ID: 1153371097

View in Genome Browser
Species Human (GRCh38)
Location 18:4316978-4317000
Sequence GTGTAGGTCATGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 327}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153371097_1153371107 5 Left 1153371097 18:4316978-4317000 CCTCCTTCCCTCATGACCTACAC 0: 1
1: 0
2: 1
3: 26
4: 327
Right 1153371107 18:4317006-4317028 TCTACTGGTGAGGTCCCTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 114
1153371097_1153371104 -5 Left 1153371097 18:4316978-4317000 CCTCCTTCCCTCATGACCTACAC 0: 1
1: 0
2: 1
3: 26
4: 327
Right 1153371104 18:4316996-4317018 TACACCCAGGTCTACTGGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 95
1153371097_1153371102 -10 Left 1153371097 18:4316978-4317000 CCTCCTTCCCTCATGACCTACAC 0: 1
1: 0
2: 1
3: 26
4: 327
Right 1153371102 18:4316991-4317013 TGACCTACACCCAGGTCTACTGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153371097 Original CRISPR GTGTAGGTCATGAGGGAAGG AGG (reversed) Intronic
901685134 1:10939557-10939579 ATGAAGGTCAGGAGGTAAGGTGG - Intergenic
902157962 1:14505014-14505036 GTGTAGCTCAGGAGGGAACTAGG + Intergenic
903539682 1:24089947-24089969 GTGTGGGGGATGAGGGCAGGTGG - Intronic
903839140 1:26225771-26225793 GTGGAGGGCATGAAGGAAGGAGG - Intergenic
904821915 1:33251069-33251091 GTGAAGGCCATGAGGCAAGGAGG + Intergenic
906442101 1:45856818-45856840 GTATATGTCATGAGGGTAGTGGG + Intronic
907470909 1:54672999-54673021 GTGTAGGTCAGGGGAGGAGGGGG - Intronic
907592323 1:55686877-55686899 GAGTAGGTCATGGAGGAAAGAGG - Intergenic
908670770 1:66544982-66545004 ATGTAGGACAGGAAGGAAGGAGG - Intronic
910479326 1:87641152-87641174 GTGGTGGTCAAGAAGGAAGGTGG + Intergenic
912655802 1:111485496-111485518 GTGTAGGTCAGGAAGGAAGGAGG - Intronic
912663870 1:111561497-111561519 GTGTATGTATTGGGGGAAGGAGG + Intronic
912982773 1:114391986-114392008 GAATAGGTTATGAGGGAAGCAGG - Intergenic
914747736 1:150512030-150512052 GTGTGGATCATGAGTGGAGGAGG - Intronic
915324742 1:155075620-155075642 GGGGAGGTCAGGAGGGAAGCGGG - Intergenic
915527559 1:156485325-156485347 CTCTTGCTCATGAGGGAAGGAGG + Intronic
915571291 1:156746699-156746721 GGGTGGGTCGTGGGGGAAGGTGG + Intronic
916508006 1:165445348-165445370 GTGTAGGTCAGGAGAGAGGCGGG + Intronic
917820507 1:178758535-178758557 GTGGAGGGGATGAGGGCAGGGGG - Intronic
918134747 1:181661542-181661564 GGGTAGGTCTTAAGGGAAAGAGG + Intronic
918881353 1:190126376-190126398 GTGGAGGTCAAGTGGGAATGTGG - Intronic
919843886 1:201628892-201628914 TTGTAGGTCAGGAAAGAAGGAGG - Intronic
920047870 1:203145378-203145400 GTGCAGGTCAGCGGGGAAGGTGG - Intronic
920604115 1:207363347-207363369 GTGTAGGGAAGGAGGCAAGGAGG - Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
922421183 1:225462085-225462107 GAGAAGGTGTTGAGGGAAGGAGG + Intergenic
922706985 1:227795234-227795256 GGGGAGCTCCTGAGGGAAGGCGG - Intergenic
922707013 1:227795296-227795318 GGGGAGCTCCTGAGGGAAGGAGG - Intergenic
922918800 1:229283220-229283242 GTGGAGGTCACCAGGGAAAGAGG - Intronic
924321433 1:242854910-242854932 ATGCAGGTCATCAGGGAAGTAGG + Intergenic
924903322 1:248425603-248425625 TTTCAGGCCATGAGGGAAGGGGG + Intergenic
924924540 1:248666201-248666223 TTTCAGGCCATGAGGGAAGGGGG - Intergenic
1063107053 10:3001490-3001512 GTTCAGGTCATGAGGGGAAGTGG - Intergenic
1063365357 10:5487136-5487158 GATTAGGACAGGAGGGAAGGTGG - Intergenic
1063561318 10:7130629-7130651 ATACAGGTCATGAGGGAAGTGGG + Intergenic
1064283410 10:13971008-13971030 GTGTGGGACAGGAGGCAAGGCGG - Intronic
1066052537 10:31648794-31648816 GTCTATTTCATTAGGGAAGGTGG + Intergenic
1066103940 10:32140696-32140718 GTTCAGGCCATGATGGAAGGGGG - Intergenic
1067068476 10:43116559-43116581 ATGTTGGAAATGAGGGAAGGGGG - Intronic
1070073818 10:73115788-73115810 GTTTAGTTCTTGGGGGAAGGGGG - Intronic
1070471364 10:76783428-76783450 GTGTAGGTCATATTGGAAGTGGG + Intergenic
1070520541 10:77249293-77249315 GTGTAGGACATTAGGGGAAGAGG + Intronic
1071198886 10:83194508-83194530 GTTCAGGTCATGACAGAAGGAGG + Intergenic
1072862441 10:99020641-99020663 GTGTATGTGTTGAGGGAGGGTGG + Intronic
1073125053 10:101144020-101144042 GTGTAGAAGGTGAGGGAAGGAGG - Intergenic
1073159389 10:101376759-101376781 TTGTAGGTCATAGGGTAAGGTGG + Intronic
1073295558 10:102436268-102436290 GAGTAGGTTAAGAGGGGAGGGGG - Intergenic
1074118655 10:110476928-110476950 GGGTGGGGCATGAGGGAAAGAGG - Intergenic
1074652294 10:115537455-115537477 ATGTAGGTCATTAAGGAAAGAGG - Intronic
1075305401 10:121363379-121363401 GTGAAGGTCTTGGGGTAAGGGGG - Intergenic
1075410743 10:122226170-122226192 GGGGAGGCCAGGAGGGAAGGAGG - Intronic
1076511189 10:131014661-131014683 GTGTTGGCAATGAGGGAAAGGGG + Intergenic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1076873328 10:133204118-133204140 GTGCAGGCCATGGGGGAACGTGG + Intronic
1077029165 11:455968-455990 GTGAAGGTCATGCAGCAAGGCGG - Intronic
1077138745 11:1014301-1014323 GGGTTGGTCATCAGGGAAGCTGG - Intronic
1077587527 11:3465269-3465291 GTGTTTGTCTTGAGGGACGGCGG + Intergenic
1077636269 11:3843258-3843280 GTGGAGGACATGAGAGCAGGAGG + Intergenic
1080541060 11:33265857-33265879 GGGTGGGTCATGAGGTCAGGAGG + Intronic
1080891125 11:36409998-36410020 GAATAGATCATGAGGTAAGGGGG + Intronic
1081443888 11:43110785-43110807 GTGCAGGTCAAGAGGGAAGTGGG - Intergenic
1083705189 11:64509264-64509286 GTGTAGGCCATCAGGGAGGTCGG - Intergenic
1083804921 11:65067789-65067811 GTCTAGGGGATGAGGGAAGTGGG + Intronic
1084191867 11:67503136-67503158 GTATAGGTGATGAGGGTTGGGGG + Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1085705579 11:78784365-78784387 CTGTAGGATATAAGGGAAGGGGG - Intronic
1087036785 11:93764143-93764165 GTGTAGGGCATAAGGGGACGAGG + Intronic
1091028782 11:132164991-132165013 GTGTAGGCCAACAGGGGAGGGGG - Intronic
1091387454 12:103842-103864 GTGGAGTTCATGAGGGGAGGCGG + Intronic
1091408041 12:221122-221144 ATGTTGGTGATGAGGGAAGCTGG - Intronic
1091667524 12:2430171-2430193 GATTAGGTCATGAGGGCAGAAGG - Intronic
1093262031 12:16950440-16950462 GTGTGGGTGATGAAGAAAGGAGG - Intergenic
1097590353 12:61566996-61567018 GCTCAGGTCATGATGGAAGGAGG + Intergenic
1097608436 12:61785106-61785128 GGGAAGGGCAGGAGGGAAGGAGG - Intronic
1098770160 12:74541148-74541170 GTGTGTGTTATGGGGGAAGGGGG + Exonic
1101463535 12:104923134-104923156 GTGTGGGTCACGAGGTCAGGAGG + Intronic
1102785668 12:115602569-115602591 GAGAAGGGGATGAGGGAAGGAGG - Intergenic
1104310965 12:127654016-127654038 GCGAAGGTCATGGAGGAAGGTGG - Intergenic
1105709703 13:22995322-22995344 GTGAAGGAAATGAGGGAGGGAGG + Intergenic
1106363036 13:29050102-29050124 GTGTAGGTAAGGAGAGAAAGGGG - Intronic
1108166435 13:47698075-47698097 GGGTAGGACATGGGGGTAGGTGG + Intergenic
1108323314 13:49306783-49306805 GAGGAAGTGATGAGGGAAGGCGG + Intergenic
1109986110 13:69987563-69987585 GTAAAGGGAATGAGGGAAGGAGG + Intronic
1110181778 13:72626027-72626049 GTACAGGTCATCAGGGAAGTCGG - Intergenic
1110356152 13:74570153-74570175 GTGTAGATCATGGAGGTAGGAGG + Intergenic
1111630005 13:90838417-90838439 GTTGAGGGCATGGGGGAAGGTGG - Intergenic
1112429443 13:99337748-99337770 GTGTAGGGCATGAACCAAGGAGG - Intronic
1113338051 13:109395549-109395571 GATTAGGTCATGAGGGAGGAGGG + Intergenic
1116278103 14:42862794-42862816 TTGTAGGTCATAGGGGAAAGAGG - Intergenic
1117768458 14:59107728-59107750 GTGCAGGTTATCAGGGAAGTTGG - Intergenic
1118122485 14:62860699-62860721 GGGTAGGTCCTGTGAGAAGGGGG - Intronic
1119988313 14:79165811-79165833 GTTATGGTCAGGAGGGAAGGTGG - Intronic
1120280924 14:82436812-82436834 CTGTAGGTCATGAGTCCAGGTGG - Intergenic
1121425016 14:93844376-93844398 GTTTAGGCCATGATGGAAAGTGG - Intergenic
1121873111 14:97427253-97427275 ATGTAGGTGATGAGGGAGGCAGG + Intergenic
1122314585 14:100818222-100818244 GAGGAGGCCATGAGGCAAGGTGG - Intergenic
1122393376 14:101406169-101406191 GTGCAGGTCAGGAGGTCAGGAGG + Intergenic
1122714520 14:103687016-103687038 GTGTGGCTCTTGTGGGAAGGAGG + Intergenic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1127545664 15:59992935-59992957 ATGTATATCATGTGGGAAGGAGG + Intergenic
1128010113 15:64285889-64285911 GTGTAGGCCATGAAAAAAGGAGG - Intronic
1129161860 15:73752075-73752097 GTGGGGGTTCTGAGGGAAGGCGG - Intronic
1129393263 15:75231143-75231165 GGTTAGGGCAGGAGGGAAGGTGG - Intergenic
1129846255 15:78768944-78768966 GTGAAGGGCATGAGGCCAGGTGG + Intronic
1129940858 15:79495438-79495460 GGGTGGGGCATGAGGGAGGGGGG + Intergenic
1130797062 15:87221003-87221025 CTGTAGGTCATGAGGAACTGAGG + Intergenic
1130969748 15:88722739-88722761 GTGAAGGTCAAGAGAGAAGGCGG - Intergenic
1131033800 15:89207775-89207797 GTGGAGGTGTTGATGGAAGGGGG - Intergenic
1131573642 15:93564632-93564654 GACTAGGGCATGAGGGGAGGTGG - Intergenic
1132036803 15:98491959-98491981 GTGATGGTCATGAGGAAATGTGG - Intronic
1133000277 16:2847318-2847340 ATGTAAGTCATCAGGGCAGGGGG + Intergenic
1133354940 16:5129214-5129236 GTGTTTGTCTTGAGGGACGGCGG + Intergenic
1133734852 16:8607272-8607294 ATGTAGCTCATTAGGGAAAGGGG + Intergenic
1134884066 16:17774324-17774346 GTGTAGCTCACCAGGGGAGGAGG - Intergenic
1136235299 16:28910206-28910228 GTGTAGGGCAGGAGGGTAGGAGG - Intronic
1136648925 16:31648827-31648849 GTGGAGTTCATGGGGGAAAGTGG - Intergenic
1139707310 16:68750206-68750228 GTGAAGGTCAAGAGGGAAACCGG - Intronic
1140766735 16:78166781-78166803 GTGTAGATCATGAGATCAGGAGG - Intronic
1141241802 16:82271749-82271771 GTGTAAATCATGGGGGAAGTAGG - Intergenic
1141832991 16:86520047-86520069 ATGTAGGTCATGAGGACAGGAGG + Intergenic
1141953320 16:87353305-87353327 GTGCGGGTCCTGAGGCAAGGGGG - Intronic
1144238800 17:13289005-13289027 ATTTAGGTCAAGAGGGAATGAGG + Intergenic
1150577441 17:66442595-66442617 GTGTGGGTGATGAGGAGAGGCGG - Intronic
1150740501 17:67775640-67775662 GTTCAGGTCATGATGGAAGAGGG - Intergenic
1151875648 17:76866905-76866927 GTGTGGGTCATCTGGGGAGGTGG - Intergenic
1152232499 17:79121132-79121154 GTGTAGGTGACGAGGCAGGGAGG - Intronic
1152279386 17:79376363-79376385 GTGTGGGTGGAGAGGGAAGGTGG + Intronic
1153065435 18:1039738-1039760 ATGCAGGTCATCAGGGAAGTAGG - Intergenic
1153371097 18:4316978-4317000 GTGTAGGTCATGAGGGAAGGAGG - Intronic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1153759844 18:8319971-8319993 GTGGGGGTCATGAGGGAGCGAGG + Intronic
1153953430 18:10076241-10076263 CAGGAGGTCATGAGGAAAGGAGG - Intergenic
1155316596 18:24577965-24577987 GTGTAGGTCAGGGTGGGAGGCGG + Intergenic
1158479526 18:57808485-57808507 GTGCAGGTCAGGAAGGAAGAGGG - Intergenic
1158640636 18:59200727-59200749 GTGTCGGACATGAAGGAATGGGG + Intergenic
1159311196 18:66712036-66712058 GTGAAAGTCATGTGGGAAAGAGG + Intergenic
1159687304 18:71438402-71438424 GAGTAGGCCCTGAGGGAAGAAGG + Intergenic
1160242571 18:77133610-77133632 GTGTAGGTCAGGAGGAACGCGGG - Intronic
1160585919 18:79913312-79913334 GTGTAGATGATGAGGGCAGCGGG - Intronic
1160963632 19:1735915-1735937 GAGGAGGCCAGGAGGGAAGGGGG + Intergenic
1161194658 19:2979712-2979734 GGGTAGATCATGAGGTCAGGAGG + Intronic
1165249780 19:34520625-34520647 GTTCAGGTCATAATGGAAGGAGG - Intergenic
1165257180 19:34585219-34585241 GTTCAGGTCATAATGGAAGGAGG - Intergenic
1166656184 19:44613769-44613791 GTGTAAGTCATGTGGGGAAGTGG + Exonic
1166860038 19:45804763-45804785 GTGGAGGAGATGACGGAAGGTGG - Exonic
926236820 2:11051854-11051876 GTGGAGGAGATGAGGGGAGGAGG + Intergenic
926727588 2:16010487-16010509 GTGTACATCCTGAAGGAAGGAGG - Intergenic
927019889 2:19005634-19005656 ATGTAGGTCATGGAGGAATGGGG - Intergenic
927886524 2:26721811-26721833 ATGTTTGTCCTGAGGGAAGGTGG - Intronic
929077181 2:38087664-38087686 GTGGAGGTCTTGAGGGAATGAGG - Intronic
929563370 2:42969480-42969502 GTGAAGGTCCAAAGGGAAGGGGG + Intergenic
929644573 2:43613769-43613791 GTGCAGGTCACGAGCGGAGGTGG - Intergenic
929842015 2:45476836-45476858 TTTTAAGTCATCAGGGAAGGAGG - Intronic
930357881 2:50344945-50344967 GTGTGAGTCCTGAGGGACGGAGG - Intronic
930774843 2:55161490-55161512 GTCTAGGACATGGGGGAAGTGGG + Intergenic
931415786 2:62079041-62079063 GTTTAGGACATGATGGGAGGTGG - Intronic
931683079 2:64768734-64768756 GTGTAGGGAGAGAGGGAAGGAGG - Intergenic
931967931 2:67554072-67554094 GATTAGGTAATGAGGGAGGGAGG - Intergenic
932815737 2:74860181-74860203 GTGGGGGGCATGAGGGTAGGAGG + Intronic
933150682 2:78911308-78911330 GTGTGTGTGATGGGGGAAGGGGG - Intergenic
934567711 2:95349758-95349780 CCGTAGGTCACCAGGGAAGGAGG - Intronic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
940285271 2:152027485-152027507 GTGTGAGTCAGGAGGGGAGGTGG - Intronic
941045593 2:160671759-160671781 GTGCAGTACTTGAGGGAAGGTGG + Intergenic
942654866 2:178204720-178204742 GTGGAGGTCTTGAGGGATTGTGG + Intronic
942719407 2:178933816-178933838 GGGTAGGTCATGAGGAATAGTGG + Intronic
943230203 2:185241340-185241362 GTGTAGGTTAGGAGGTAAGTGGG + Intergenic
944286927 2:197961217-197961239 TTGAAGGTCATTTGGGAAGGTGG + Intronic
945262626 2:207858959-207858981 GTCTAGGGCTTGGGGGAAGGAGG - Intronic
945969217 2:216219958-216219980 GTGTCGCTCATTAGGGAAAGGGG + Intergenic
946037250 2:216754086-216754108 CTCTAGGTCAGGAAGGAAGGGGG - Intergenic
946125689 2:217560607-217560629 GTGCAGGTCATGATGGGAAGAGG + Intronic
946510441 2:220349920-220349942 TTGTGGGGCATGGGGGAAGGGGG + Intergenic
946545708 2:220740665-220740687 GAGAAGGTCATGAGGTGAGGCGG + Intergenic
948294508 2:236850592-236850614 GTGAGGGTCAACAGGGAAGGAGG - Intergenic
948616521 2:239202734-239202756 GTGGAGCTCATGAGGTCAGGGGG - Intronic
949019467 2:241733263-241733285 GTGGAGGTCAGGTGGTAAGGGGG + Intergenic
1170630088 20:18058102-18058124 GTGCAGGTGATGGGGGAATGGGG - Intronic
1171136699 20:22701265-22701287 GTGGAGGTCCTAAAGGAAGGTGG + Intergenic
1171974482 20:31585676-31585698 GTTTAGGCCATGATGGAAGCGGG + Intergenic
1172888195 20:38245908-38245930 GTGTAAGTCAAGAGGGAAACAGG - Exonic
1173746564 20:45441890-45441912 GTTTAGGCCATGATGGAAAGGGG + Intergenic
1174135685 20:48377415-48377437 GTGGGGGTCTTGTGGGAAGGTGG - Intergenic
1175121842 20:56721901-56721923 GGGTAGGACGGGAGGGAAGGCGG - Intergenic
1175262636 20:57684360-57684382 GTTCAGGTCAGGAGGGAAGCAGG - Intronic
1176030414 20:63008718-63008740 GTGGGGGCCATGGGGGAAGGTGG + Intergenic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1178732848 21:35120642-35120664 GTGCAGGTCACCAGGGAAGTGGG - Intronic
1179401791 21:41091070-41091092 CTGTGGTTCATGAGGGAAGCGGG - Intergenic
1179979153 21:44887522-44887544 GTGCAGGTCAGGATGGCAGGAGG - Intronic
1179979173 21:44887602-44887624 GTGCAGGTCAGGATGGCAGGAGG - Intronic
1180641606 22:17303744-17303766 GTGGAGGTGATGAGGGAAGCTGG + Intergenic
1180835068 22:18925714-18925736 GTGCAGGACCTGTGGGAAGGAGG + Exonic
1180878820 22:19189127-19189149 GTGTGGATCATGAGGTCAGGAGG - Intronic
1181473413 22:23154381-23154403 GTGGAAGTCCTGAGAGAAGGGGG - Intronic
1181644940 22:24226051-24226073 GCGTAGGGCCTGGGGGAAGGCGG - Intronic
1182510399 22:30815614-30815636 GTGTATGTCCTGAGGGGAGATGG - Intronic
1183391479 22:37547687-37547709 GTTAATGTCATGGGGGAAGGTGG + Intergenic
1184799296 22:46750284-46750306 GTGGATGGCATGAGGAAAGGAGG + Intergenic
1185256978 22:49839472-49839494 GTGTGGGGAATGAGGGTAGGCGG + Intergenic
1203285157 22_KI270734v1_random:151013-151035 GTGCAGGACCTGTGGGAAGGAGG + Intergenic
949269254 3:2195056-2195078 GTGTAGGGAAGGAGGGAATGGGG - Intronic
950398432 3:12752000-12752022 GAGTACTTCATGAGGGAAGTGGG - Intronic
950859401 3:16134377-16134399 GTCTAGGTCATAAAGGAATGTGG - Intergenic
951825190 3:26860441-26860463 GTGTATGGCAGGAGGGAAGGGGG - Intergenic
953794843 3:45976593-45976615 GTATATGTGATGGGGGAAGGGGG + Intronic
954025849 3:47782296-47782318 GTGGAGGGCCTGAGGGAAAGCGG - Intergenic
957381781 3:79440293-79440315 GTGCAGGTAATGAGGGATAGGGG - Intronic
959873613 3:111356694-111356716 TTGTGGTTCATGAGAGAAGGTGG + Intronic
960338927 3:116451381-116451403 GTGTATGTTATGAGGGTAGTTGG + Intronic
960785447 3:121368922-121368944 GTGTAGGGCTTGCGGGAATGAGG + Intronic
961294642 3:125874819-125874841 GTGTTTGTCTTGAGGGACGGCGG - Intergenic
961870190 3:129981925-129981947 ATGTGGGTAATAAGGGAAGGAGG - Intergenic
961891322 3:130132658-130132680 GTGTTTGTCTTGAGGGATGGCGG + Intergenic
961966797 3:130913283-130913305 GTTTTGGTTATGAGGCAAGGTGG + Intronic
962259642 3:133894791-133894813 GTGCAGGCCATGGGGGAACGGGG - Intronic
962411176 3:135143103-135143125 GTGAAGGCTCTGAGGGAAGGAGG + Intronic
962613554 3:137102285-137102307 TTGTGGGAGATGAGGGAAGGAGG - Intergenic
962974175 3:140431700-140431722 GGGTAGGTGATGGGGGAATGGGG + Intronic
964248648 3:154684485-154684507 GTGCAGGTCACCAGGGAAGTAGG + Intergenic
966242034 3:177765603-177765625 GTGGAGGCAATGAGGAAAGGAGG + Intergenic
966311026 3:178594039-178594061 GGGTAGGTAAGGAGGGAGGGAGG - Intronic
966557201 3:181276030-181276052 ATATAGTTCATAAGGGAAGGAGG - Intergenic
966679091 3:182621271-182621293 GTGGAGGTCAAGAGGCAGGGAGG + Intergenic
967282908 3:187839630-187839652 GTGTGGGTCATCACGGAATGGGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968120326 3:196121449-196121471 GTGTAGGTCTGGTGGGTAGGGGG - Intergenic
968594426 4:1474909-1474931 GTGTGTGTCAGGAGAGAAGGTGG + Intergenic
969492548 4:7508234-7508256 ATGAAGGTCAGGAGGGAGGGAGG + Intronic
969751307 4:9113428-9113450 GTGTTTGTCTTGAGGGACGGTGG - Intergenic
970235540 4:13954888-13954910 GTTTGGGTCATGAGGGGAGGCGG - Intergenic
970472062 4:16388871-16388893 GTACAGATAATGAGGGAAGGGGG - Intergenic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
972135805 4:35891562-35891584 GTGGTGGTCATGAGGCATGGTGG - Intergenic
972416191 4:38842718-38842740 GATTAGGTCATGAGGACAGGCGG - Intronic
972779210 4:42271357-42271379 CTGTAGCTCCTGAGGGGAGGTGG - Intergenic
973336556 4:48962541-48962563 GTTCAGGTCATGATGGAAGGGGG - Intergenic
973897067 4:55423836-55423858 AAGGAGGTCATGAGGGTAGGTGG - Intronic
975695536 4:77009186-77009208 GTGTATGACATAAGAGAAGGAGG + Intronic
977681329 4:99801599-99801621 GTCTAGGCCATGTGGGAAGTGGG - Intergenic
977992950 4:103466706-103466728 GTTCAGGTCATGATGGAAGCAGG - Intergenic
978081280 4:104594929-104594951 GTGTAGCTCATGCAGGAAAGTGG + Intergenic
982800326 4:159697842-159697864 ATACAGGTCATCAGGGAAGGTGG + Intergenic
983445606 4:167846599-167846621 CTGTAGTTCATGAAGCAAGGAGG - Intergenic
984244861 4:177263107-177263129 GAGTAGGTCAGCAAGGAAGGTGG + Intergenic
984474383 4:180217234-180217256 ATGGAGGTCAAGAGGGAAAGTGG - Intergenic
984785768 4:183566044-183566066 ATGGAGGAAATGAGGGAAGGAGG + Intergenic
984869290 4:184312407-184312429 GTTCAGGTCATGAGGGGAAGGGG + Intergenic
986681082 5:10233253-10233275 GTGGAGGCCATGAGGGGAGGGGG - Intronic
987546635 5:19318894-19318916 GTGTAGGTGATGGGGGATGCAGG - Intergenic
991513970 5:67413425-67413447 TTGCAGGTAATGAGAGAAGGTGG - Intergenic
991613748 5:68474887-68474909 GTGTAGGTCATAAGGAAATGTGG + Intergenic
993509815 5:88757580-88757602 CTGTAGTTAATTAGGGAAGGGGG - Intronic
997394933 5:133552125-133552147 GTGGAGGGCAGGAGGGAAGGTGG - Intronic
998499657 5:142621387-142621409 GTGGAGGAAAGGAGGGAAGGAGG - Intronic
1000129629 5:158283686-158283708 GTGTATGTGGTGGGGGAAGGGGG + Intergenic
1000460400 5:161509854-161509876 ATGCAGGTCATGAGGTAGGGAGG - Intronic
1000903206 5:166933407-166933429 GTTCAGGTCATGATGGAAGAGGG - Intergenic
1001282635 5:170398161-170398183 GTTCAGGTCATGATGGAAAGAGG - Intronic
1002807580 6:591845-591867 GTGGAGGCCCTGAGGGAAGCTGG - Intronic
1003644696 6:7905027-7905049 GAGTAGGCCACAAGGGAAGGAGG - Intronic
1007039916 6:38712143-38712165 GTGCAGGCCATGATGGAAGGAGG + Intergenic
1007322806 6:41039418-41039440 GTCTAGGTCTGGAAGGAAGGAGG + Intronic
1007776446 6:44226940-44226962 GTGGAGAGCAGGAGGGAAGGAGG - Intronic
1008231202 6:48986701-48986723 ATGCAGGTCACCAGGGAAGGGGG - Intergenic
1008674719 6:53807277-53807299 GTGGAGTGAATGAGGGAAGGAGG - Intronic
1008762918 6:54875720-54875742 GTGGAGGGGAAGAGGGAAGGTGG + Intronic
1010659939 6:78557625-78557647 GTGTGGGGCAGGTGGGAAGGGGG - Intergenic
1011788128 6:90868781-90868803 GTGGAGGTGAGGAGGGAAAGAGG + Intergenic
1012898276 6:104976796-104976818 GTGAAGGGCAAAAGGGAAGGAGG + Intronic
1012971299 6:105734527-105734549 GGGGAGGTTATGGGGGAAGGGGG - Intergenic
1013811711 6:114052139-114052161 GAGTAGGTCATAAGAGAAGGTGG - Intergenic
1013898290 6:115120781-115120803 ATGTAGGTAATTGGGGAAGGGGG - Intergenic
1014146641 6:118005581-118005603 GTGGAGGACAGGAGAGAAGGAGG - Intronic
1014683860 6:124470085-124470107 GGGCAGGTCATGAGTGAGGGTGG + Intronic
1015228127 6:130882211-130882233 GTGTGGGGGAGGAGGGAAGGAGG - Intronic
1015536680 6:134273774-134273796 GTTTAGGTCATGGGGCAATGAGG + Intronic
1016290037 6:142518684-142518706 ATGTAGGTCGTCAGGGAAGTGGG + Intergenic
1017681191 6:156865792-156865814 GTGGAGGGAAGGAGGGAAGGAGG - Intronic
1018037884 6:159897207-159897229 GTGTAGGGCACCAGGGAATGTGG + Intergenic
1018759376 6:166877960-166877982 GTTCAGGCCATGAGGGAAAGTGG - Intronic
1019305945 7:335809-335831 GTGGAGGGCAAGAGGGAAGGTGG + Intergenic
1019404909 7:877915-877937 GTGGAGGCCAGGGGGGAAGGTGG - Intronic
1020240395 7:6390007-6390029 GAGTAGGAGAGGAGGGAAGGAGG - Intronic
1020321659 7:6943216-6943238 GTGTTGGTCTTGAGGGACGGCGG + Intergenic
1021099390 7:16571265-16571287 GTTCAGGCCGTGAGGGAAGGGGG + Intronic
1021380648 7:19961918-19961940 GATGAGGTCATGAGGGCAGGGGG + Intergenic
1023256755 7:38320002-38320024 GTGTTGGTGAGGAGTGAAGGTGG + Intergenic
1027521498 7:79215090-79215112 GTTCAGGTCATGATGGAAAGAGG + Intronic
1029580603 7:101434614-101434636 GTGTTGGTGAGGAGAGAAGGCGG + Intronic
1029745163 7:102512445-102512467 GTGGGGGTTAAGAGGGAAGGGGG + Intronic
1029763155 7:102611606-102611628 GTGGGGGTTAAGAGGGAAGGGGG + Intronic
1031675772 7:124610292-124610314 GTGCAGGTCACCAGGGAAGTGGG - Intergenic
1034182718 7:149150711-149150733 GTCTAGGGCAGGAGGGGAGGCGG - Intronic
1034984041 7:155496580-155496602 GTGGTAGCCATGAGGGAAGGAGG - Intronic
1035184331 7:157113977-157113999 GGGTAGTTTATGAAGGAAGGAGG - Intergenic
1036374513 8:8188842-8188864 GTGTTTGTCTTGAGGGAAGGCGG - Intergenic
1036855029 8:12234305-12234327 GTGTTTGTCTTGAGGGAAGGCGG + Intergenic
1036876390 8:12476793-12476815 GTGTTTGTCTTGAGGGAAGGCGG + Intergenic
1037182561 8:16025066-16025088 CTGTATGCAATGAGGGAAGGTGG + Intergenic
1037502240 8:19497174-19497196 GTGCAGGGCAGGAGGGAAGTGGG - Intronic
1039064686 8:33598469-33598491 GTGTGTGTCTTGAGGGGAGGGGG + Intronic
1039386755 8:37143049-37143071 GTGTAGGTGAGGCGGGGAGGAGG - Intergenic
1040055672 8:43055466-43055488 GTTCAGGCCATGATGGAAGGAGG - Intronic
1040671083 8:49691432-49691454 ATGCATGTCATGAGGGAAGTAGG + Intergenic
1040711548 8:50195199-50195221 ATGCAGGTCATCAGGGAAGTGGG + Intronic
1041366789 8:57114836-57114858 GTGGAAGTCATGCGGGAAAGTGG + Intergenic
1043415890 8:80048582-80048604 GGGTAGTTCTTGAGGGAACGTGG + Intronic
1043523796 8:81074313-81074335 GTGAGGATCATGAGGGAAGAGGG + Intronic
1045226540 8:100252249-100252271 GGGAAGATAATGAGGGAAGGAGG + Intronic
1046916151 8:119680352-119680374 GGGAACGTCATGAGGGATGGTGG - Intergenic
1047180412 8:122582498-122582520 GGGTAGGATGTGAGGGAAGGAGG - Intergenic
1047368873 8:124238357-124238379 CTGTATGTGAGGAGGGAAGGTGG - Intergenic
1047464403 8:125098673-125098695 GTATAGGATATGAGGGGAGGAGG + Intronic
1049586238 8:143433641-143433663 GTGTAGGTCATGTGAGGAAGGGG + Intergenic
1049702328 8:144020898-144020920 GAGAAGGTCCTGAGGGAAGAGGG - Intronic
1049702418 8:144021220-144021242 GAGAGGGTCCTGAGGGAAGGCGG - Intronic
1049702843 8:144022946-144022968 GGGTAGGTCATGAGGGGAAAGGG - Intronic
1049702912 8:144023174-144023196 GGGTAGGTCCTGAGGAAAGAGGG - Intronic
1049702923 8:144023210-144023232 GGGTAGGTCCTGAGGGGAGAGGG - Intronic
1049703056 8:144023715-144023737 GAGAGGGTCCTGAGGGAAGGGGG - Intronic
1049703290 8:144024525-144024547 GAGAGGGTCCTGAGGGAAGGGGG - Intronic
1049703345 8:144024748-144024770 GAGAGGGTCCTGAGGGAAGGAGG - Intronic
1049703349 8:144024764-144024786 GGGTAGGTCTTGAGGGGAGAGGG - Intronic
1049791142 8:144473252-144473274 GTGTCGGTGCTGAGGGAAGAAGG - Exonic
1049832588 8:144711569-144711591 GCATAGGTCTTGAGGGAAGCTGG + Intergenic
1050636478 9:7618206-7618228 GTTTAGGCCATGATGGAAGAGGG + Intergenic
1050796865 9:9557210-9557232 GTTCAGGCCATGATGGAAGGGGG + Intronic
1053275271 9:36778758-36778780 GTGTTGCTCAGGAGGGGAGGTGG + Intergenic
1055092942 9:72381097-72381119 GTGTTTGTTTTGAGGGAAGGTGG + Intergenic
1055984024 9:82037166-82037188 GAGTAGGGAATGAGGGAATGAGG + Intergenic
1056719261 9:89058998-89059020 GTGTAGGACATGATGGAGGGCGG + Intronic
1060237560 9:121876587-121876609 GTGTAGGGAATGAGAGAATGTGG + Intronic
1060374383 9:123105528-123105550 GGGCAGGTCAAGCGGGAAGGGGG - Intergenic
1060387418 9:123244535-123244557 GGGAAAGTCATGAGGGAAGAAGG + Intronic
1061060884 9:128250088-128250110 GAGTAGGCAAAGAGGGAAGGAGG - Intronic
1061488118 9:130930576-130930598 GTGCAGGGCATGGGGGGAGGTGG - Intronic
1185509313 X:651036-651058 GTGCAGGTCCCGTGGGAAGGAGG + Intronic
1186819156 X:13269025-13269047 GTGTTGGCCTTGAGGGGAGGTGG + Intergenic
1186951592 X:14632079-14632101 TTCTAGGTCATGATGCAAGGAGG - Intronic
1187668702 X:21646131-21646153 GTGTAGGGGATGGGGGCAGGGGG + Intronic
1189828742 X:44948407-44948429 TTTTAGTTCATGAGAGAAGGGGG + Intronic
1189884349 X:45525642-45525664 TTGTAGCTAATGAGGGATGGTGG + Intergenic
1190604712 X:52128709-52128731 GTTCAGGTCATGATGGAAAGTGG + Intergenic
1192310207 X:70005609-70005631 GTGTAGGTATTGAGGGAAAGTGG + Intronic
1193289120 X:79751200-79751222 GTGTAGATCATGAGGTCAGGAGG + Intergenic
1193447888 X:81627427-81627449 GTGGAGGGCAGGAGGGAATGGGG - Intergenic
1193820871 X:86163177-86163199 GTGAAGGGCTGGAGGGAAGGTGG - Intronic
1194824140 X:98541009-98541031 GTTCAGGTCATGATGGAAAGGGG - Intergenic
1195407132 X:104527129-104527151 GTTTAGGTCATGAGGATAGAGGG - Intergenic
1195502765 X:105621661-105621683 GTGTTAGTCAAAAGGGAAGGGGG + Intronic
1201306681 Y:12556553-12556575 ATGCAGGTCATCAGGGAAGTGGG - Intergenic
1201339468 Y:12917786-12917808 GTGTGGATCATGAGGTCAGGAGG - Intronic
1201452430 Y:14130573-14130595 GAGAAGGTGAAGAGGGAAGGAGG - Intergenic