ID: 1153369217

View in Genome Browser
Species Human (GRCh38)
Location 18:4295004-4295026
Sequence CCTCATCTGCTCCTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 3, 1: 15, 2: 34, 3: 121, 4: 499}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153369212_1153369217 7 Left 1153369212 18:4294974-4294996 CCAGTTTGCTAATCTCCTTGTTT 0: 1
1: 0
2: 2
3: 24
4: 260
Right 1153369217 18:4295004-4295026 CCTCATCTGCTCCTGGAGCCTGG 0: 3
1: 15
2: 34
3: 121
4: 499
1153369210_1153369217 30 Left 1153369210 18:4294951-4294973 CCTCTGCTGCATTGTTCTGCCAT 0: 1
1: 0
2: 4
3: 21
4: 213
Right 1153369217 18:4295004-4295026 CCTCATCTGCTCCTGGAGCCTGG 0: 3
1: 15
2: 34
3: 121
4: 499
1153369213_1153369217 -8 Left 1153369213 18:4294989-4295011 CCTTGTTTCCTGTCTCCTCATCT 0: 1
1: 0
2: 4
3: 68
4: 739
Right 1153369217 18:4295004-4295026 CCTCATCTGCTCCTGGAGCCTGG 0: 3
1: 15
2: 34
3: 121
4: 499
1153369211_1153369217 11 Left 1153369211 18:4294970-4294992 CCATCCAGTTTGCTAATCTCCTT 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1153369217 18:4295004-4295026 CCTCATCTGCTCCTGGAGCCTGG 0: 3
1: 15
2: 34
3: 121
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153369217 Original CRISPR CCTCATCTGCTCCTGGAGCC TGG Intronic
900188357 1:1343233-1343255 CCTCATCTGTTCCTGGGGCTTGG + Intronic
900653070 1:3740675-3740697 CCTCAAGTGATCCTGCAGCCTGG + Intergenic
900673966 1:3872543-3872565 CCTCTTCAGCACCTGGAACCTGG + Exonic
900745247 1:4356439-4356461 TCTCATTTGCCCCTGCAGCCCGG + Intergenic
900752447 1:4407177-4407199 GCTCAACTGATCCTGGGGCCTGG - Intergenic
900806403 1:4770770-4770792 CCTCCTCTGATCCCAGAGCCTGG - Intronic
900933397 1:5750728-5750750 CCCCACCTGCCCCTGGAGACTGG + Intergenic
900945919 1:5831395-5831417 CCTCACCAGCTCCAGGAGCCAGG - Intergenic
901195152 1:7436271-7436293 CTTCATCTGCTCCTGAGGACAGG - Intronic
902044163 1:13512987-13513009 CCACCTCTTCTCCTGGATCCAGG - Exonic
902400663 1:16155227-16155249 CCTAACCTGCCCCGGGAGCCCGG + Intronic
902635785 1:17734285-17734307 CCTCATCTTCTTCTGGAGAATGG - Intergenic
902774656 1:18666941-18666963 CCTCAGCCTATCCTGGAGCCAGG - Intronic
903448595 1:23437702-23437724 CCTCGTCTGAGCCTGGAACCAGG - Intronic
904534635 1:31190958-31190980 CCTCAGCTGCACCATGAGCCTGG - Intronic
904627469 1:31815102-31815124 CCTCAGCAGCACCTGCAGCCCGG + Exonic
905371761 1:37486254-37486276 CCTCATCAGCTTCTGGCTCCTGG - Intergenic
905446064 1:38029170-38029192 CCTCTGCTGCAGCTGGAGCCTGG + Intergenic
905653001 1:39668932-39668954 CTTCAGCTCCACCTGGAGCCTGG - Intronic
905730951 1:40299407-40299429 CCTCACTTGCTCCTAGTGCCTGG - Intergenic
906624468 1:47313911-47313933 CGTCATCTGCTCCAGGCTCCTGG + Intronic
906860478 1:49353720-49353742 ACTCTTCTGCTCGTGGAGCCTGG - Intronic
907501310 1:54883578-54883600 CCCCACCTGCTCCCAGAGCCCGG + Intronic
909486572 1:76180588-76180610 CCTCATCTGCTTCTGGAGTCTGG - Intronic
909585511 1:77283108-77283130 CATCATCTGCACCGGGACCCGGG + Intronic
909804659 1:79859130-79859152 CCTCATCTGCTTCTGGAGTCTGG + Intergenic
910449668 1:87332156-87332178 CCTCAAGTGCTCCTGCTGCCAGG + Exonic
910907090 1:92192594-92192616 GGTGATCTTCTCCTGGAGCCAGG + Intergenic
912261772 1:108118093-108118115 CCTCAGATGCTTCTGGAGTCTGG - Intergenic
912512256 1:110197583-110197605 CCTCACCTCCTCCTTGATCCAGG - Exonic
914221614 1:145686890-145686912 CCTAATCTGCACCTGGATCTCGG - Intronic
914323824 1:146591688-146591710 CCTCTTCTGCACATGGACCCTGG + Intergenic
915292560 1:154896475-154896497 CCTCATCTGCTCCCTGGGGCCGG - Intergenic
915380248 1:155433629-155433651 CCTCTTCTGCTTCAGGAGCTTGG - Intronic
916384230 1:164249568-164249590 GTTCATCTGCTCTTGGAGCCTGG - Intergenic
917525430 1:175784275-175784297 CCTCCTCTGTTCCAGGAGCTGGG - Intergenic
917539875 1:175902010-175902032 GTTCATCTGCTCATGGAGCCTGG - Intergenic
917789445 1:178490172-178490194 CATCATCGGCACCTGCAGCCAGG + Intergenic
918794483 1:188874753-188874775 GCTCATCTGCTTTCGGAGCCTGG + Intergenic
919048141 1:192480162-192480184 GCTTGTCTGCTTCTGGAGCCTGG - Intergenic
919777900 1:201206144-201206166 ACTCTTCTGCTCCTGATGCCTGG - Exonic
920095471 1:203483693-203483715 CCTCAGCTGCTCCAGGTTCCGGG - Exonic
920269503 1:204752395-204752417 CCTGCTCTGATCTTGGAGCCGGG + Intergenic
920314029 1:205065184-205065206 CCTCACCTTCACCTGGACCCTGG + Exonic
920916153 1:210259689-210259711 CCTGAGCTGCTCCTGGCTCCAGG + Intergenic
920921220 1:210298773-210298795 GCTCTTCTGCTTGTGGAGCCTGG + Intergenic
920950326 1:210566519-210566541 CCTCATCTGCTTCTGGAGCCTGG - Intronic
921097727 1:211901587-211901609 CCTGATCTGATCTTGGAGCAAGG + Intergenic
921264431 1:213410630-213410652 ACTCCCCTGCTCCTGCAGCCAGG - Intergenic
921520904 1:216152902-216152924 GCTCTTCTGCTCATGGAGCCTGG - Intronic
921632862 1:217455839-217455861 CCTTGTCTGCTGCTGGAGCCTGG - Intronic
922110008 1:222547471-222547493 CCTCTCATTCTCCTGGAGCCTGG + Intronic
922726738 1:227926312-227926334 CCTCAACTGCTCCAGGAACCCGG + Intronic
922746675 1:228048168-228048190 CCTGAGGTTCTCCTGGAGCCAGG - Intronic
922913300 1:229235163-229235185 CCTTGTCTGCTTCTGGAGCCTGG + Intergenic
923291856 1:232553332-232553354 GCCCGTCTGCTCATGGAGCCTGG + Intronic
923315198 1:232773386-232773408 CCTCGTCTGCTTCTGGAGCGTGG - Intergenic
924643752 1:245857943-245857965 CCTCAGCTTCTCCTTGAGTCAGG - Intronic
1063019953 10:2117544-2117566 GCTCATCTGCCTCTGGAGCCAGG + Intergenic
1063452938 10:6163652-6163674 CCGCAGCTGCTCCCGGGGCCCGG - Intronic
1063522997 10:6757960-6757982 GCTCATCTGCTTGTGGAGCCTGG + Intergenic
1063523384 10:6760974-6760996 GTTCATCTGCTTCTGGAGCCTGG - Intergenic
1064600160 10:16985221-16985243 GCCCATCTGCTCGTGGAGCCTGG - Intronic
1064709519 10:18109335-18109357 GCTCCTCTGCTTCTGGAACCTGG - Intergenic
1064722692 10:18246008-18246030 GCTCTTCTACTCCTGGAACCCGG + Intronic
1065009773 10:21410742-21410764 GCTCGTCTCCTTCTGGAGCCTGG + Intergenic
1065011756 10:21427395-21427417 GCTCATCTCCTCCTGGAACCAGG + Intergenic
1065189538 10:23197100-23197122 CCACTTCTGCACCTGGAGCTGGG + Intergenic
1065304377 10:24354766-24354788 GCTCTTCTGCTCATGGAGCCTGG + Intronic
1065428679 10:25631668-25631690 CCTCCTCTGCTCCCCGTGCCAGG + Intergenic
1065864230 10:29899737-29899759 CCTCAGCTTCTCCAGGAGCTGGG - Intergenic
1066066577 10:31765381-31765403 CCCCATCTGCTCCTGGAGAGAGG + Intergenic
1066287535 10:33982663-33982685 GCTCATCAGCTTCTGGAGCCTGG + Intergenic
1067578084 10:47420330-47420352 CCACATCTGCATCCGGAGCCTGG - Intergenic
1067802754 10:49370460-49370482 CCTCATCTGCACCCCAAGCCTGG + Intronic
1068403779 10:56563985-56564007 GCTCATTTGATCCTGTAGCCTGG - Intergenic
1068497927 10:57808562-57808584 GCTCATCTGCTTGTGGAGCCTGG + Intergenic
1068656064 10:59577578-59577600 CCTCATCTGCTTCTGGAGCCTGG + Intergenic
1069398041 10:68010810-68010832 CCTCTTCTGCTTCAGGAGCTTGG + Intronic
1069894621 10:71672761-71672783 CCTCAGCTGCTCCAGGCCCCAGG + Intronic
1070283179 10:75065018-75065040 TCTCACTTGCTCCTGGGGCCTGG + Intergenic
1070639637 10:78158447-78158469 CGTCATCTGCTCTTGAAGCAAGG + Intergenic
1070855283 10:79603599-79603621 GCTGGTCTGCTTCTGGAGCCTGG + Intergenic
1071124750 10:82320886-82320908 GCTCTTCTGCTCGTGGAGCTTGG - Intronic
1072275480 10:93818276-93818298 CCTCATCTGATCCTGGCGCCTGG + Intergenic
1072570561 10:96654465-96654487 CCTCAGCAGCCCCAGGAGCCAGG - Intronic
1073332787 10:102681605-102681627 CCTCTCCTCCTCCTGGAGACAGG - Intronic
1073812457 10:107165020-107165042 CATCGACTGCTCCGGGAGCCCGG - Intergenic
1074182389 10:111076551-111076573 CCGCAGGTGCTCCTGGAGGCTGG - Intergenic
1074304873 10:112267793-112267815 CATCATCTGCTTCTGGACCAGGG + Intergenic
1074815245 10:117137571-117137593 CCTCATCTCCCCCCGCAGCCCGG + Intronic
1074941080 10:118236413-118236435 CCTCAGGTGCTCCTTGGGCCAGG + Intergenic
1075689654 10:124386657-124386679 CCTCACCTGTTCCTGTTGCCTGG - Intergenic
1075997761 10:126892470-126892492 CCTGAACAGCTCTTGGAGCCTGG - Intergenic
1076853220 10:133103142-133103164 CCACATCTGCAGCTGGAGCCCGG + Intronic
1076909751 10:133381087-133381109 TCTCATCTGCACCTGGTACCTGG - Intronic
1077167222 11:1149124-1149146 GCCCACCTGCTCCTGGAGCTGGG + Intergenic
1077712421 11:4550676-4550698 CCTCATCTGCTTGTGGGGTCTGG - Intergenic
1077712951 11:4554190-4554212 GCTCATATGTTTCTGGAGCCTGG - Intergenic
1078014446 11:7601124-7601146 CCTCTTGTGCTCCTGGAGGAAGG - Intronic
1078050362 11:7960505-7960527 CTCCATCTGCCCCTGCAGCCAGG + Exonic
1078514307 11:12009234-12009256 CCGCATCTGCACCCGCAGCCCGG - Intronic
1079538098 11:21539676-21539698 GCTCATCTGCTTGTGGAGCCTGG + Intronic
1080502633 11:32885285-32885307 GCTCATCTGCTTCTGGAGCCTGG - Intergenic
1080645094 11:34182389-34182411 CCTCATCTCCTCCAGCAGCCAGG + Intronic
1080700304 11:34638792-34638814 CCCCATCTTCTGCTGGAGGCAGG - Intronic
1081062936 11:38503346-38503368 CCTCATCTGCTTCTGGAACCTGG + Intergenic
1081216660 11:40407541-40407563 CCTCATCTTCTCCTGGAATGAGG + Intronic
1081312613 11:41592329-41592351 GCTCATCTGCCTCTGGATCCTGG + Intergenic
1081609980 11:44556070-44556092 CCTCACCTGGCCCTGCAGCCAGG + Intergenic
1082748702 11:56995686-56995708 TCTCATCTGCTTCTGAAGCCTGG + Intergenic
1083325757 11:61872194-61872216 CATCATTTGCTGCTGGAGGCTGG - Intergenic
1083485707 11:62981834-62981856 CTTCATCTACTCCTGGTGCGTGG - Exonic
1083640963 11:64145050-64145072 CCTCATCCTCTCCTGCCGCCTGG - Intronic
1083678960 11:64342607-64342629 CCTCAGCTCCTCCTGCAGGCGGG - Exonic
1084183040 11:67456010-67456032 CCTTTTGTGCTCCTAGAGCCTGG - Intronic
1084297253 11:68220937-68220959 CCTCATCTGCACCTTAAACCTGG - Intergenic
1084638220 11:70407570-70407592 CTTGATATGCTCCTGGTGCCCGG - Exonic
1084802781 11:71555696-71555718 CCTCGTCCGCTCCAGGAGGCAGG + Intronic
1085525641 11:77161947-77161969 CCTCCTCTGCACCTGGAGGGAGG + Intronic
1087822378 11:102726978-102727000 CCTCACCTGCTTCTGGTCCCTGG + Intronic
1087896237 11:103589821-103589843 ACTCTTCTGCTTATGGAGCCTGG - Intergenic
1087933684 11:104006620-104006642 CCTCATCTGCTTCTGGAGCCTGG - Intronic
1087945934 11:104160690-104160712 CCTCATGTTCTCCTGGAGACGGG + Intronic
1088450596 11:109977579-109977601 GTTCATCTGCTCATGGAGCCTGG - Intergenic
1088748520 11:112824398-112824420 GTTCATCTGCTTGTGGAGCCTGG - Intergenic
1088802629 11:113320328-113320350 GCTCGTCTGCTTCTGGAGCCTGG - Intronic
1089108967 11:116039391-116039413 CCTTCTGTTCTCCTGGAGCCAGG + Intergenic
1089163490 11:116457475-116457497 CCTCACCAGCTTCTGGAGGCTGG + Intergenic
1089602411 11:119623978-119624000 CCTCCCCTGCACCAGGAGCCGGG + Intronic
1090083040 11:123627046-123627068 CCTCAACAGGCCCTGGAGCCAGG + Intronic
1090207495 11:124893978-124894000 CCTCAGCTGCTCCAGGGTCCAGG + Exonic
1090540747 11:127700507-127700529 GAGCATCTGCTTCTGGAGCCTGG + Intergenic
1090554145 11:127855763-127855785 GCTCTTCTGCTCATGGAGCCTGG + Intergenic
1090590442 11:128261530-128261552 GCTCTTCTGCTCATGGAGCCTGG + Intergenic
1091294805 11:134466205-134466227 CTTCATGTGCTCCTGGAGAAGGG + Intergenic
1091323254 11:134666274-134666296 CCTCATCTGCCCCTGAGACCTGG + Intergenic
1092226488 12:6751672-6751694 CCTCATGTGTTCCTGTAGGCTGG - Exonic
1092396813 12:8134381-8134403 CCTCTTCTGCTTCAGGAGCTTGG + Intronic
1092505271 12:9092304-9092326 CTCCATCTACTCCTGGAGCTAGG - Intronic
1093749260 12:22779722-22779744 GCTCTTCTGCTCATGGAGCCTGG + Intergenic
1093769084 12:22998828-22998850 GCTCTTCTGCTCATGGAACCTGG - Intergenic
1094696937 12:32829158-32829180 CCTCATGTGATCCTCCAGCCTGG + Intronic
1094716404 12:33018823-33018845 ACTCATCTCCTTCTGGAGCCTGG - Intergenic
1095966453 12:47870405-47870427 CCTCAGCTGCTCTCTGAGCCTGG + Intronic
1096071894 12:48780110-48780132 CCTCTTGGGCTCCTGGGGCCAGG - Intronic
1096501219 12:52064781-52064803 CCTCGTTTTCTCCTGGTGCCTGG + Intergenic
1097192766 12:57227246-57227268 CCTCATCTTCGCCTTGAGTCCGG + Intergenic
1097260381 12:57716479-57716501 CCTCCTCCCCTCCTGGGGCCTGG - Exonic
1097290803 12:57913495-57913517 CCTTGTCTGCTTCTGGAGCCTGG - Intergenic
1097461847 12:59872045-59872067 CCTCATTAGATCCTGGTGCCAGG + Intergenic
1098166679 12:67705631-67705653 CCACATCTGCTCCAGCAGCCTGG + Intergenic
1098584802 12:72142688-72142710 GCTGGTCTGCTGCTGGAGCCTGG - Intronic
1098744112 12:74213742-74213764 GCTCATCTGCTTCTGGAGCCTGG + Intergenic
1098784715 12:74737549-74737571 CAGCATATGCTACTGGAGCCTGG - Intergenic
1099509615 12:83517845-83517867 GCTCTTCTGCTCTTGGAGCCTGG - Intergenic
1100131770 12:91502923-91502945 CTTTGTCTGCTTCTGGAGCCTGG + Intergenic
1100386984 12:94112753-94112775 GCTCATATGCTTCTGGAGCCTGG - Intergenic
1100478098 12:94952570-94952592 TCTCATCTGCTTGTGGAACCTGG - Intronic
1100978520 12:100146190-100146212 GCTCATCTGCTTGTGGAGCCTGG + Intergenic
1101224374 12:102673184-102673206 ACTCATATGCTTATGGAGCCAGG + Intergenic
1101567661 12:105923338-105923360 ACTTATCTTCTCCTGGATCCAGG - Intergenic
1102681739 12:114695128-114695150 CCGAAACTGCTCCTGGAGGCTGG + Intergenic
1102715951 12:114972748-114972770 CCTCATCAGGGCCTGGAACCAGG + Intergenic
1103506360 12:121444204-121444226 CATCTTCTGCTCCTTGAGCAGGG + Exonic
1103715769 12:122944593-122944615 CCTCACCTCCCCCTGCAGCCTGG - Intronic
1104096833 12:125565767-125565789 GTTCATCTCTTCCTGGAGCCAGG + Intronic
1104736554 12:131139004-131139026 CCTCATCTCCCCCAGGAGCATGG + Intronic
1104816337 12:131648080-131648102 CAACATCTCCTCGTGGAGCCGGG + Intergenic
1105459890 13:20574403-20574425 CTTCATCTGTCTCTGGAGCCAGG - Exonic
1105510257 13:21045832-21045854 TCTCATCTGCTGCTGCTGCCTGG + Exonic
1105703178 13:22948965-22948987 CCTCACCTGCTCCTGACACCGGG + Intergenic
1106815469 13:33402644-33402666 GCTCATCTGCTTCTGGAGCCTGG - Intergenic
1106879376 13:34112760-34112782 GTTCATCTGCTCATGGAGACTGG - Intergenic
1107401942 13:40077745-40077767 TCTCAGCTCCTCCTGGGGCCTGG + Intergenic
1108297432 13:49038166-49038188 GCTCATCTCCTTCTGGAGCCTGG + Intronic
1108799783 13:54081552-54081574 CTTCATCTGCTTCTGGAGTCTGG - Intergenic
1108846104 13:54679663-54679685 CCTCGTCTGCTTCTGAAGCTTGG - Intergenic
1109300703 13:60587192-60587214 GCTTGTCTGCTCTTGGAGCCTGG - Intergenic
1109958656 13:69602817-69602839 GCTCATCTTCTCCTGGAACCTGG - Intergenic
1111274152 13:85925985-85926007 CCTGATCTGTTCCTGAGGCCAGG - Intergenic
1111668158 13:91295780-91295802 GCTCCTCTCCTCCTGGAGCTAGG - Intergenic
1112558687 13:100492725-100492747 ACTCTTCTGCTTGTGGAGCCTGG - Intronic
1112605171 13:100897398-100897420 GCTCATGTGATCCTGGAGTCTGG + Intergenic
1113061987 13:106331849-106331871 GCTCATCTGCTTCTGGAGCCTGG + Intergenic
1114529108 14:23384407-23384429 CCACATCTACTCCTGGTGTCTGG + Intronic
1116860944 14:49995216-49995238 CCTAATCTGCTCTTGGACTCAGG - Intronic
1117390336 14:55256368-55256390 GTTCATCTGCCCATGGAGCCTGG - Intergenic
1118400278 14:65373347-65373369 ACTCTTCTGCTTGTGGAGCCTGG - Intergenic
1118474267 14:66102186-66102208 CCTCATCTGCTTCTGGGGCCTGG - Intergenic
1118885310 14:69860784-69860806 CCTCTTCTGCTCTTGGAAGCCGG + Intronic
1119023836 14:71137117-71137139 GCTCATCTACTCCTGGAGCTGGG + Intergenic
1119281962 14:73416943-73416965 GCTCTTCTGCTTGTGGAGCCTGG - Intronic
1119298503 14:73552493-73552515 CCTCCTCTGAGCTTGGAGCCTGG - Intronic
1119302800 14:73584680-73584702 CCTCCTCTGAGCTTGGAGCCTGG - Intergenic
1120128166 14:80772246-80772268 TCTTTTCTGCTCATGGAGCCAGG - Intronic
1120218396 14:81705148-81705170 GCTCTTCTGCCCATGGAGCCTGG + Intergenic
1120685340 14:87530942-87530964 CCTCATCTGCTTCTGGAGCCTGG - Intergenic
1120713292 14:87815349-87815371 GCTCATCTGCTTCTGCAGCCTGG - Intergenic
1121172731 14:91868326-91868348 CCCCGTCTGCTTCTGGAGCCTGG + Intergenic
1121666495 14:95676453-95676475 CCTCATCTGCTTCTGGAGCCTGG - Intergenic
1121965139 14:98296788-98296810 CCTCAGCTCCTGCTGGAGCCTGG + Intergenic
1122114011 14:99518708-99518730 CCTCATCTGCACCAGGCCCCTGG + Intronic
1122155861 14:99750092-99750114 CGTCACCTGAGCCTGGAGCCAGG + Intronic
1122695820 14:103551545-103551567 CCACCACTGCTGCTGGAGCCGGG - Intergenic
1125408958 15:39384708-39384730 CGTTAACTGCTCGTGGAGCCCGG + Intergenic
1125932970 15:43613108-43613130 CCACAGCAGCTCCTGGGGCCAGG + Exonic
1125946069 15:43712570-43712592 CCACAGCAGCTCCTGGGGCCAGG + Intergenic
1126277006 15:46895276-46895298 GCTTGTCTGCTCGTGGAGCCTGG + Intergenic
1127312786 15:57767412-57767434 CCCCATTTGCTCCTGCAGCTGGG + Intronic
1127931138 15:63598212-63598234 ATTCATCTACTCCTGGAGTCTGG - Intronic
1128318276 15:66674979-66675001 CTTGATCTGCTCCTGGGGCAGGG + Intronic
1129236349 15:74225911-74225933 CCTCAGCTGCTCCTGACCCCAGG - Intergenic
1129467271 15:75731139-75731161 CCTCTTCTGCTCCTGGCCCAGGG - Intergenic
1129719955 15:77872578-77872600 CCTCTTCTGCTCCTGGCCCAGGG + Intergenic
1129912116 15:79236517-79236539 CCTCTCCTGCTCCAGCAGCCCGG - Intergenic
1129925961 15:79364602-79364624 GCTTGTCTGCTCCTGGAACCTGG - Intronic
1130171935 15:81523671-81523693 GCTCATCTGCTTCTGGAGCCTGG + Intergenic
1131067254 15:89442388-89442410 TCTAATGTGCTTCTGGAGCCAGG + Intergenic
1131114386 15:89785049-89785071 GCTCATCTGGCCCTGGAGCTGGG + Exonic
1132213170 15:100041464-100041486 CCTCAGGTGGTCCTGGAGCAAGG - Intronic
1132508025 16:322231-322253 GGTCACCTCCTCCTGGAGCCTGG - Intronic
1133076192 16:3282998-3283020 CCTCGTCGGCTCCGGAAGCCAGG - Exonic
1133197327 16:4180431-4180453 CCACCTCTGCACCTGGAGGCAGG - Intergenic
1134873696 16:17676353-17676375 GCTCATCTGTGCTTGGAGCCTGG + Intergenic
1137397118 16:48124032-48124054 CCTCATCTGGCCCAGGGGCCTGG + Intronic
1137571022 16:49566377-49566399 ACCCATCTGCTCCAGGAGCAGGG - Intronic
1138977901 16:62230390-62230412 CCTCATTTCCTTCTGGATCCTGG - Intergenic
1139093781 16:63680294-63680316 GCTCATCTGCCTCTGGAACCTGG + Intergenic
1139295277 16:65895193-65895215 GCTTGTCTGCTTCTGGAGCCCGG - Intergenic
1139328073 16:66167266-66167288 GCTCATCTCCTTCTGGAGTCTGG + Intergenic
1139403039 16:66696937-66696959 CCCCACCTGCGCCTAGAGCCGGG + Intergenic
1140009739 16:71119156-71119178 CCTCTTCTGCACATGGACCCTGG - Intronic
1140339133 16:74139957-74139979 CCTTGTCTGCTTCTGGAGCCTGG + Intergenic
1141285747 16:82670007-82670029 CCGTATCTGCTCCTTGAGGCAGG - Intronic
1141447350 16:84069756-84069778 GCTCAGCTTCTCGTGGAGCCTGG - Intronic
1141615556 16:85207617-85207639 CCTCATCTGGCTCTGCAGCCCGG - Intergenic
1141644288 16:85358986-85359008 CCACATCTGCCCCGTGAGCCAGG - Intronic
1141816010 16:86409644-86409666 CCTTCTCTGCTGCTTGAGCCCGG - Intergenic
1142144773 16:88488260-88488282 CCTTATCTGATCTAGGAGCCAGG + Intronic
1142591953 17:1010153-1010175 CCCCTTCTGCTGCTGGAGCGTGG + Intronic
1143230895 17:5353731-5353753 CCTCATCCTCTCGTGTAGCCGGG - Intronic
1143253217 17:5537726-5537748 CCTCCTTCCCTCCTGGAGCCGGG - Intronic
1143347169 17:6258394-6258416 CCCCATCTGCTCCTCTATCCTGG - Intergenic
1144371341 17:14594458-14594480 GCTCATCTGCTTCTGGAGACTGG - Intergenic
1145289150 17:21529442-21529464 CTTCATCTGCTCCTGGAGCCTGG - Exonic
1146255347 17:31389031-31389053 CCTCTTGGGCTCCTAGAGCCTGG + Intergenic
1146282904 17:31557128-31557150 CCTTCTCTGCCCCTGGAGGCAGG + Intergenic
1147448381 17:40488787-40488809 CCTCATCTTCTCTGGGAACCAGG - Exonic
1147539346 17:41343959-41343981 GGTCATCAGCTCCTCGAGCCAGG - Intergenic
1148496293 17:48055116-48055138 CCGCCTCTGCTCCTGGGTCCAGG + Intronic
1148716158 17:49717629-49717651 CCCCTCCTCCTCCTGGAGCCTGG - Exonic
1148759285 17:49991230-49991252 CCCTACCTGCTCCAGGAGCCTGG - Exonic
1149102968 17:52928187-52928209 CCTCATCTGCTTCTGGAGCCTGG + Intergenic
1149117785 17:53118671-53118693 CCTCATGTGCTCCTTAAACCAGG + Intergenic
1149547069 17:57511529-57511551 TCTCATTTGCTCCTGGAGCGGGG + Intronic
1150132881 17:62678774-62678796 CTGCATCTGCTGCTGGTGCCAGG + Intronic
1150435806 17:65153286-65153308 CCCCATCTGGTACAGGAGCCAGG - Intronic
1150845212 17:68650001-68650023 CCTCTTCAGGTTCTGGAGCCTGG - Intergenic
1152000747 17:77643982-77644004 CCACAGCTGCTCCTGGATCTGGG - Intergenic
1152520360 17:80852653-80852675 CCCCATCTGCCCCTCCAGCCTGG + Intronic
1152638989 17:81441922-81441944 CCCCATGGGCTCCTGCAGCCGGG + Exonic
1152664165 17:81557799-81557821 GCTCATCTGCTCTTGGGACCAGG - Exonic
1152711436 17:81872075-81872097 CCTCATCTGCTCACGGTGCCAGG - Intergenic
1152875917 17:82786133-82786155 AATCATCTGCACCTGGAACCAGG + Intronic
1153369217 18:4295004-4295026 CCTCATCTGCTCCTGGAGCCTGG + Intronic
1153643279 18:7173599-7173621 CCTCATCTGCCTCTGGACCACGG + Intergenic
1153681480 18:7504986-7505008 GCTCTTCTGCTCATGGAGCCTGG + Intergenic
1153783680 18:8515780-8515802 TATCAGCAGCTCCTGGAGCCTGG - Intergenic
1154079742 18:11244176-11244198 CCTCCTCTCCTCCCAGAGCCAGG - Intergenic
1156951888 18:42910550-42910572 GCTCATCTGCTCTTGGAGCCTGG - Intronic
1157485781 18:48085844-48085866 CTGAATCTGCTGCTGGAGCCAGG - Intronic
1158057926 18:53304116-53304138 GCTCATTTGCTTGTGGAGCCTGG + Intronic
1158318200 18:56235432-56235454 ATTCATCTGCTCCTGGCTCCAGG - Intergenic
1158536115 18:58309554-58309576 CCTCATCAGCTCCTTCAGGCAGG - Intronic
1160149432 18:76387945-76387967 GCTCTTCTGCTCTTGGAGCCTGG - Intronic
1160174315 18:76580265-76580287 CCTCCTGTGCTCCTGCACCCAGG + Intergenic
1160774833 19:850659-850681 CCTCCCCTTGTCCTGGAGCCAGG + Intergenic
1160937203 19:1602344-1602366 GCACAGCTGCTCCTGGAACCTGG + Intronic
1161104118 19:2434782-2434804 CATCACCTGCTTCTGGAGGCCGG + Exonic
1161277182 19:3425043-3425065 CTTCATCTGCTCCTGGGGTGGGG + Intronic
1161668410 19:5590624-5590646 CCTGAGCTGCCCCAGGAGCCAGG + Intronic
1161722098 19:5908832-5908854 CATCAGCTGCTCCTGGAGTGTGG - Exonic
1162947178 19:14051132-14051154 CCTCAGCTTCTCCAGGAGCTGGG - Intronic
1163152110 19:15421791-15421813 CCTCAACTGCTTCTTGATCCTGG + Exonic
1163717052 19:18878832-18878854 CCTCATCTGCTGCTGGGTCTTGG + Exonic
1163800015 19:19358979-19359001 CCTCATATGCTGATGGAGCATGG - Intergenic
1164539816 19:29114190-29114212 CCCCATCACCTCCTAGAGCCAGG - Intergenic
1164693324 19:30226495-30226517 CCTCCTGTGCCCCGGGAGCCTGG + Intergenic
1165073084 19:33266949-33266971 GCTCCACTGCACCTGGAGCCGGG - Intergenic
1165414855 19:35686594-35686616 CCTCATCTGCTCATAAAGTCAGG + Intergenic
1165422494 19:35729144-35729166 CCTCTTCTGCCCCAGGAGGCGGG + Exonic
1165755050 19:38288171-38288193 CCCCATCTCCTCCTGGAGGATGG + Intronic
1166364559 19:42272035-42272057 CCTCTGCTGGGCCTGGAGCCGGG - Intronic
1166458703 19:42967123-42967145 CCTCATCTGCTTCTGGAGCCTGG + Intronic
1166475652 19:43122394-43122416 CCTCATCTGCTTCTGGAGCCTGG + Intronic
1167742671 19:51333754-51333776 CCTCATTTCCTCCTGGAATCGGG - Intronic
1168060606 19:53889983-53890005 TCTCATCTGCTGTGGGAGCCCGG - Exonic
1168412537 19:56148620-56148642 CCTCCTCTGCTCCTGCCTCCTGG + Intronic
1168695279 19:58400741-58400763 CCTCATCTGCTCCCTGAGGTTGG - Intergenic
925306443 2:2850602-2850624 CCTCTGCTGCTCCTGATGCCTGG + Intergenic
926292558 2:11542341-11542363 CTGCATCTGCTCTTGGAGCTTGG + Intronic
927093242 2:19728363-19728385 CCTCATCTGCTTCCTGAGCTTGG + Intergenic
927133415 2:20079821-20079843 CCTCATGTCCCCATGGAGCCAGG - Intergenic
927553538 2:24017826-24017848 CCTCCTCTGCTCCAGGTGGCTGG - Intronic
927930637 2:27041344-27041366 CCTCACCTCCACCTGAAGCCTGG + Exonic
928441421 2:31295380-31295402 GCTCGTCTGCTTCTGGAGCCTGG - Intergenic
928572168 2:32620540-32620562 CCGCATGTGCTCTTGGACCCAGG - Intergenic
929620210 2:43347073-43347095 CCTCATCTGATGGTGGAGGCAGG + Intronic
929845410 2:45520624-45520646 CTTCATCTGCTCCTGGAGCCTGG - Intronic
930173886 2:48281498-48281520 CCTCATGTGCTCAGGGAGACAGG - Intergenic
931284476 2:60820586-60820608 GCTTGTCTGCTTCTGGAGCCTGG + Intergenic
931665687 2:64608478-64608500 CCTCAGCTTCTCCAGCAGCCAGG - Intergenic
931893498 2:66702518-66702540 CCTCCTCTTCTCCTTCAGCCTGG + Intergenic
932479043 2:72027725-72027747 CCCCACCTGCTCCTGGGGCAGGG - Intergenic
932487727 2:72094615-72094637 CCTCATTTGTTCCTAGAGGCTGG - Intergenic
933409781 2:81910428-81910450 CCTCATCTGCTCCTGGAGCCTGG + Intergenic
934507628 2:94906645-94906667 GCTTGTCTGCTTCTGGAGCCTGG - Intergenic
935262142 2:101364737-101364759 CCTCCTCTGTTCCTGCACCCAGG - Intronic
935383714 2:102479322-102479344 CCTCATCTCCCCCGGAAGCCGGG - Intronic
935894447 2:107719636-107719658 GCTCAACTCCTTCTGGAGCCTGG - Intergenic
936052015 2:109231144-109231166 TCTCCTCTCCTCCCGGAGCCAGG + Intronic
937709287 2:124960895-124960917 GCTTATCTGCTTCTGGAGCCTGG - Intergenic
938293765 2:130164081-130164103 CCTCATCTGTTCCTGCTGCCAGG + Intronic
938337442 2:130511980-130512002 CCTCCTCTGCTGAGGGAGCCAGG - Intergenic
938352396 2:130608755-130608777 CCTCCTCTGCTGAGGGAGCCAGG + Intergenic
938365396 2:130729463-130729485 GCTCATCTCCTCCAGCAGCCTGG + Exonic
938410092 2:131056488-131056510 CTTTATCTGCTTCTGGAGACGGG - Intronic
938462779 2:131508881-131508903 CCTCATCTGTTCCCGCTGCCAGG - Intergenic
938648321 2:133353648-133353670 CCTCATCTGCTTCTGGAGCCTGG - Intronic
938813367 2:134874096-134874118 CCTCTTCTGCTCCTGTCCCCTGG - Intronic
939417835 2:141924157-141924179 CCTTGTCTTCTCCTGGAGCCTGG - Intronic
939450489 2:142367263-142367285 TCTCATCTGCTTCTGGATCCTGG + Intergenic
939590818 2:144061799-144061821 ACTCTTCTGCTCTTGGAGCCTGG - Intronic
940660033 2:156534303-156534325 GCTCATCTGCTCGAGGAGCCTGG + Intronic
941222157 2:162796006-162796028 GCTCATTTGTTCCTTGAGCCTGG - Intronic
941967873 2:171317756-171317778 CCTCAGCTGCCCCTGGAGCTCGG - Exonic
943749206 2:191494264-191494286 ACTCTTCTGCTCATGGAACCTGG + Intergenic
945882650 2:215342536-215342558 CCTCATGTTCTTCTGTAGCCGGG + Intronic
946098015 2:217292151-217292173 GCTGGTCTGCTTCTGGAGCCCGG + Intronic
946166299 2:217866188-217866210 CCTAGTCTGCTGCTGCAGCCAGG - Intronic
946209874 2:218138983-218139005 ACTCATCTGTGCCTGGAGCTGGG + Intergenic
947129147 2:226903819-226903841 CCTTGTCTCCTTCTGGAGCCTGG - Intronic
947563997 2:231182082-231182104 CCTAATCTGACCCTGGAGCGTGG - Intergenic
948008232 2:234628884-234628906 CCTCATCTGCTCTTGGAGCCTGG - Intergenic
948140818 2:235670621-235670643 CCACAGCAGCTCCGGGAGCCTGG + Intronic
948596444 2:239082487-239082509 CCCCATCGGCTGCTGGAGTCAGG - Intronic
948763200 2:240205148-240205170 CCTCATCCTCTGCTAGAGCCAGG - Intergenic
948897869 2:240935563-240935585 GCCCACCTGCTCCTGGAGCTGGG - Intronic
949034539 2:241810487-241810509 CCTCAGCTGCTTCTGAAACCTGG - Intronic
1169036720 20:2459204-2459226 CCACCTCTGCTCCAGGAGGCTGG + Intergenic
1170525010 20:17228142-17228164 CCTCTCCAGCTCCTGTAGCCGGG - Intronic
1171895186 20:30751979-30752001 GCTTGTCTGCTTCTGGAGCCTGG - Intergenic
1172127238 20:32631995-32632017 CCACCTCTGCTCCTTGAGGCAGG + Intergenic
1174379598 20:50148176-50148198 CCTCACCACCTCCTGGAGCTAGG + Intronic
1174761440 20:53210583-53210605 CCTCATCTGCTTTTGGAGCCTGG + Intronic
1175041853 20:56059533-56059555 CCTCATTGGCTCCTGGGACCTGG - Intergenic
1175168430 20:57062841-57062863 GCTCATCTGCTCGTGGAACCTGG + Intergenic
1175754852 20:61523010-61523032 CTTCCTCTGCTCCTGGAGGCCGG - Intronic
1175891173 20:62316681-62316703 CCTCTGCTGTTCCTGGAGCATGG + Exonic
1175891696 20:62318622-62318644 GCTCAGCTGCTCCTGCACCCGGG + Exonic
1175934353 20:62508223-62508245 CAGCATCTGCTCCTGAAGGCAGG + Intergenic
1176606662 21:8839683-8839705 GCTTGTCTGCTTCTGGAGCCTGG + Intergenic
1176783967 21:13232633-13232655 GCTTGTCTGCTTCTGGAGCCTGG + Intergenic
1176980472 21:15375721-15375743 TATCTTCTGCTCATGGAGCCTGG - Intergenic
1177787108 21:25682978-25683000 GCTCATCTGCTTCTAGAACCTGG + Intronic
1178094269 21:29197317-29197339 GCTCATCTGCTTCTGGAGCCTGG - Intronic
1179022552 21:37653419-37653441 CCCCATCTGCTTCTGCAGCCTGG - Intronic
1179572893 21:42288323-42288345 CCGCATCTTCTCCTGTAGCTGGG + Intronic
1179628209 21:42660325-42660347 CCGCACCTGCTCCTGGAAGCTGG - Intronic
1179768616 21:43595540-43595562 CCTCAGCTGCTCCAGTAGCTGGG - Intronic
1179786731 21:43734536-43734558 CCTCCTCAGCTCCAGGAGGCAGG - Intronic
1180356736 22:11849385-11849407 GCTTGTCTGCTTCTGGAGCCTGG + Intergenic
1180381525 22:12142946-12142968 GCTTGTCTGCTTCTGGAGCCTGG - Intergenic
1180940701 22:19658174-19658196 CCTCATGTCTTCCTGGGGCCTGG + Intergenic
1181046591 22:20217528-20217550 CCTCAAACGCTCCTGCAGCCTGG - Intergenic
1181113118 22:20613369-20613391 CCTCATCTGTTCCTGTTGCCAGG + Intergenic
1181419440 22:22787532-22787554 CCTGATGTGCACCTGGGGCCTGG + Intronic
1182620730 22:31617105-31617127 CAACACCTGCTCCTGTAGCCAGG - Intronic
1183383154 22:37500519-37500541 CCTTCTCAGCTCCTGGAGCCTGG - Intronic
1184205328 22:42998823-42998845 ACTCTTCTGCTCCTGGATTCTGG - Intronic
1184415352 22:44348951-44348973 CCTCATCTTCTCCAGGCCCCTGG - Intergenic
1184420695 22:44381331-44381353 CCTCCTCAGCTCCTGTTGCCAGG - Intergenic
1184664219 22:45978829-45978851 CCCCATCCCCTCCCGGAGCCCGG + Intergenic
1185141606 22:49105657-49105679 CCTCCTCTGCCCTTGCAGCCTGG + Intergenic
1185372086 22:50465639-50465661 CTGCTTCTGCTACTGGAGCCGGG + Intronic
950404574 3:12796746-12796768 CGTCATCTTCTCCAGGAGGCTGG - Exonic
951291004 3:20872488-20872510 CATCATCTACTTCTGAAGCCAGG - Intergenic
951731588 3:25815847-25815869 CCTTGTCTGCTTCTGGAGCCTGG - Intergenic
951776174 3:26312669-26312691 TCTCATCTCCTTCTGGAGCCTGG - Intergenic
952887875 3:38022579-38022601 GCTCATCCTGTCCTGGAGCCAGG + Intronic
953856140 3:46500439-46500461 CCTCATCTTCACCTGGCCCCTGG - Exonic
953899872 3:46833927-46833949 CCGCTTCAGGTCCTGGAGCCGGG + Exonic
954107996 3:48419571-48419593 CCTCACCAGCTCCCAGAGCCCGG + Exonic
954403580 3:50332446-50332468 CCTCAGCTGTTCCTGGCCCCTGG - Intronic
954456998 3:50605084-50605106 CCTCACCTGGTGCTGCAGCCTGG - Intergenic
955038696 3:55293559-55293581 CTTCGTCTGCTTCTGGAGCCTGG - Intergenic
955080005 3:55649728-55649750 CCTCATTTCCCCATGGAGCCAGG + Intronic
955425995 3:58790486-58790508 GTTCATCTGCTCATGGAACCTGG - Intronic
955588947 3:60513874-60513896 GCTCTTCTGCTCATGGAGCGTGG - Intronic
955609150 3:60738940-60738962 CCTTGTCTGCTCCTGGAGCCTGG - Intronic
955663739 3:61328416-61328438 ACTCTTCTGCTTCTGGAGCCTGG + Intergenic
955749041 3:62169071-62169093 TCTCGTCTGCTTCTGGAGCCTGG + Intronic
957206503 3:77205463-77205485 CCTTCTCTGCTCCTGGAGCCTGG + Intronic
957383629 3:79467450-79467472 GCTTGTCTGCTCGTGGAGCCTGG - Intronic
957824517 3:85423234-85423256 ACTCTTCTGCTCATGGTGCCTGG + Intronic
957984945 3:87562306-87562328 TATCTTCTGCTCATGGAGCCGGG - Intergenic
959065228 3:101649092-101649114 ACTCTTCTGCTCATGGAGCCTGG + Exonic
959254106 3:103989220-103989242 TCTCATCTGCTTTTGGACCCTGG + Intergenic
959486620 3:106934316-106934338 GCTCGTCTGCTCATGGACCCTGG - Intergenic
959575056 3:107925327-107925349 CCTAGTCTGCCTCTGGAGCCTGG + Intergenic
959773971 3:110134704-110134726 GCTCTTCTGCTCATGGAGCCTGG - Intergenic
959967785 3:112376076-112376098 TCTCATCTGCTTCTGGAGCCTGG + Intergenic
960092977 3:113660542-113660564 CATCATCTGCCCCTGGAGTAGGG - Exonic
961269682 3:125679861-125679883 CCTGATGTTCACCTGGAGCCTGG - Intergenic
961622999 3:128239456-128239478 CCTCTTGACCTCCTGGAGCCTGG - Intronic
961691982 3:128676582-128676604 CCTCTTCTGCTTCAGGAGCTTGG + Intronic
962186010 3:133260057-133260079 GTTCATCTGCACCTTGAGCCAGG + Intronic
963102808 3:141622563-141622585 TCTCATCTGCTTGTGGAGCCTGG - Intergenic
963234737 3:142945706-142945728 GCTCATCTGCTTCTGGAGCCCGG + Intergenic
963762179 3:149295096-149295118 ACTCATCTGCTTCTGGAGCCTGG - Intergenic
963939440 3:151085398-151085420 CCTCACCTGCGCCGGGAGCGTGG - Intergenic
967070911 3:185961603-185961625 CCTAGTCTGCTTCTGGAGCCTGG + Intergenic
967384770 3:188900483-188900505 CTTCATCTCCTCCTGGAGAAGGG - Intergenic
967641778 3:191874159-191874181 CCTCATCTACACCTGGAGGTTGG + Intergenic
967771236 3:193335598-193335620 CCTCATAAGCTCATGGAGCAAGG + Intronic
968213484 3:196868338-196868360 CCCCAGCTCCTCCTGAAGCCGGG + Intronic
968511635 4:998193-998215 CCCCACCTGCTCCTGTACCCCGG - Intronic
968517985 4:1022861-1022883 TCTCTTCTGCGCCTGGGGCCCGG + Intronic
968597960 4:1495083-1495105 TCTCATCAGCCCCGGGAGCCCGG + Intergenic
969134390 4:5018830-5018852 CCTCATCTGCTGAGGGACCCGGG - Intronic
969265622 4:6062342-6062364 TCCCACCTGCTCCTGGAGCAGGG + Exonic
970720896 4:18987469-18987491 GCTCATCTGCTCCTGAAGCCTGG - Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
971502083 4:27328542-27328564 CCTCATCTACTTCTGGAGCCTGG + Intergenic
971742700 4:30540318-30540340 CTTCATCTCCTCCTGGAGCCTGG + Intergenic
972192531 4:36612366-36612388 CATTATCTGCTTCTGAAGCCAGG - Intergenic
972406489 4:38751428-38751450 GCCCATCTGCTTCTGGAACCTGG - Intergenic
973277715 4:48327282-48327304 CCTCATCTGCTTCTGGAGTCTGG - Intergenic
973371450 4:49251474-49251496 GCTTGTCTGCTTCTGGAGCCTGG - Intergenic
973620622 4:52722250-52722272 CCTGCTCTGGACCTGGAGCCAGG - Intergenic
973757623 4:54091265-54091287 GCTCTGCTGGTCCTGGAGCCTGG - Intronic
974186547 4:58454648-58454670 GCTCGTCTGCTTCTAGAGCCTGG + Intergenic
974368658 4:60985869-60985891 ACTCATCTGCTTGTGGAGCCTGG + Intergenic
974550240 4:63363020-63363042 GCTAGTCTGCTTCTGGAGCCTGG + Intergenic
975060119 4:69986368-69986390 ACTCATCTGCTTCTGGAGCTTGG + Intergenic
975580890 4:75906188-75906210 GCTCATCTCCTCATGGACCCAGG - Intergenic
976198522 4:82557350-82557372 CTTCAGCTGCTCCTGGAGCCAGG + Intronic
976856931 4:89615044-89615066 CCTCAGCTTCTCCAGGAGCTGGG + Intergenic
977459247 4:97304103-97304125 CTCCATCTGTTCCTGGAGACAGG - Intronic
978589615 4:110310707-110310729 CTCCAACTGCCCCTGGAGCCAGG - Intergenic
978605733 4:110476839-110476861 CCTCTTCAGCTCCGGGAGCCGGG - Exonic
979208992 4:118077494-118077516 CCTAATCTGCTCCTGGGTCTTGG + Intronic
979519193 4:121646575-121646597 CCTCATTTGTTCATGCAGCCTGG - Intergenic
980097022 4:128501737-128501759 GTTCATCTGCTCGTGGAGCCTGG - Intergenic
980318232 4:131234111-131234133 GCTCATCTGCTCATGTAGCCTGG - Intergenic
980554593 4:134386892-134386914 GCTCATCTCTTTCTGGAGCCTGG - Intergenic
980821552 4:138023398-138023420 GCTCATCTGCTTCTGGAGCGTGG + Intergenic
981815883 4:148830040-148830062 CCTCATCTTCTTCGGGAGCCTGG + Intergenic
981834476 4:149039561-149039583 CATTATCTGCTTCTGAAGCCAGG - Intergenic
982325833 4:154127456-154127478 GCTCATCTGCTTATGGAGCCTGG + Intergenic
982354237 4:154449145-154449167 CCTCATCTTCTTCTCCAGCCAGG - Intronic
982835125 4:160113648-160113670 CATTATCTGCTTCTGAAGCCAGG - Intergenic
983141496 4:164155083-164155105 CCTCATCTGCTTCTGGAGCCTGG + Intronic
983238637 4:165207455-165207477 CCGCTTCTGCTTCTGGAGGCGGG - Intronic
983781406 4:171674506-171674528 CGTCTCCTGCTTCTGGAGCCTGG - Intergenic
984373727 4:178900050-178900072 TCTCATCTGCTTCTAGAGCTTGG + Intergenic
984591248 4:181619830-181619852 ACACACCTGCTCCGGGAGCCTGG - Intergenic
984718838 4:182951841-182951863 GCTCATCTGCTAGTGGAGCCTGG + Intergenic
985138328 4:186812216-186812238 CCTCCTTTGCTTCTGAAGCCTGG + Intergenic
985293159 4:188406843-188406865 CCTTGCCTGCTTCTGGAGCCTGG - Intergenic
985528853 5:422019-422041 AGGCATCTGCACCTGGAGCCTGG - Intronic
985543747 5:499061-499083 TCTCATCTTCTCCTGAAACCAGG + Intronic
985778988 5:1860029-1860051 GGTCATCTGCTCCTGCAGCCTGG + Intergenic
986175000 5:5344422-5344444 TCACATCTGCCCCTGGAGGCTGG + Intergenic
986457226 5:7931594-7931616 TCTCACCTGCTTCTGGAGCCTGG - Intergenic
986542695 5:8863737-8863759 GCTTGTCTGCTCCTGGAACCTGG - Intergenic
987190244 5:15470086-15470108 GCTCATCTGCTCTTGGAGTCTGG + Intergenic
987251726 5:16107727-16107749 CCTCATCTGCTCCTGGAGCCTGG - Intronic
987504853 5:18754536-18754558 ACTCATCTGCTTCTGGAGCCAGG + Intergenic
987697306 5:21348845-21348867 CCAGATCTGCTCCTGGGCCCTGG + Intergenic
988754932 5:34237850-34237872 CCAGATCTGCTCCTGGGCCCTGG - Intergenic
989505089 5:42217682-42217704 GCTCTTCTGTTCTTGGAGCCTGG + Intergenic
989719102 5:44503877-44503899 GTTCATCTCCTCATGGAGCCAGG - Intergenic
989735068 5:44693969-44693991 CCTTGTCTGCTTCTGAAGCCTGG - Intergenic
990193778 5:53290265-53290287 CCTCGTCTGCTTCTGGAACCTGG - Intergenic
990499044 5:56376724-56376746 GCTCTTCTGCTCATGGAGCCTGG + Intergenic
992073777 5:73172787-73172809 CCTCATCCTCTCCAGTAGCCAGG - Intergenic
992474535 5:77088727-77088749 CATCTTTTGCTGCTGGAGCCTGG + Intergenic
992992512 5:82298609-82298631 GCTCATCTGCTTGTGGAGCCTGG + Intronic
993773514 5:91962314-91962336 GCCCATCTGCTCGTGCAGCCTGG - Intergenic
994431975 5:99677921-99677943 CCTCAGCTTCTCCTGTGGCCGGG - Intergenic
994819273 5:104627977-104627999 GCTCATCTGCTTGTGGAGCCTGG - Intergenic
994825356 5:104706914-104706936 CTTCTTCTTCTCCTGGGGCCAGG - Intergenic
994836760 5:104865239-104865261 CATTATCTGCTTCTGAAGCCAGG - Intergenic
996536774 5:124585703-124585725 CCTCATCAGCTTCTGGAGCCTGG + Intergenic
997293829 5:132757280-132757302 CCTGCTCTGCTGCTGGAGCATGG + Intronic
997362386 5:133303377-133303399 CCTCATCTGCTGCTTCAGGCAGG + Intronic
998160210 5:139808942-139808964 CATCTTTGGCTCCTGGAGCCAGG + Intronic
998676903 5:144419541-144419563 CCTCTTCTGCTGCTGGAGGCAGG + Intronic
998762643 5:145449492-145449514 GTTCATCAGCTCATGGAGCCTGG + Intergenic
998868496 5:146529688-146529710 CCTCATCTGCTTGTGGAGCCTGG - Intergenic
999811478 5:155131504-155131526 CCTCTCCTGCTTCTGGAGCCTGG + Intergenic
1000204799 5:159048509-159048531 CCTCTTGTACTTCTGGAGCCTGG + Intronic
1000223676 5:159237512-159237534 CAGTATCTGCTTCTGGAGCCAGG + Intergenic
1000664699 5:163980317-163980339 GCTTGTCTGCTTCTGGAGCCTGG + Intergenic
1000867924 5:166538234-166538256 GCTCATCTGCTTCCGGAGCCTGG - Intergenic
1001050333 5:168408819-168408841 CATCATATCCTCCTGGGGCCAGG - Intronic
1001934173 5:175692952-175692974 CCTCACCTGCCCCTGGCTCCTGG - Intergenic
1001982517 5:176046732-176046754 CCTAATGTCCACCTGGAGCCTGG - Intergenic
1002234944 5:177797325-177797347 CCTAATGTCCACCTGGAGCCTGG + Intergenic
1002295319 5:178227555-178227577 CCTCATCTTCTCCTGGTTCCCGG - Intronic
1003200686 6:3957571-3957593 CAGCACCTCCTCCTGGAGCCTGG - Intergenic
1003381238 6:5626248-5626270 CCTCATCTGGACCTGCAGGCTGG - Intronic
1003593938 6:7458020-7458042 CCTTACCTGCTTCAGGAGCCTGG - Intergenic
1004964734 6:20835661-20835683 CCTCATCTTCTCCAGTAGCTGGG + Intronic
1005553552 6:26949561-26949583 CCAGATCTGCTCCTGGGCCCTGG - Intergenic
1005608906 6:27504314-27504336 CCTCATGTGCTCCTGAAACTTGG - Intergenic
1005796617 6:29369250-29369272 CCTCATTTCCTCCTGGAGGTGGG + Intronic
1006027191 6:31154667-31154689 CCTCATCTTCTGCTGCAGCGAGG + Exonic
1006029100 6:31165982-31166004 CCTCTTCTGCTTCAGGAGCTTGG + Exonic
1006641763 6:35492891-35492913 CCTCATCTTGTCCTGGTCCCAGG + Intronic
1006908385 6:37548138-37548160 GCTCAGCTGCATCTGGAGCCAGG + Intergenic
1007279218 6:40698156-40698178 CCCCACCTGCTCCCGGACCCTGG - Intergenic
1008601013 6:53094760-53094782 TCTGATGGGCTCCTGGAGCCTGG + Intronic
1008797365 6:55320659-55320681 TCTCTTCTGCTCTTAGAGCCAGG + Intergenic
1009349931 6:62661548-62661570 CCTGGTCTGCCTCTGGAGCCTGG + Intergenic
1010494241 6:76513974-76513996 ACTCTTCTGCTCATGGAGCTTGG + Intergenic
1012945437 6:105460995-105461017 GCTCTTCTGCTTGTGGAGCCTGG - Intergenic
1013421057 6:109967443-109967465 CCCCATGTGTTCCTTGAGCCAGG - Intergenic
1014400590 6:120985067-120985089 ACTCATCAGCTCATGGACCCAGG - Intergenic
1014810140 6:125875933-125875955 CATCATAAGCTCCTGGAGGCCGG + Intronic
1014825784 6:126047306-126047328 ACTCTTCTGCTTGTGGAGCCTGG - Intergenic
1014992791 6:128103070-128103092 GCTCATCTGCTCAAGGAACCTGG - Intronic
1015349022 6:132195177-132195199 CATCTTCTGATTCTGGAGCCTGG + Intergenic
1015715974 6:136192098-136192120 CCTAGTCTTCTCCTGGAGCAGGG - Exonic
1016155935 6:140808729-140808751 CCTTCTCTACTTCTGGAGCCTGG + Intergenic
1016283340 6:142445108-142445130 TCTCATCATCTGCTGGAGCCAGG - Exonic
1016373195 6:143394940-143394962 ACTCCTCTGATCCTAGAGCCAGG + Intergenic
1016498452 6:144690513-144690535 CCTCATCTGCCCATGAAGCAGGG + Intronic
1016532819 6:145076715-145076737 ACTCATCTGCTTCTGGAGGCTGG + Intergenic
1016534007 6:145090795-145090817 GCTCTTCTGCTTATGGAGCCTGG + Intergenic
1017021465 6:150143292-150143314 CCTGAGCCGCTGCTGGAGCCGGG - Exonic
1017887031 6:158607975-158607997 CATCAGCTCCTCCCGGAGCCTGG - Intronic
1018201422 6:161399029-161399051 GCTCTTCTGCTCATGGAGCCTGG - Intronic
1019045693 6:169143657-169143679 GCTCATCTGCTTCTGGAGCCTGG + Intergenic
1019506000 7:1391725-1391747 CCTCATGAGAGCCTGGAGCCAGG - Intergenic
1019744039 7:2689536-2689558 CCCCAGCTGCTCCTGGAGCAGGG - Intronic
1019958578 7:4437135-4437157 TGTCATCGGCTCCTAGAGCCAGG + Intergenic
1020151945 7:5689228-5689250 CCATATCAGCTTCTGGAGCCAGG - Intronic
1020389906 7:7646831-7646853 ACTCTTCTGCTCATGGAGCCTGG + Intronic
1021041885 7:15872633-15872655 CCTTGTCTGCTTCTGGAGCCTGG - Intergenic
1021083073 7:16386318-16386340 GCTCTTCTGCTCATGGAGCCTGG + Intronic
1021179921 7:17494495-17494517 GCTCATCTGCCTCTGGAGCTTGG - Intergenic
1022901095 7:34811418-34811440 GCTCATCTCCTCCTGGAGCCTGG + Intronic
1023754311 7:43401893-43401915 GCTCATCTGCTTGTGGAGCCTGG - Intronic
1024150925 7:46570421-46570443 CCACATCTGCACCTGATGCCAGG - Intergenic
1024811135 7:53213572-53213594 CCTCATCAGTTCTTGGAGACAGG - Intergenic
1025003450 7:55337311-55337333 GCTCTTCTGCTTATGGAGCCTGG + Intergenic
1027266901 7:76499512-76499534 CCCCTTCTGGTCCTGGAGTCTGG + Intronic
1027318716 7:76999380-76999402 CCCCTTCTGGTCCTGGAGTCTGG + Intergenic
1027585254 7:80049393-80049415 GCTCATCCGCTTGTGGAGCCTGG + Intergenic
1028718737 7:94004486-94004508 CCCCGTCCGCTCCTGGAACCGGG - Intergenic
1029007952 7:97230133-97230155 CATCTGCTGCTTCTGGAGCCTGG - Intergenic
1029200692 7:98837281-98837303 CCTGATCTGTTCTTGGAACCAGG - Intergenic
1029257772 7:99280937-99280959 CCTCTTCTCCTTCTGGAGCTTGG - Intergenic
1029485380 7:100836782-100836804 GCTCATCTGCCCCTGGGACCTGG + Intronic
1030100024 7:105937650-105937672 CCTTATCTGCTGCCTGAGCCAGG - Intronic
1030117588 7:106073934-106073956 GCTCATCTGCTTGTAGAGCCTGG - Intergenic
1030386533 7:108874061-108874083 GCTCTTCTGCTTGTGGAGCCTGG - Intergenic
1030387145 7:108878055-108878077 TCTCTTCTGCTCGTGGAGCCTGG - Intergenic
1031693421 7:124818567-124818589 CCTCATCTGCTGCTGGAGTCTGG - Intergenic
1033075826 7:138249792-138249814 CCGTATCTGCTTCTGAAGCCGGG - Intergenic
1033629308 7:143141117-143141139 GCTCATCTCCTTCTGGAGCCTGG + Intergenic
1033881324 7:145887321-145887343 TCCCATCTGCTCATGGAGCCTGG + Intergenic
1033976071 7:147101810-147101832 GCTCGTCTGTTCATGGAGCCTGG + Intronic
1034099411 7:148438139-148438161 GCTATTCTGCTCATGGAGCCTGG + Intergenic
1034164520 7:149015098-149015120 CCTCATCTGCTTCTGGAGGGAGG - Intronic
1038428226 8:27479181-27479203 CCTCATCCCCTCCTGGGGCCAGG - Exonic
1038455396 8:27669358-27669380 CTACCTCTGCTCCTGGCGCCTGG - Intronic
1038931897 8:32202810-32202832 ACTCTTCTGCTTGTGGAGCCTGG + Intronic
1040466192 8:47697573-47697595 ACGCAGCTGCTCCTGGAGGCGGG - Intronic
1041786497 8:61639873-61639895 ACTCTTCTGCTTCTGCAGCCTGG - Intronic
1042333637 8:67608313-67608335 GCTCTTCTGCTCATGGAGCCTGG - Intronic
1042348545 8:67751951-67751973 GCTCATCTGCTTCTAGAGCCTGG + Intergenic
1042601462 8:70503331-70503353 GCTCTTCTGCTCATGGAGCCTGG + Intergenic
1042701944 8:71625157-71625179 CCCCAGCTCCTCCTGTAGCCAGG + Intergenic
1042984346 8:74566521-74566543 CCTCATCTGCTTCAGGAGCCTGG - Intergenic
1043999802 8:86865591-86865613 CTTCGTCTGCTTCTGGAGCCTGG + Intergenic
1044275830 8:90298187-90298209 CCTCACCTGACCCTGGAGACTGG + Intergenic
1045481265 8:102593962-102593984 GCTCGTCTGCTTCTGGAGCCTGG - Intergenic
1045484718 8:102622062-102622084 CCTCCTCTGCTTCAGGAGCTTGG + Intergenic
1047353990 8:124102822-124102844 CCTCCTCTGCTCCCTAAGCCTGG - Intronic
1047697325 8:127416315-127416337 CCTCTTCTGCTTCAGGAGCTTGG - Exonic
1048060855 8:130917936-130917958 CCACATCTGGCCCTGTAGCCTGG + Intronic
1049201539 8:141342900-141342922 TCTCCTCTGCTCATGCAGCCTGG - Intergenic
1049345562 8:142136761-142136783 CCCCCTCTGCTGCTGGAGCCCGG - Intergenic
1049545652 8:143229398-143229420 CCTCCTCTATCCCTGGAGCCAGG - Intergenic
1049620071 8:143594162-143594184 CCTACTCTGCTCCTGGAAGCAGG + Intronic
1049668277 8:143858518-143858540 GCTCATCTTCTCCTGGCGGCCGG + Exonic
1049668693 8:143860117-143860139 GCTCATCTTCTCCTGGTGGCCGG + Exonic
1049669108 8:143861719-143861741 GCTCATCTTCTCCTGGCGGCCGG + Exonic
1049669523 8:143863321-143863343 GCTCATCTTCTCCTGGCGGCCGG + Exonic
1049669933 8:143864914-143864936 GCTCATCTTCTCCTGGCGGCCGG + Exonic
1049670350 8:143866522-143866544 GCTCATCTTCTCCTGGCGGCCGG + Exonic
1049683441 8:143929941-143929963 GCTCATCCGCTCCTGGTCCCTGG - Exonic
1050108435 9:2189913-2189935 TCTCATCTCCTTCTGGAGCTAGG + Intronic
1050118848 9:2287975-2287997 GCTGGTCTGCTCCTGGAGCCTGG - Intergenic
1051983773 9:23057458-23057480 CCTCATCTGCTTCTGGAGCCTGG - Intergenic
1052036873 9:23692769-23692791 TCTCATCTGCGTCAGGAGCCAGG + Exonic
1052113489 9:24619260-24619282 GCTCTTCTGCTCATGGAGCCTGG + Intergenic
1052459727 9:28747147-28747169 CCTCCTCTCCTTCTGGATCCTGG - Intergenic
1052758497 9:32566387-32566409 CCTCTTCTGGACCTGGAACCTGG - Intronic
1052793631 9:32902109-32902131 GCTCATCTGCTCATGGAGCTTGG - Intergenic
1054353464 9:64040788-64040810 GCTTGTCTGCTTCTGGAGCCTGG + Intergenic
1055007519 9:71525469-71525491 CCACACCTGCTCCCGGTGCCAGG - Intergenic
1055121365 9:72664516-72664538 GCTCATCTGCTCATCAAGCCTGG - Intronic
1055486260 9:76759442-76759464 GCTCATCTGCTCATGGAGCCTGG - Intronic
1055998993 9:82194144-82194166 GCAGATCTGCTTCTGGAGCCTGG - Intergenic
1056085752 9:83147972-83147994 GCTCATCTGCTTGTGGAGCCTGG + Intergenic
1056617440 9:88180520-88180542 CCTCATTGCCCCCTGGAGCCAGG - Intergenic
1056873729 9:90307709-90307731 CCTCAGCTGCTCCTATAGCCTGG - Intergenic
1057445922 9:95114553-95114575 CCTCATCTGCCCTTTGAGCAGGG - Intronic
1057577445 9:96254758-96254780 CCACATCTGCTCTCAGAGCCTGG - Intronic
1057904646 9:98974545-98974567 CCTCCTCTGCGCCTGCAGCATGG - Intronic
1058974705 9:110115132-110115154 CCTCAGCTGCTCCCAGAGTCTGG + Intronic
1059332719 9:113546120-113546142 CCTGCTTTGCACCTGGAGCCCGG + Intronic
1059494710 9:114699967-114699989 GCTCTGCTGCTCATGGAGCCTGG - Intergenic
1059790527 9:117637221-117637243 CCTTATCTACTCCTTCAGCCTGG + Intergenic
1060485262 9:124042362-124042384 CCTGCCCTGCTCCAGGAGCCGGG + Intergenic
1060547981 9:124471778-124471800 CCTCTTCTGCTGCTGCGGCCTGG - Intronic
1060886705 9:127159655-127159677 CCCCATCTTCTCAGGGAGCCTGG + Intronic
1203792122 EBV:157398-157420 CCTCTTCTGCTCCAGGCACCAGG + Intergenic
1203695875 Un_GL000214v1:96416-96438 GCTTGTCTGCTTCTGGAGCCTGG - Intergenic
1203741797 Un_GL000218v1:9897-9919 GCTTGTCTGCTTCTGGAGCCTGG + Intergenic
1203377170 Un_KI270442v1:385247-385269 TCTCAACAGCTCCAGGAGCCGGG - Intergenic
1203701986 Un_KI270742v1:4488-4510 GCTTGTCTGCTTCTGGAGCCTGG + Intergenic
1203553969 Un_KI270743v1:190543-190565 GCTTGTCTGCTTCTGGAGCCTGG + Intergenic
1203640398 Un_KI270751v1:7647-7669 GCTTGTCTGCTTCTGGAGCCTGG + Intergenic
1185738524 X:2511925-2511947 GTTCGTCTCCTCCTGGAGCCAGG + Intergenic
1185909047 X:3965574-3965596 TCTCATCTCCTTCTGGAACCGGG - Intergenic
1185923972 X:4125895-4125917 CCACTTCTGCCCCTAGAGCCTGG + Intergenic
1185961805 X:4552782-4552804 GCTCTTCTGCTCATAGAGCCTGG + Intergenic
1186004426 X:5052296-5052318 CCTTATCTGTGCCTGAAGCCTGG + Intergenic
1186031720 X:5375955-5375977 GCTCATTTGCTCGTGGAGTCTGG - Intergenic
1186185251 X:7014193-7014215 CCTCATCTGCTTCTGGAGCCTGG + Intergenic
1187144559 X:16625862-16625884 ACTCTTCTGCTCATGGAGCCTGG + Intronic
1188117596 X:26264022-26264044 GCTCATTTGCTTCTGGAGCCTGG + Intergenic
1188807089 X:34604810-34604832 GCTCATCTGCTTGTGGAGCCTGG - Intergenic
1189450324 X:41122956-41122978 ACTCTTCTGCTTTTGGAGCCTGG + Intronic
1190483099 X:50897335-50897357 GCTCATCTGCTTCTGGAGCCTGG + Intergenic
1190484292 X:50909666-50909688 ACTCATCATCTCCTAGAGCCAGG + Intergenic
1190569338 X:51765968-51765990 ACTCTTCTGCTTGTGGAGCCTGG - Intergenic
1190591222 X:52003731-52003753 CCCCATCAGCTCCTGGAATCAGG + Intergenic
1192113883 X:68392671-68392693 CCTCGTCTGCTTCTGGAGCCTGG - Intronic
1192263832 X:69525111-69525133 CGTCATCTGCTCCTGGAGGGAGG - Intronic
1192426981 X:71085890-71085912 CCTCATATCCTCATGGAGGCAGG - Intergenic
1193023654 X:76821146-76821168 CCTGAGTTGGTCCTGGAGCCTGG + Intergenic
1194163392 X:90483601-90483623 GCTCTTCTGCTCGTGGAACCTGG + Intergenic
1194752131 X:97697041-97697063 CCTCGTCTGCTTCTGGAGCCTGG - Intergenic
1196861540 X:120033485-120033507 GCTCATCTGCTTGTGGATCCTGG - Intergenic
1198147007 X:133867760-133867782 GCTTGTCTGCTCCTGGAGCCTGG - Intronic
1198933626 X:141884890-141884912 CAGTATCTGCTTCTGGAGCCAGG - Intronic
1199380627 X:147168299-147168321 GCTCATCTGCTCTTGGAGCTGGG - Intergenic
1199559929 X:149151410-149151432 GCTGGTCTGCTTCTGGAGCCTGG - Intergenic
1199575710 X:149311923-149311945 GCTCATCTTCTCGTGGAGCCTGG + Intergenic
1200110470 X:153738207-153738229 CCACATATGCTCAGGGAGCCGGG + Intronic
1200123109 X:153800565-153800587 GCTCATATGGGCCTGGAGCCTGG - Intergenic
1200229716 X:154437784-154437806 CCTCATCGTCTTCTGGGGCCAGG + Intronic
1200367890 X:155686940-155686962 CCTTTCCTGCTCCTTGAGCCAGG + Intergenic
1200509661 Y:4061326-4061348 GCTCTTCTGCTCGTGGAGCCTGG + Intergenic
1201155328 Y:11127351-11127373 GCTTGTCTGCTTCTGGAGCCTGG + Intergenic