ID: 1153372303

View in Genome Browser
Species Human (GRCh38)
Location 18:4333229-4333251
Sequence CATCTGGGATGAGCAGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 184}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153372303_1153372310 5 Left 1153372303 18:4333229-4333251 CCAGGGGCTGCTCATCCCAGATG 0: 1
1: 0
2: 4
3: 11
4: 184
Right 1153372310 18:4333257-4333279 ACTTACAGGTTTACGGCAGTTGG 0: 1
1: 0
2: 0
3: 2
4: 47
1153372303_1153372308 -2 Left 1153372303 18:4333229-4333251 CCAGGGGCTGCTCATCCCAGATG 0: 1
1: 0
2: 4
3: 11
4: 184
Right 1153372308 18:4333250-4333272 TGGCCTCACTTACAGGTTTACGG 0: 1
1: 0
2: 0
3: 16
4: 160
1153372303_1153372305 -9 Left 1153372303 18:4333229-4333251 CCAGGGGCTGCTCATCCCAGATG 0: 1
1: 0
2: 4
3: 11
4: 184
Right 1153372305 18:4333243-4333265 TCCCAGATGGCCTCACTTACAGG 0: 1
1: 0
2: 16
3: 22
4: 177
1153372303_1153372312 17 Left 1153372303 18:4333229-4333251 CCAGGGGCTGCTCATCCCAGATG 0: 1
1: 0
2: 4
3: 11
4: 184
Right 1153372312 18:4333269-4333291 ACGGCAGTTGGCTGATGACTGGG 0: 1
1: 0
2: 0
3: 4
4: 78
1153372303_1153372311 16 Left 1153372303 18:4333229-4333251 CCAGGGGCTGCTCATCCCAGATG 0: 1
1: 0
2: 4
3: 11
4: 184
Right 1153372311 18:4333268-4333290 TACGGCAGTTGGCTGATGACTGG 0: 1
1: 0
2: 0
3: 2
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153372303 Original CRISPR CATCTGGGATGAGCAGCCCC TGG (reversed) Intronic
900142113 1:1143066-1143088 CAGCTGGGCTGAGCCACCCCGGG + Intergenic
900561491 1:3309250-3309272 CCTCTGGGCACAGCAGCCCCTGG + Intronic
901466689 1:9426255-9426277 CATCCCTGAGGAGCAGCCCCTGG - Intergenic
901654158 1:10759796-10759818 CACATAGGAAGAGCAGCCCCCGG + Intronic
901799835 1:11701658-11701680 CGGCTGGGAGGAGCAGACCCTGG + Intronic
903137913 1:21321385-21321407 CCACTGGGAGGAGCAGCCCTGGG + Intronic
903318609 1:22527922-22527944 CGGCTGGGATGAGCTGTCCCAGG - Exonic
904270128 1:29344368-29344390 CTTCTGATGTGAGCAGCCCCAGG + Intergenic
904428407 1:30446476-30446498 CTTCTGATGTGAGCAGCCCCAGG - Intergenic
906692228 1:47800077-47800099 CAACTGGCTGGAGCAGCCCCTGG - Intronic
906749081 1:48242632-48242654 CCTCTGTGATGAGTATCCCCCGG - Intronic
910178600 1:84457626-84457648 CATCTGGTATCAGCACCCCGAGG - Intergenic
912970246 1:114274785-114274807 CCTCTGAGCTGAGCAGGCCCTGG - Intergenic
913208545 1:116564256-116564278 CATCTGAGATGAGCAGCATTTGG + Intronic
916509712 1:165461235-165461257 CATCTGGGAATAGCAGACCCTGG - Intergenic
919865640 1:201780905-201780927 ACTCTGAGATGAGCAGCGCCAGG + Intronic
920436938 1:205953200-205953222 CATCTGGAAGCAGCAGCCCCAGG - Intergenic
1063906384 10:10784239-10784261 GAGCTGGGATGAGCACCCCTGGG + Intergenic
1067180529 10:43982492-43982514 CATCAGGGTTGGGCAGGCCCTGG - Intergenic
1069659509 10:70114373-70114395 ACTCTGGGAGGTGCAGCCCCAGG - Intronic
1070326788 10:75395065-75395087 TAAATGGGATGAGCAGCCCTTGG + Intergenic
1070750726 10:78962584-78962606 CACCTGGGATGGGGAGCCACTGG - Intergenic
1071495330 10:86164003-86164025 CAGCTGGAGTGAGCAGCACCGGG - Intronic
1076033011 10:127175463-127175485 CATCGGGGGTGAGCAGGCCAGGG + Exonic
1076481278 10:130786678-130786700 CAGATGGGATGGGAAGCCCCCGG - Intergenic
1078645910 11:13141249-13141271 CATCTGGAAAGGGCAGCCCCTGG + Intergenic
1080459544 11:32441130-32441152 CAACTGGGATATGCAGCCGCTGG + Intergenic
1081184344 11:40023612-40023634 CATCTGCCATGGGCAGCTCCTGG + Intergenic
1081813442 11:45925989-45926011 CACCTGGGACGACCAGCTCCTGG - Intronic
1083233870 11:61339666-61339688 CATTTGGGAGGAGAAGCACCAGG - Intronic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1091120604 11:133054504-133054526 CCTCTGTGAGGAGCAGCCCTGGG - Intronic
1096113663 12:49042785-49042807 CATCTGGGTTGTGGAACCCCTGG - Exonic
1096510199 12:52123595-52123617 CTCCTGGGAGGAGCAGCCTCTGG + Intergenic
1102525182 12:113507540-113507562 AACCTGGGAGGACCAGCCCCTGG - Intergenic
1102554635 12:113718978-113719000 CCCCAGGGAGGAGCAGCCCCAGG - Intergenic
1104067316 12:125316661-125316683 CTTCCGGAATGAGCTGCCCCAGG - Intronic
1104976274 12:132553327-132553349 CTTCTGGGCTCAGCAGTCCCAGG - Intronic
1106162288 13:27212263-27212285 CATCTGGGACGAGCTCCCTCTGG + Intergenic
1106593213 13:31115598-31115620 CCTTTGGGCAGAGCAGCCCCTGG + Intergenic
1107815851 13:44243706-44243728 CCTCTGCCCTGAGCAGCCCCTGG - Intergenic
1108409301 13:50130794-50130816 CATCTTTTCTGAGCAGCCCCGGG + Intronic
1111036242 13:82677898-82677920 CATCTGAGATGAGCAGCATTTGG + Intergenic
1113518718 13:110922668-110922690 CAGTTGGGATGAACTGCCCCCGG - Intergenic
1119268130 14:73277162-73277184 CGTCCGGGCTCAGCAGCCCCAGG - Exonic
1121566359 14:94912939-94912961 CAGCTGGGGTGAGATGCCCCAGG - Intergenic
1126453484 15:48835643-48835665 CATCAGGGAGGAACAGCCCAAGG + Intronic
1126931100 15:53652291-53652313 CATACTGGATTAGCAGCCCCAGG - Intronic
1127384591 15:58457073-58457095 GATGTGGGCTGAGCAGCCCTTGG + Intronic
1128231518 15:66038831-66038853 CATCTGTGCCGAGCAGCACCTGG + Intronic
1128309722 15:66622442-66622464 CACCTGGGAGGGGCAGCCCGGGG - Intronic
1130017929 15:80201778-80201800 CACCTGGGAGGAGCAGCACCTGG - Intergenic
1130411841 15:83654239-83654261 TATCTGGGACGTGCAGCCCCGGG - Exonic
1131596534 15:93803647-93803669 CATCTGGAAAGCGGAGCCCCGGG + Intergenic
1132051479 15:98611189-98611211 CGTCTGGGGTGAGCACGCCCGGG - Intergenic
1132232562 15:100194778-100194800 CAGCTGGGATGACACGCCCCAGG - Intronic
1132352447 15:101148500-101148522 CAGCTGGGAGGGGCAGTCCCAGG + Intergenic
1133252613 16:4493537-4493559 CAACTGGGATGGGCAGAACCAGG + Intronic
1133379025 16:5314413-5314435 GATCTGGGAGAAGCAGCACCAGG + Intergenic
1136024050 16:27458680-27458702 CATCTGGGCTGTGCATTCCCTGG + Intergenic
1139474190 16:67194438-67194460 CCTCTGGGATGGGCACCTCCAGG - Exonic
1144371243 17:14593889-14593911 CACCTGGGAGGAGGAGCCCAGGG + Intergenic
1144630990 17:16872416-16872438 CAGCTGGGAGAAGCAGCCCAAGG - Intergenic
1144650324 17:17003060-17003082 CAGCTGGGAGAAGCAGCCCAAGG + Intergenic
1147163023 17:38578836-38578858 CTTGGGGGATGGGCAGCCCCAGG - Intronic
1147185129 17:38709181-38709203 CATCTGCGAGGAGCAGGGCCGGG + Exonic
1151369305 17:73637861-73637883 CATCTGGGTTGGGCAGCCCCTGG - Intronic
1151681769 17:75626207-75626229 CATCTGGTTTGAGCTGCCACAGG + Intergenic
1152437128 17:80283303-80283325 CACCTCGGAGCAGCAGCCCCAGG - Intronic
1152487397 17:80602980-80603002 CATCTGGGATGATCATCCAATGG - Intronic
1152583643 17:81179779-81179801 CATCTGGGATGCCCTGCTCCGGG - Intergenic
1153372303 18:4333229-4333251 CATCTGGGATGAGCAGCCCCTGG - Intronic
1153507343 18:5814663-5814685 CGTCTGGGCTGAGGAGCACCAGG + Intergenic
1153973470 18:10246840-10246862 CATCTGGGATGAGCAGTTTGCGG - Intergenic
1156363703 18:36406633-36406655 GATCTGAGATGAGCTGCCCTTGG + Intronic
1156394946 18:36691074-36691096 GCTCTGGGATGAGTGGCCCCTGG + Intronic
1160912879 19:1482944-1482966 CTTCTGGGATGAGAACCCACAGG - Exonic
1163776201 19:19219276-19219298 CATCGAGGATGAGCAGGACCTGG + Exonic
1164011844 19:21210492-21210514 CAGCTGGGCTGGGCAGCCTCAGG - Intergenic
1164776650 19:30858297-30858319 TGGCTGGGAGGAGCAGCCCCTGG - Intergenic
1165257495 19:34588588-34588610 CCTCTGGCATGCTCAGCCCCAGG + Intergenic
1166114001 19:40641586-40641608 AATCTGGGAGGCGCAGGCCCTGG + Intergenic
1168326550 19:55541436-55541458 CATCTGCGTGGACCAGCCCCCGG + Exonic
1168630892 19:57955225-57955247 CACATGGGATGGGCAGCCCCGGG - Intergenic
927277552 2:21274472-21274494 CAGCAGGGAAGAGCTGCCCCTGG + Intergenic
927972303 2:27313315-27313337 AAACTGGGATGAGCAGACCCAGG + Intronic
930990760 2:57650966-57650988 CAGGTGGGGTGAGAAGCCCCTGG + Intergenic
931776839 2:65548138-65548160 CATCTGGGATGAGATGCTGCAGG + Intergenic
932425517 2:71631904-71631926 CATCAGGGAGGAGGAGGCCCTGG + Intronic
934546143 2:95218118-95218140 CAGATGGGTTTAGCAGCCCCAGG - Intronic
937099276 2:119256273-119256295 CTTCTGAGATGAGCAGAGCCAGG - Intronic
937212962 2:120289343-120289365 CATTTGTGATGAGCATCCCAGGG + Intronic
939826365 2:147020193-147020215 CTTCTGTTATGTGCAGCCCCTGG + Intergenic
946024928 2:216665934-216665956 CACCTGGGGACAGCAGCCCCGGG - Intergenic
946821881 2:223638376-223638398 CATTTCGGATGAGCACCTCCAGG - Intergenic
947047909 2:226009012-226009034 CTTCATGCATGAGCAGCCCCTGG - Intergenic
947828798 2:233124692-233124714 TAGCTGGGATGGGCAGCCCGAGG - Intronic
947961400 2:234241032-234241054 CATCTGGGATGATCTCACCCTGG + Intergenic
948566534 2:238890842-238890864 AATCTGGGAAGGGCAGACCCTGG - Intronic
1172292659 20:33787613-33787635 CATCAGGCAAGAGCTGCCCCAGG + Intronic
1173185288 20:40835873-40835895 CATCAGGGATGCTCAGCACCTGG - Intergenic
1174175551 20:48642315-48642337 CATCTGGGACCCACAGCCCCCGG + Intronic
1175384877 20:58587756-58587778 CATGTGGGCTGAGAAGACCCCGG - Intergenic
1175768217 20:61605962-61605984 CCCCTGGGATGAGGAGGCCCTGG + Intronic
1176025300 20:62982501-62982523 GATCTGGCATGAGAAGCCTCCGG + Intergenic
1176376135 21:6087669-6087691 CCTCAGGGCTGAGGAGCCCCGGG + Intergenic
1179747340 21:43450575-43450597 CCTCAGGGCTGAGGAGCCCCGGG - Intergenic
1180675374 22:17582630-17582652 CATCTTCCATGAGCAGCCGCCGG - Exonic
1182759274 22:32708905-32708927 CATCTGGGCTGTGCAGCCTGCGG - Intronic
1184506797 22:44908537-44908559 CATGTGGGATGGCCAGCCCAGGG - Intronic
1185039953 22:48498728-48498750 CAACTGGGAGGAGGGGCCCCTGG - Intronic
1185060341 22:48603266-48603288 CATGTGGGCAGAGCAGCCTCCGG - Intronic
950989665 3:17419397-17419419 CATCTGGGATATGCAGGCCTTGG - Intronic
951058842 3:18180369-18180391 CATGTGGGATGAGCAGAAGCAGG + Intronic
951411536 3:22372553-22372575 CATCCGGGAGGAGCAGCCGCCGG + Intronic
951754676 3:26077226-26077248 CAGCTTAGATGAGCAGCACCAGG + Intergenic
953084087 3:39650771-39650793 CCTCTGTGGTCAGCAGCCCCTGG - Intergenic
954333088 3:49901168-49901190 CATCTGGGTTGAGAGGCCCTAGG - Intronic
954422577 3:50426422-50426444 CACCTTGGCTGAGCTGCCCCAGG - Intronic
958563724 3:95780942-95780964 CATCTGAGATGAGCAGCATTTGG - Intergenic
960468855 3:118034661-118034683 CCTCTGGGATGAGCAAGCACTGG + Intergenic
960987252 3:123288967-123288989 CAGTTTGGATGAGCAGCCACTGG + Intronic
961498808 3:127315811-127315833 CCTCTAGGATGAGCAGCCCCTGG - Intergenic
961561349 3:127732592-127732614 CACCTGGGGTGAGCAGCTCTAGG - Intronic
961901173 3:130213340-130213362 CATGTGGGTAGAGCAGGCCCTGG + Intergenic
963728526 3:148948223-148948245 CATCTGGGGTGTGAAGCCCAAGG - Intergenic
963836582 3:150063659-150063681 TATCTGGGATGAGAAGAGCCTGG - Intergenic
964733468 3:159892116-159892138 CATCTCGGATGAGAAGCAGCTGG - Exonic
964943501 3:162190195-162190217 CATCTGAGATGAGCAGCATTTGG - Intergenic
967729304 3:192892763-192892785 CAGCTGGTACGAGCAGACCCAGG + Intronic
967775447 3:193381538-193381560 CTTCTGGGAGAAGCAGCCTCAGG + Intergenic
968281023 3:197476730-197476752 GCTGTGGGATGAGGAGCCCCTGG + Intergenic
968760995 4:2442759-2442781 CAGCTGGGAGGAGCAGCCCCCGG - Intronic
969335069 4:6502966-6502988 CTTCTGGAATGTGCAGCCCAGGG - Intronic
969466094 4:7357318-7357340 CATCTGGGATTAGGAACCACTGG - Intronic
969710557 4:8840746-8840768 CAGCGGGGCTGAGCCGCCCCAGG + Intergenic
969715746 4:8867423-8867445 ACTCTGGGCTGCGCAGCCCCCGG - Exonic
981866809 4:149431300-149431322 CAGCAGGGATGAGCAGCAACTGG - Intergenic
982564701 4:156971987-156972009 CCTCTGGGAGGGGCAGCCCTGGG + Intergenic
986977487 5:13410402-13410424 CCTCTGGGCTGAACAACCCCTGG + Intergenic
993547465 5:89230068-89230090 CATCAGGCCTGAGCAGACCCAGG - Intergenic
995745860 5:115402516-115402538 CACCTGGTATGAGCTTCCCCTGG - Intergenic
997455861 5:134017001-134017023 CATCTGGGAAGAACATGCCCAGG - Intergenic
997570133 5:134921043-134921065 CAGGTGGGTGGAGCAGCCCCAGG + Intronic
997627661 5:135341948-135341970 AAGCTGGGATGGGAAGCCCCAGG + Intronic
998005127 5:138651623-138651645 CCTGCAGGATGAGCAGCCCCTGG - Intronic
998164753 5:139836691-139836713 CATGGAGGAAGAGCAGCCCCAGG - Intronic
999134306 5:149307592-149307614 CATCAGGGAGGACCAGCTCCTGG + Exonic
1001544721 5:172563872-172563894 CATGTGGGATCAGAAGCCCTGGG + Intergenic
1002023606 5:176382271-176382293 GTTCTGAGATGAGCAGCTCCAGG - Intronic
1005352480 6:24949827-24949849 CACCTGGAAGGGGCAGCCCCTGG + Intronic
1005578237 6:27210077-27210099 CAGCTGGGAGGAGCAGGTCCGGG - Intergenic
1006011465 6:31046025-31046047 GAGCTGGGAGGAGCAGCCCTGGG - Intergenic
1006923567 6:37641483-37641505 CAAATGGGCTGAGCACCCCCAGG + Intronic
1007756583 6:44103509-44103531 CATCTGGGATGGGGAGCCACTGG + Intergenic
1008232777 6:49004839-49004861 CATATGGGATCAGCATCACCTGG - Intergenic
1010143096 6:72634098-72634120 CATCTGATATGAGGAGCCCTGGG - Intronic
1013665440 6:112342674-112342696 CACCTGGGAGCATCAGCCCCTGG - Intergenic
1016142331 6:140627645-140627667 CATCTGAGATGAGCAGCATTTGG + Intergenic
1017029111 6:150205290-150205312 CTTCTGGGACCAACAGCCCCTGG + Intronic
1017515300 6:155151072-155151094 CATCTGGGAATAGCTTCCCCTGG + Intronic
1018177339 6:161188778-161188800 CCTCTGGGTTGAGCAGCCAGCGG + Intronic
1018652550 6:166004209-166004231 CTTCTGGGAAGAGCACCCCCAGG - Intergenic
1019038529 6:169083338-169083360 GACCTGGGATGAGCCTCCCCTGG + Intergenic
1019052441 6:169193370-169193392 CATCTGTGCTCAGCAGTCCCTGG + Intergenic
1020315359 7:6901753-6901775 CAATTGGGATGAGTATCCCCTGG + Intergenic
1022835580 7:34110660-34110682 GATCTGGGATGAGCTGCATCTGG + Intronic
1023024490 7:36038430-36038452 CCTCTGGGATGCTCTGCCCCTGG + Intergenic
1024257117 7:47547493-47547515 GGTCTGGGAGGAGCAGCTCCCGG - Intronic
1024499879 7:50093384-50093406 CAACTGTGCTGTGCAGCCCCCGG + Intronic
1029698300 7:102229120-102229142 CAGCTGGGGCGGGCAGCCCCTGG + Intronic
1032057291 7:128693851-128693873 GATCTTGGATGAGCCGACCCAGG - Intergenic
1033209881 7:139452945-139452967 CATGTGGGCTGGCCAGCCCCTGG - Exonic
1037102026 8:15058633-15058655 CATCTGGGAAGAAGAGCTCCAGG - Intronic
1038288004 8:26223273-26223295 CATCATGGATGAGCACCCACGGG + Intergenic
1040448198 8:47517474-47517496 CCTCAGGGATCAGCAGCCTCAGG - Intronic
1042611796 8:70608235-70608257 CAGCTGGGAAGAGCAGAACCGGG - Exonic
1048543216 8:135361895-135361917 GTTCTGAGATGAGCAGCCCATGG - Intergenic
1050349121 9:4722572-4722594 CATCTGGGATGAGTTTCCCTTGG + Exonic
1050681566 9:8117559-8117581 CACCTCGCATTAGCAGCCCCAGG + Intergenic
1051026201 9:12614685-12614707 CACCTGTGATAAGCAGCCCTGGG + Intergenic
1051365186 9:16316839-16316861 CAGCAGTGATGGGCAGCCCCGGG - Intergenic
1052088038 9:24291787-24291809 CATCTGAGATGAGCAGCATTTGG + Intergenic
1056189990 9:84175685-84175707 CATCTGGGACTCGCAGCCCCAGG + Intergenic
1056308798 9:85319394-85319416 CTGCTGGGATGAGCACCTCCTGG - Intergenic
1058905273 9:109477722-109477744 CATCAGGTAGGAGCGGCCCCAGG - Intronic
1060419063 9:123454584-123454606 CATCTGGCATGAGAAGAGCCTGG + Intronic
1060883126 9:127132665-127132687 CAGCTGGGAAGGGCAGGCCCAGG - Intronic
1061663123 9:132143597-132143619 CATCTCTGATGCCCAGCCCCTGG - Intergenic
1062277654 9:135738328-135738350 CAGCTGGGCTGAGCAGCCCCTGG + Intronic
1062335390 9:136063193-136063215 GACCAGGGATGAGCAGCTCCCGG + Intronic
1062461538 9:136664490-136664512 CCTCTCGGATCCGCAGCCCCTGG - Intronic
1185956407 X:4495653-4495675 CAACTGCTATGAGCAGCCCAAGG + Intergenic
1187447564 X:19372685-19372707 CCTCTGGGAGGAGCAGAACCAGG - Exonic
1189239032 X:39511559-39511581 CATCAGACATGAGCTGCCCCAGG + Intergenic
1190334722 X:49255414-49255436 CATCTGTGGTGAGCGACCCCAGG - Exonic
1197050749 X:122056223-122056245 CATCTGGGTTAAGTAGCACCAGG - Intergenic
1197534160 X:127666527-127666549 CATCTGAGATGAGCAGCATTTGG - Intergenic
1198321389 X:135521513-135521535 GACCGGGGAGGAGCAGCCCCGGG + Intronic
1199694582 X:150334842-150334864 CATCTGGGAGGAGAAGGCCAGGG - Intergenic