - Intronic
919020842 1:192103107-192103129 AAGCACTGGATGAATAATGATGG + Intergenic
920012234 1:202877071-202877093 AGGTACTGGCTGAATGAATTTGG + Intergenic
920125420 1:203690508-203690530 GAGGACTAGGTGAGTGAAGATGG + Intronic
920258354 1:204672035-204672057 AAGGCTTCCCTGAATGAAGAGGG + Intronic
921843770 1:219857559-219857581 AAGGACTGGCTTTATGAATCTGG + Intronic
921988827 1:221341780-221341802 AAGGACTGAATGAATGCAGAAGG - Intergenic
923246112 1:232134097-232134119 GAGGACTGGCTGAATAAATGTGG + Intergenic
924276665 1:242395738-242395760 GGGGACTGACTGAGTGAAGAAGG + Intronic
924588802 1:245383606-245383628 AAGCACTGGCTGTTTGAACAGGG - Intronic
1062975236 10:1678117-1678139 AAGGAATGGGTGAGTGCAGATGG + Intronic
1063680425 10:8182011-8182033 AGGCACTGGCTGACTGAAGGGGG + Intergenic
1064068214 10:12201967-12201989 AACAACTAGATGAATGAAGATGG + Intronic
1066078281 10:31903354-31903376 ATGGACTGCATGAATGATGACGG - Intronic
1067811741 10:49433400-49433422 GAGAACTTTCTGAATGAAGAGGG + Intergenic
1068535885 10:58241159-58241181 AACGACTTGCTGAAGGCAGAAGG + Intronic
1070098003 10:73357298-73357320 AAGGAAGTGCTGAATGAAGCTGG + Intronic
1070691322 10:78528780-78528802 AAGGGCAGGCTGAATGCAAAGGG - Intergenic
1070803820 10:79258847-79258869 AAGGAATGACTGACTGAACATGG + Intronic
1071057735 10:81530574-81530596 ATGGACTGGCTGAATACAGTTGG - Intergenic
1071711799 10:88057022-88057044 AAGGACTGTGGGAATGAAGAGGG + Intergenic
1071754945 10:88527202-88527224 AAGGTCTGGCAAAATGAAGCTGG - Intronic
1072223800 10:93349408-93349430 AAGGACTGGCTGTCTGGGGAAGG - Intronic
1072381352 10:94874735-94874757 AAGGACAGACTGATTGCAGATGG + Intergenic
1072857587 10:98965854-98965876 AATGACTGAATGAATGAACAGGG - Intronic
1072991951 10:100204420-100204442 AACAACTGGCTGAGTTAAGAAGG + Intronic
1073130133 10:101183046-101183068 GAGGCCTAGCTGAATGGAGATGG + Intergenic
1073616106 10:104997769-104997791 AAAGATTTGCTGAATGAAAAAGG - Intronic
1074306095 10:112279886-112279908 AAGGACGAGCTGAATGAAATTGG - Intergenic
1074871837 10:117583067-117583089 AACGACTGGCATAATAAAGATGG - Intergenic
1075044235 10:119133420-119133442 AATGAATGGATAAATGAAGAAGG - Intronic
1075805124 10:125182608-125182630 AAGGACTTGCTGTATGAATCTGG + Intergenic
1076201470 10:128562194-128562216 AAAAACTTGCAGAATGAAGAAGG - Intergenic
1076585716 10:131546267-131546289 CAGGGCTGGCTGAAGGAACATGG - Intergenic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1080161783 11:29185245-29185267 AAGGACTGACTGAAAACAGAAGG + Intergenic
1080304230 11:30819222-30819244 AGGGGCTGGCTGAATGCATAAGG - Intergenic
1080721056 11:34849084-34849106 AAGGACTTGCTGAATCACTATGG - Intergenic
1082184976 11:49168024-49168046 AAGGACTAAATGAATGAAGGGGG - Intronic
1082719696 11:56658665-56658687 AAGGACTTGCTTTATGAATATGG + Intergenic
1083160606 11:60851990-60852012 AAGCATTGGCTAAATGAAGAGGG + Exonic
1083690273 11:64404102-64404124 CAGGGCTGGAGGAATGAAGAAGG - Intergenic
1086681362 11:89677322-89677344 AAGGACTAAATGAATGAAGGGGG + Intergenic
1087079896 11:94160380-94160402 AAGGACTGGCTTTATGAATCTGG + Intronic
1087530958 11:99381471-99381493 AAGAAATGGCTGTATGCAGAAGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087596377 11:100259282-100259304 AAGGACTTGCTTTATGAATATGG - Intronic
1087719080 11:101641372-101641394 AAGGACTTGCTTTATGAAGCCGG - Intronic
1090457190 11:126860431-126860453 AGGAATTTGCTGAATGAAGAAGG + Intronic
1090576145 11:128105932-128105954 AAAGATTGGCCAAATGAAGAAGG + Intergenic
1092240649 12:6834125-6834147 CAGGACAGGCAGAATGAAGGGGG - Intronic
1092327287 12:7546111-7546133 AAGGACTTGCTGTATGAATCTGG - Intergenic
1092718699 12:11418634-11418656 AAGGACTGGCTTTATGAATCTGG - Intronic
1092862020 12:12726226-12726248 ACCGACTGGCTGAATTATGATGG - Intronic
1093181340 12:15970927-15970949 AATGACTTTCTGAATAAAGATGG - Intronic
1093854572 12:24085053-24085075 AAGGACTACCTGAAAAAAGAGGG + Intergenic
1095042417 12:37456775-37456797 CAGGACTGGCTTAATGTTGAAGG - Intergenic
1095074054 12:37894867-37894889 AAGGACTGGCTTTATGAATCTGG - Intergenic
1095647065 12:44559665-44559687 AAGGACTTGCTGTATGAATCTGG - Intronic
1096452999 12:51760490-51760512 AAGCACTGGCTGATTGACCATGG - Intronic
1100460885 12:94798238-94798260 GAGGAATGGCTGAAGGAACAGGG + Intergenic
1100808519 12:98313236-98313258 AAGGACTTGCTTTATGAATATGG - Intergenic
1102856282 12:116297116-116297138 GAGGAGTGGATGAATGAAGAAGG + Intergenic
1104290451 12:127461555-127461577 GAGGACAGGCTGGATGAATAGGG + Intergenic
1106596064 13:31139049-31139071 GAAGACTGGCTGTATGAAGAAGG - Exonic
1107091102 13:36481018-36481040 ACAGAGTGGCTGAATGGAGAAGG + Intergenic
1107439813 13:40415724-40415746 AAGGACTTGCTTTATGAATATGG - Intergenic
1107667395 13:42705420-42705442 AATGACTGGCTTATAGAAGAGGG - Intergenic
1108479941 13:50858403-50858425 AAGGACTTGCTGTATGAATCTGG - Intergenic
1109601717 13:64639639-64639661 TAGAAGTGGCTGGATGAAGAAGG - Intergenic
1111337045 13:86838563-86838585 AAGGAGTGCGTGAATGAGGATGG + Intergenic
1112744626 13:102512641-102512663 AAGGACTGGGAGAAGGAAGTTGG - Intergenic
1114248252 14:20934558-20934580 AACGTCTGGCAGAATGCAGAAGG + Intergenic
1115487398 14:33925222-33925244 AATGACTTTCTGAATAAAGATGG - Exonic
1116719899 14:48482819-48482841 AAGGACTTGCTTTATGAAGCTGG - Intergenic
1117081905 14:52160277-52160299 AAGGACTTGCTTTATGAATATGG - Intergenic
1117438879 14:55742300-55742322 AAGGACGGCCTGAAAGGAGAAGG - Intergenic
1117474577 14:56080987-56081009 AAGGAGTGGCTACATGGAGAAGG + Intergenic
1118014506 14:61644874-61644896 AAGGGATGGATGAATGTAGATGG - Intronic
1118290619 14:64518430-64518452 CAGGACTGGTGAAATGAAGATGG - Intronic
1118844388 14:69535839-69535861 AATGACTGAATGAATGAATAAGG - Intergenic
1118938276 14:70308705-70308727 AAGGACTTGCTTTATGAAGCTGG + Intergenic
1119404043 14:74385181-74385203 AAGGACTTGCTTTATGAATATGG + Intergenic
1119421380 14:74509748-74509770 GGGTACTGGGTGAATGAAGACGG - Exonic
1123576371 15:21674145-21674167 AAGGACTTGCTTTATGAATATGG + Intergenic
1123612995 15:22116613-22116635 AAGGACTTGCTTTATGAATATGG + Intergenic
1124590733 15:31050798-31050820 CAGGCCTGGCTGTCTGAAGAAGG + Intronic
1127296593 15:57614219-57614241 AAATACTTGCTGAATGAATAGGG - Intronic
1127686888 15:61354680-61354702 AAGGGCTGGGTGAAGAAAGAAGG + Intergenic
1129647275 15:77448195-77448217 AAGAACAGACTGAATGAAGGTGG - Intronic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130627484 15:85530455-85530477 AAGGACTGGTTAAATGGATAGGG + Intronic
1130857939 15:87857842-87857864 AAGGACTTCCTGAAGAAAGATGG + Intergenic
1131091874 15:89629613-89629635 GAGGATTAGCTGGATGAAGAGGG - Intronic
1202985239 15_KI270727v1_random:408390-408412 AAGGACTTGCTTTATGAATATGG + Intergenic
1133088905 16:3388328-3388350 AAAGACTTGCTGAAGGAGGAGGG - Intronic
1133758490 16:8780060-8780082 AGGGATTGGCTGGGTGAAGAAGG + Intronic
1133982853 16:10646531-10646553 AAGGAATGACTGAATGAGGTTGG + Intronic
1134033084 16:11008222-11008244 AAGGACAGACTGAAAAAAGATGG - Intronic
1134659125 16:15970559-15970581 AAGCACTGGCTTAATGAGGAAGG + Intronic
1134666976 16:16025813-16025835 AAGTCCTGGCTGAAGGCAGAGGG - Intronic
1135959839 16:26986358-26986380 AAGGCCTGGCTGCATGAATGGGG + Intergenic
1137318186 16:47349546-47349568 AAGGACTTGCTGTATGAATCTGG - Intronic
1138734266 16:59232118-59232140 AAGGACTTGCTTTATGAAGCTGG - Intergenic
1141279394 16:82617367-82617389 AATGAATGAATGAATGAAGAAGG + Intergenic
1141447638 16:84072301-84072323 AAGGGCTGGTGGAAGGAAGAAGG + Intronic
1141850661 16:86643268-86643290 AAGGGGTGGCAGAAGGAAGATGG - Intergenic
1143346196 17:6250897-6250919 AAAGACTGGCAGAAAGAACAAGG - Intergenic
1146833987 17:36095078-36095100 AAGGGCTGGCTGCAGAAAGAAGG - Intergenic
1146954859 17:36931587-36931609 TAGTACTGCCTGAAAGAAGAGGG + Intergenic
1147606316 17:41775739-41775761 AAGGACAGGAAGAAGGAAGACGG + Intronic
1147980150 17:44269112-44269134 ATGGACTGGCTGAAGGAACCTGG + Intergenic
1148656625 17:49288728-49288750 AATGAATGACTGAATGAAGGGGG + Intergenic
1150574987 17:66422633-66422655 CAGGACTGGCTAAAAGAAGTTGG - Intronic
1153368760 18:4289165-4289187 AAGGACTGGCTGAATGAAGATGG + Intronic
1155178960 18:23326538-23326560 AAGGACTTGCTTTATGAATATGG - Intronic
1155344407 18:24844153-24844175 AAGCACTGGCAGAATGAGGCAGG - Intergenic
1157123191 18:44931594-44931616 AAGGACTTGCTTTATGAAGCTGG + Intronic
1157608573 18:48941632-48941654 AAGAACTGGCTGAAGCAAGAGGG - Intronic
1159907179 18:74104920-74104942 AATCAATGGCTGAATGAATAAGG + Intronic
1159933352 18:74337687-74337709 AAGGACACGCAGAATGAATAAGG - Intronic
1163468700 19:17484652-17484674 AGGGAATGAGTGAATGAAGATGG + Intronic
1164132919 19:22382326-22382348 AAGGACTTGCTTTATGAATATGG + Intergenic
1164165899 19:22674405-22674427 AAGGACTTGCTTTATGAATATGG - Intergenic
1164265830 19:23615883-23615905 AAGGACTTGCTTTATGAATATGG - Intronic
1164335919 19:24321266-24321288 AAGGAGTAGCTGAAGGGAGAGGG - Intergenic
1165150943 19:33759776-33759798 TGGGACTGGCTGACTGCAGAGGG - Intronic
1165590784 19:36967701-36967723 AAGGTCTTGGTGAATGATGATGG - Intronic
1165729157 19:38133331-38133353 AAGGAATGACAGAATGAAGATGG - Intronic
1166050585 19:40256643-40256665 AAGGCCTGGCTGACAGAAGCTGG + Intronic
1166357611 19:42236396-42236418 AAGGCCTGACTGAATCAGGAAGG - Intronic
1167195334 19:48024231-48024253 AAGGACCAGCTGATTGAAGCAGG + Intronic
1167195444 19:48025070-48025092 AAGGACCAGCTGATTGAAGCAGG - Exonic
926925836 2:17986778-17986800 AAGGACTTGCTTTATGAATATGG + Intronic
931671833 2:64654175-64654197 AAGGACGGGCTGAAAGAGGAGGG + Intronic
934062243 2:88305971-88305993 GATGACTGGTTGAATGAGGAGGG - Intergenic
935453054 2:103233230-103233252 AAGGATTGGCTCACTGTAGAAGG - Intergenic
936171019 2:110174541-110174563 AAGGACTGACTATATGTAGAAGG - Intronic
937087131 2:119178895-119178917 CAGGCCTGGCTGAATGCAAAAGG + Intergenic
938234256 2:129690275-129690297 AATGCCTGGCTGAATGTAAAAGG + Intergenic
940368188 2:152872080-152872102 AAGGAAAGGCTGGATAAAGATGG - Intergenic
941019975 2:160397613-160397635 AAAGAGTGAATGAATGAAGAGGG - Intronic
942921916 2:181384356-181384378 ATTGCCTGGCTGAATGATGATGG + Intergenic
943549554 2:189321652-189321674 AAGGACTTGCTTTATGAAGCTGG - Intergenic
943746053 2:191463724-191463746 AAGAAGTGTCTGAATGTAGAAGG - Intergenic
944138145 2:196423344-196423366 AATGACTAGCTGAATGACCATGG - Intronic
946149468 2:217754338-217754360 ATGGACTGACTGAATAAAGAAGG - Intronic
946488263 2:220121826-220121848 AACAAATGGATGAATGAAGAAGG + Intergenic
948863105 2:240762399-240762421 CAGGAGTGGCTGGATGATGATGG - Intronic
1171443296 20:25184484-25184506 AAGGACTTGCTGTATGAATCTGG + Intergenic
1172276300 20:33681461-33681483 ACGGACTGGCTGTATAAAAATGG + Intronic
1172798262 20:37558457-37558479 AAGGACAGAATGAGTGAAGAGGG + Intergenic
1172829717 20:37823323-37823345 CCTGACTGGCTGAAGGAAGAAGG + Intronic
1172891398 20:38268475-38268497 AAGGAGAGGGGGAATGAAGAAGG - Intronic
1173185862 20:40839706-40839728 AAGAACTGGGGGAATGGAGAGGG - Intergenic
1173746051 20:45437892-45437914 TGGGACTGGCTGTATGATGACGG + Intergenic
1173890210 20:46502163-46502185 AAGGGCTGACTGACAGAAGAAGG + Exonic
1174485436 20:50858101-50858123 AATGAATGAATGAATGAAGATGG - Intronic
1175613927 20:60376424-60376446 AATGAGTGAATGAATGAAGATGG - Intergenic
1176267233 20:64216526-64216548 AGTCCCTGGCTGAATGAAGAAGG + Intronic
1177471627 21:21567143-21567165 ATGGACAGGCTGAACAAAGAAGG + Intergenic
1177530002 21:22346248-22346270 TAGGACTGGCTTAAGGAGGAGGG + Intergenic
1178323937 21:31628187-31628209 AAGGACTTTCAGAAAGAAGAGGG - Intergenic
1178368610 21:32008623-32008645 GAGGAGTGTTTGAATGAAGAGGG + Intronic
1178965366 21:37111535-37111557 AAGGACTTGCTGTATGAATCTGG - Intronic
1179080177 21:38163450-38163472 AAGCACTGCCTGCATGACGAGGG - Intronic
1179827247 21:43973144-43973166 AAGGACTGGCTGATTAGAGGCGG + Intronic
1179930633 21:44568781-44568803 AGGGCGTGGCTGAATGAAGCAGG + Intronic
1181266321 22:21633005-21633027 AAGGGCTGGATGCATGAAGGAGG + Intronic
1182790042 22:32943934-32943956 AAGGACTTGCTGTATGAATCTGG - Intronic
949793715 3:7823101-7823123 TAGGATTGGTAGAATGAAGATGG - Intergenic
950208522 3:11098790-11098812 AATGACTGGCTGGGTGAAGAAGG - Intergenic
950284504 3:11734061-11734083 ATGGCCTCACTGAATGAAGACGG + Intergenic
950448506 3:13052343-13052365 GAAGAGTGGCTGAATGCAGAGGG - Intronic
950547238 3:13645837-13645859 AAGGACTGGATGAGGGATGAGGG + Intergenic
950929865 3:16778012-16778034 AAGGACTTGCTTAATGAATCTGG - Intergenic
951186439 3:19719306-19719328 AAGAACTGGGTGGATGAAGATGG - Intergenic
951620127 3:24592365-24592387 AAGGAGTGGCTGATGGCAGAAGG - Intergenic
952037064 3:29215473-29215495 AAGGACTGGCTGATGGAATGAGG - Intergenic
952118534 3:30214035-30214057 AAGGACTTGCTTTATGAATACGG + Intergenic
952159425 3:30678911-30678933 AAGGTCTAACTGAATGAAGTAGG + Intronic
952575148 3:34765555-34765577 AAGGACTTGCTTAATGAATCTGG - Intergenic
953955075 3:47225668-47225690 TGGGACTGCCTGAATAAAGATGG - Intergenic
953984210 3:47428881-47428903 AAGAACTGGCTGAAATAAGCTGG + Intronic
954148590 3:48646481-48646503 AAGGACAGGCTGACTGATGGGGG - Intronic
956579531 3:70795063-70795085 AAGGACTTGCTTTATGAATATGG + Intergenic
957453332 3:80408582-80408604 AAAGACAGGATGAATGAAAATGG + Intergenic
957638683 3:82820167-82820189 AAGGACTGACAGAACGGAGAAGG - Intergenic
958767516 3:98387590-98387612 GAGGACTTGCTGAATGAAAGGGG - Intergenic
959098220 3:101980528-101980550 AAGGACAGAAAGAATGAAGAAGG - Intergenic
959863553 3:111242112-111242134 AAGGGGTGGCTGAGTGAACATGG + Intronic
960751940 3:120964926-120964948 AAGGACTTGCTGTATGAATCTGG + Intronic
963307099 3:143664821-143664843 AAGGACTTGCTTTATGAAGCTGG - Intronic
964367332 3:155964197-155964219 AAGGAATGGCAGAGTGAGGAAGG - Intergenic
964471792 3:157064474-157064496 ACTGCCTGGCTGAATGATGAGGG - Intergenic
965011063 3:163091769-163091791 AATGACTGCATGAATGAATACGG + Intergenic
965250700 3:166341284-166341306 CAGGACGGTATGAATGAAGATGG + Intergenic
966018447 3:175174251-175174273 AAGAGCTGGTTGAATGAAGAGGG - Intronic
966343887 3:178956859-178956881 AAAGACTGGCTCATTTAAGAAGG + Intergenic
967726832 3:192870026-192870048 AAAGCCTAGCTGAATGAATAAGG + Intronic
967921475 3:194617358-194617380 GAGGACTGGCTGCAGGCAGAGGG - Intronic
968126380 3:196163584-196163606 AAGGACGGGTAGAAGGAAGAGGG - Intergenic
968761226 4:2443525-2443547 CAGGACTGGCTGAGTGAATGGGG + Intronic
968814874 4:2817149-2817171 CAGGAGTGGCTGAATCAGGAAGG + Intronic
970147166 4:13048095-13048117 CAGCACTGGCTGTGTGAAGAGGG + Intergenic
970685480 4:18561871-18561893 AAGGACTTGCTGTATGAATCTGG - Intergenic
971456536 4:26850456-26850478 GAGGACTGCCTGAACCAAGAGGG + Intergenic
971734245 4:30425641-30425663 AAGGACAGGAGGAAGGAAGAAGG + Intergenic
971746770 4:30590391-30590413 AAGAACTAGCTCTATGAAGATGG + Intergenic
972042031 4:34614703-34614725 AAGCACTGGGAGAATGCAGAAGG + Intergenic
972209368 4:36818673-36818695 AAGGAAGGCCTGAATGAAAAAGG - Intergenic
972284743 4:37637472-37637494 CAGGGCTGGCTGTAGGAAGAAGG - Intronic
972972592 4:44595559-44595581 AAGGACTGGCTTTATGAATCTGG - Intergenic
973579072 4:52323442-52323464 AAGGACTTGCTTTATGAAGCTGG + Intergenic
974470428 4:62311732-62311754 AAGGACTGGCTTTATGAATCTGG - Intergenic
975506750 4:75146748-75146770 AAGTGCTGGCTAAAAGAAGAAGG - Intergenic
975640672 4:76496759-76496781 AAGAATTGACTGAATGAGGAAGG - Intronic
975668191 4:76754551-76754573 AGGGAATGGCTGAAGGCAGAGGG - Exonic
976455078 4:85237057-85237079 AACTACTGGCAGAATGAGGATGG - Intergenic
976913872 4:90344969-90344991 AAGGACTGTCTGGCTGAAGTTGG - Intronic
976992112 4:91380402-91380424 AAGGACTTGCTTTATGAATATGG + Intronic
977071009 4:92387741-92387763 AAGGACTTTCTCAATGTAGAAGG + Intronic
978269644 4:106873751-106873773 AAGGACTTGCTTTATGAATATGG + Intergenic
978363808 4:107959151-107959173 AAGGACTTGCTTTATGAAAATGG - Intergenic
978560676 4:110030423-110030445 AAGGGCAGGCTGAAAGAAGAAGG - Intergenic
980248136 4:130274562-130274584 AAGGACTGAATGAATAAAGTTGG - Intergenic
980846359 4:138329912-138329934 AAGGACTGCCTGAAGGGACAAGG - Intergenic
981057754 4:140383266-140383288 AATCACTAGCTGGATGAAGAGGG - Exonic
981124218 4:141087415-141087437 AAGGAGAGGCTGGATAAAGATGG - Intronic
981272509 4:142861030-142861052 AAGTAGTGCCTCAATGAAGAAGG + Intergenic
982863821 4:160486446-160486468 AAGAAATGCCTGAATTAAGAGGG + Intergenic
984125821 4:175809020-175809042 AAGGCCTTGCTGAATTAGGAGGG - Intronic
986012438 5:3728313-3728335 AGGCACTGGCGGAATGAATAGGG - Intergenic
987034420 5:14005880-14005902 CAGGGCTGGCAGAATGAAGGAGG + Intergenic
987053852 5:14172503-14172525 AAGAACTGGCTTAATGGAGTGGG + Intronic
987293616 5:16530970-16530992 AAGAAATGGATGAATGAAAAAGG + Intronic
988131286 5:27109636-27109658 GAGAAATGACTGAATGAAGAAGG - Intronic
988943889 5:36174779-36174801 GAGAACTGACTGAGTGAAGAAGG + Intronic
989098816 5:37805998-37806020 AAGGACTGGGTGGAAAAAGAAGG + Intergenic
989357844 5:40565037-40565059 AAGGACTTGCTTTATGAAGCTGG + Intergenic
989517041 5:42355655-42355677 AAGGACTTGCTTTATGAAGCTGG - Intergenic
990710548 5:58575271-58575293 AAGGACTGGCTTTATGAATCTGG - Intergenic
991106480 5:62849577-62849599 ATAGACTGGCTGAGTGAAGGGGG - Intergenic
991348279 5:65693291-65693313 AAGGAAGGGATGAATCAAGAAGG + Intronic
991539054 5:67706145-67706167 AAGGACTGGCTTTATGAATCTGG - Intergenic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
993434098 5:87870218-87870240 AAGAATTGCCTGAATGAAGGTGG + Intergenic
993535900 5:89086254-89086276 AAGGACAGTTTGAATGTAGATGG - Intergenic
993801018 5:92337289-92337311 AAAGATTGGCTGTTTGAAGAAGG - Intergenic
996017456 5:118556563-118556585 AAGGACTTGTTGAATGAAGTAGG + Intergenic
996147067 5:119989797-119989819 AAGGACTTGCTGTATGAATCTGG + Intergenic
996167853 5:120247287-120247309 AAAGACAGGCTATATGAAGAAGG + Intergenic
996782216 5:127199623-127199645 AAGGACTTGCTTTATGAAAATGG - Intergenic
996820356 5:127619767-127619789 AAGGACTGGCTCATGGGAGAGGG - Intergenic
1000534274 5:162460847-162460869 AAGAAGTGGGTGAATGTAGAAGG + Intergenic
1000604039 5:163309176-163309198 ACAGACTGGCTGAATGAAGTAGG - Intergenic
1001105836 5:168853873-168853895 AAGGCCTTGATGAATGAGGAGGG - Intronic
1001107297 5:168865588-168865610 GAGGACTGGCTGAAGACAGAAGG + Intronic
1001459660 5:171899916-171899938 AAGGACTTTCAGAAAGAAGAGGG - Exonic
1002965331 6:1960514-1960536 ATGGAAGGGCTGAATGAACATGG + Intronic
1004035655 6:11920503-11920525 AAGAACAGGCTGACTGAAGCTGG - Intergenic
1004221108 6:13747145-13747167 AAGGACTGGCAGAGTGTAAAGGG + Intergenic
1006183516 6:32167712-32167734 AGGGAATGCCTGAATGGAGAGGG - Intronic
1007401335 6:41604262-41604284 GAAGACTGGCTGAATTAACAGGG + Intergenic
1007851806 6:44810288-44810310 ATGGACTGGCTAACAGAAGACGG + Intronic
1008012375 6:46482029-46482051 AAGGACTGGCTGATCCAAAAAGG + Intronic
1008240119 6:49099846-49099868 AAGGACTGGCTTTATGAATCTGG - Intergenic
1008608743 6:53166605-53166627 AAGCACTGGCTGAATGTTGAAGG + Intergenic
1009972902 6:70643797-70643819 AAGGAAAGGCTGATTAAAGAGGG - Intergenic
1010297805 6:74220941-74220963 AAGGACTTGCTGTATGAATCTGG + Intergenic
1010421509 6:75681546-75681568 AAGGACTGCTTGAATGTAGAAGG - Intronic
1011758553 6:90532083-90532105 AAGGAGGTGCAGAATGAAGATGG + Intronic
1013342839 6:109232105-109232127 GAGGAGTGGCAGAAGGAAGAGGG - Intergenic
1013909125 6:115252558-115252580 AAGGACTTGCTTTATGAATATGG - Intergenic
1014938364 6:127410590-127410612 AAGGACTTGCTTTATGAAGCTGG + Intergenic
1015096220 6:129417541-129417563 AGGGACTGCCTGAAGGAAGGGGG - Intronic
1016408642 6:143758559-143758581 TAAGACTGGCTGAGTTAAGAGGG + Intronic
1016452653 6:144198978-144199000 GATAACTGGCAGAATGAAGAAGG - Intergenic
1016655407 6:146513310-146513332 AAGGACTTGCTTTATGAAGCTGG + Intergenic
1016892768 6:149022791-149022813 AGGGACTTGCTGAAGGAAGGTGG + Intronic
1016913145 6:149218706-149218728 TATGACTGCCTGGATGAAGAAGG + Intronic
1016928310 6:149376605-149376627 AAGGACTGAGTTAATGAGGAAGG - Intronic
1018371329 6:163170836-163170858 AAGGAGTGGGAGAATGAAGGAGG - Intronic
1018433763 6:163743655-163743677 AAGCACTGCCTGAAAGGAGAAGG - Intergenic
1018890719 6:167979623-167979645 AGGGACTGGCTGGAGGAAGGGGG - Intergenic
1019116795 6:169771618-169771640 GAGGACTTGAGGAATGAAGATGG - Intronic
1020494665 7:8834375-8834397 AAGGAATAGTTGAATGAAGAGGG + Intergenic
1021274047 7:18627037-18627059 AAGATCTGGGTGAATGTAGAAGG - Intronic
1021282467 7:18737914-18737936 AAGGACTTGCTGTATGAATCTGG + Intronic
1021287075 7:18793551-18793573 AAGGAAGGGCAGAAGGAAGAGGG + Intronic
1021460353 7:20880064-20880086 AAGGACTAGCTAAATGTAGTAGG + Intergenic
1021516672 7:21496801-21496823 AATGACTGGCTGAGTGCTGAAGG - Intronic
1022582463 7:31569541-31569563 ATGTACTGGCTCAATGGAGAGGG - Intronic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1024012771 7:45284209-45284231 AATGACTGGATAAATAAAGAGGG - Intergenic
1024634565 7:51276516-51276538 AAGGACTGGCATTATCAAGAGGG - Intronic
1026586330 7:71659000-71659022 AAAGACTGGCAGCATGAAGAGGG - Intronic
1027525057 7:79258425-79258447 ATGGCCTGGTTGAAGGAAGAAGG - Intronic
1027578695 7:79964587-79964609 AATGAATGGATGAATGAAGATGG - Intergenic
1029650795 7:101890077-101890099 AGGGACTGGCTGGAGGAAGAGGG + Intronic
1029945503 7:104528543-104528565 AAGAACTAGTTGAATGAACAAGG + Intronic
1029957510 7:104655031-104655053 TTGGACTAGCTGAAGGAAGAAGG - Intronic
1030098600 7:105923879-105923901 AAGGCCTGGCTGAGTGTAGCTGG + Intronic
1030473567 7:109999206-109999228 AAGAAATGGCAGAATGAGGATGG - Intergenic
1031664338 7:124466379-124466401 AAGGACTGGCTTTATGAATCTGG + Intergenic
1033102686 7:138489003-138489025 AAGGACTTGCTGTATGAATCTGG + Intronic
1034064590 7:148124103-148124125 AGGGACTGGCTGAAGGAGCAAGG + Intronic
1035262931 7:157673405-157673427 AACAGCTGGCTGGATGAAGAAGG + Intronic
1037974947 8:23202386-23202408 AAGGCCTGGCTGAGTGGACAGGG - Intronic
1038612905 8:29070919-29070941 AGGGACTGGCTAAATGAATGTGG + Intronic
1040900786 8:52414972-52414994 CAGGTTTGGCTGGATGAAGAAGG - Intronic
1042312174 8:67389824-67389846 AAAGACTGGCTTAATTAATAGGG - Intergenic
1042413042 8:68486364-68486386 AAGGACTTGCTGTATTATGAAGG - Intronic
1042490330 8:69390592-69390614 AAGAATTAGCTGGATGAAGAGGG - Intergenic
1042949055 8:74182228-74182250 AAGGATTTGCTGAATCAAAAGGG - Intergenic
1043369247 8:79571937-79571959 AAGAAATGGCTGGATGAGGACGG - Intergenic
1043697110 8:83233395-83233417 AAGGACTTGCTTTATGAATATGG - Intergenic
1043819185 8:84841454-84841476 AAGGACTTGCTGTATGAATCTGG - Intronic
1044225235 8:89710660-89710682 AAGGACTTGCTGTATGAATCTGG - Intergenic
1044845007 8:96371926-96371948 TAGGACTGGAAGAAAGAAGAGGG - Intergenic
1045135358 8:99211156-99211178 AATGAGAGGCTGAATGAAGTAGG + Intronic
1048079400 8:131108907-131108929 AAGGACTGGCTGATTAATAAGGG - Intergenic
1050322682 9:4469122-4469144 AAGGACTTGCTTAATGAATCTGG - Intergenic
1051088115 9:13375773-13375795 AAGGACTAGCTGAATGCAGGGGG + Intergenic
1051808651 9:21025718-21025740 AAAGACAGGTTGAAGGAAGATGG - Intronic
1053317731 9:37066441-37066463 AGGGAGTGGCTGTATGAAGAAGG + Intergenic
1053322108 9:37107882-37107904 AGGGAGTGGCTGTATGAAGAAGG + Intergenic
1054894350 9:70291291-70291313 ACTGCCTGGCTGAATGATGAAGG - Intronic
1054990652 9:71321764-71321786 AAGTATTTGCTGAATGAATAAGG - Intronic
1055044726 9:71911874-71911896 AAGGAATGGCTCACTGGAGAGGG + Intronic
1055652697 9:78422378-78422400 AAGGAGTGGCTCAATGATAAAGG + Intergenic
1056933096 9:90894904-90894926 AAGGACTGGCTATATTAAGGTGG + Intronic
1057175705 9:92997130-92997152 AAGGACTTGCTTTATGAATATGG + Intronic
1058217697 9:102255417-102255439 GAGGAGTTGCGGAATGAAGAAGG - Intergenic
1060296890 9:122348984-122349006 AAATACTGGCTGAAAGAACAAGG + Intergenic
1060728329 9:126021020-126021042 AAGGACAGCCTGAGTGGAGAGGG - Intergenic
1060729957 9:126030936-126030958 AAGGTGTGGCTGAATCATGAGGG - Intergenic
1061263002 9:129490227-129490249 AAGGCCTGGAGGCATGAAGATGG - Intergenic
1062315457 9:135964950-135964972 GAGGAGAGGCTGCATGAAGATGG - Intergenic
1187633644 X:21203044-21203066 AAAGACTGGCTGACTGAGGAAGG + Intergenic
1188046412 X:25430253-25430275 AACAACTAGCTGAATGAAGTTGG + Intergenic
1189017454 X:37299099-37299121 AAGGACTTGCTGTATGAATCTGG + Intergenic
1189988237 X:46572641-46572663 AACAACTGGCTGGAAGAAGAGGG + Intergenic
1190287007 X:48968149-48968171 AAGGAATGACTGAATGAATTGGG - Intronic
1190807414 X:53852100-53852122 AAGGACTTGCTTAATGAATCTGG + Intergenic
1191702761 X:64061147-64061169 AAGGACTTGCTGTATGAATCTGG + Intergenic
1192784881 X:74325874-74325896 AACCACTGGCTGAATGACAAAGG + Intergenic
1193071155 X:77306916-77306938 AAGGACTTGCTTTATGAAGCTGG - Intergenic
1193452365 X:81686405-81686427 AAGGACTTGCTGTATGAATCTGG - Intergenic
1199509818 X:148609499-148609521 AGTGACTGGCTGAATTAAAAGGG + Intronic
1199659620 X:150035902-150035924 AAGTACTGCCTCACTGAAGAGGG - Intergenic
1201062512 Y:10059730-10059752 AGAGGCTGGGTGAATGAAGATGG - Intergenic
1201956335 Y:19627796-19627818 AAGGACTTGCTGAATGAATCTGG + Intergenic
1202111705 Y:21427737-21427759 AGGGGCTGGGTGAATGAGGATGG - Intergenic