ID: 1153372809

View in Genome Browser
Species Human (GRCh38)
Location 18:4338658-4338680
Sequence AAGATGATAAATACGACAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153372809 Original CRISPR AAGATGATAAATACGACAGA CGG Intronic
903733544 1:25515727-25515749 AAAATTAAAAATACGATAGATGG - Intergenic
904230866 1:29070306-29070328 AAGATGAACAAAATGACAGATGG - Intronic
904404828 1:30279789-30279811 AAGCTGAGAAATACAACAGCAGG + Intergenic
904902534 1:33868836-33868858 ATGATGATAGATAGGATAGAGGG + Intronic
907018547 1:51042119-51042141 ATGATAACAAATAAGACAGAAGG + Intergenic
907887616 1:58607653-58607675 AAGATGATGAATAGGAGACAGGG - Intergenic
908823261 1:68109693-68109715 AAGATTATAAATAAGAAAGAAGG + Intronic
909688985 1:78384362-78384384 AAGATTATAAATAGGTCAGTGGG - Intronic
910920616 1:92342574-92342596 AAGTTGATAATTACAACAGATGG + Intronic
910923183 1:92371393-92371415 AGGTAGATAAATAAGACAGATGG + Intronic
912902329 1:113665271-113665293 AAGTTGATATATAGGAGAGATGG - Intronic
916458644 1:164997470-164997492 AAGATGATGCATCCAACAGATGG - Intergenic
917165079 1:172102778-172102800 AAGAGGATAAAAGAGACAGAGGG - Intronic
917211052 1:172632324-172632346 AGGAAGATAAATAAGAGAGAAGG + Intergenic
918476699 1:184932921-184932943 AAAAAGAGAAACACGACAGATGG + Intronic
918880864 1:190119242-190119264 AAAATGAAAAATAAAACAGATGG - Intronic
921117900 1:212111909-212111931 AGGATGATAGATATGAAAGATGG + Intergenic
921528554 1:216250276-216250298 AAAATGATAAATAACACCGAAGG + Intronic
923911733 1:238454134-238454156 AAGATGATAGTTACGGCACATGG + Intergenic
924122109 1:240811348-240811370 AAGATGATGTTTACAACAGATGG + Intronic
924887740 1:248237894-248237916 AAGCTGTTAAAGACCACAGAAGG + Intergenic
1063156349 10:3382416-3382438 AAGAGGATAAAAAGGACAGAAGG + Intergenic
1064228698 10:13510136-13510158 AAGATGATGAATACTAATGATGG + Intronic
1064577447 10:16760637-16760659 CAGCTGAAAAATACAACAGATGG - Intronic
1068275002 10:54783327-54783349 GAAATGATAAATACTACTGAGGG + Intronic
1071819173 10:89263290-89263312 AAGATTATAAAAACAAGAGAAGG + Intronic
1071976111 10:90956998-90957020 AAGACGATAAATACCAAATATGG - Intergenic
1072052021 10:91714387-91714409 AAGGTGAAAAATACGCCAAAAGG + Intergenic
1075289088 10:121213163-121213185 AAGATGATAAAGACCATACAAGG + Intergenic
1079347487 11:19665691-19665713 AAGATTATAAATACTTCTGATGG - Intronic
1079870147 11:25787390-25787412 AAAATCATAATTACTACAGAAGG - Intergenic
1080396924 11:31898761-31898783 AAGATGAGAAAGACCACAGGTGG - Intronic
1080593180 11:33741962-33741984 AAGATGATGAAGAGGAGAGACGG - Exonic
1081716893 11:45256809-45256831 AAGATGATAAATATTTCCGATGG - Intronic
1085927196 11:81036444-81036466 AACAGGATTAATAGGACAGATGG + Intergenic
1086747171 11:90443350-90443372 AATATGATAAATTTGATAGACGG - Intergenic
1086823351 11:91464241-91464263 ATGATGAAAAATACAACAAAAGG - Intergenic
1086940509 11:92793027-92793049 ATGGTGATAAATACTACTGAGGG - Intronic
1087303127 11:96458432-96458454 AAGAGCATAAATACGGCATAAGG - Intronic
1087481256 11:98703297-98703319 AAGGTGATAAATACATAAGAAGG - Intergenic
1088218253 11:107537889-107537911 AAGATGAGAAAGACCACAGAAGG + Intronic
1091305647 11:134534426-134534448 GAGATGAGAAATACAACAGAAGG + Intergenic
1092021534 12:5206845-5206867 AAGAAAATAAAGACCACAGAGGG - Intergenic
1093114311 12:15190690-15190712 AAGATGGGAAATACAAAAGAAGG + Intronic
1093193723 12:16105537-16105559 GAGATGAAAAATACAACACATGG - Intergenic
1093530593 12:20157612-20157634 AAGATTATAAAGAAGATAGAAGG - Intergenic
1095130849 12:38540732-38540754 AAATTGATAAATAAGACAAATGG + Intergenic
1095597771 12:43978883-43978905 AACAAGATTAATAGGACAGATGG - Intronic
1098803188 12:74987092-74987114 AAGAAGATTAAAACCACAGATGG + Intergenic
1099710576 12:86219424-86219446 AAGACAATAAAAACGTCAGATGG + Intronic
1099743458 12:86670231-86670253 AAGATGAAAAATTCAACAAATGG + Intronic
1100168200 12:91942324-91942346 AAGATGATGAATAGCACTGATGG + Intergenic
1100505390 12:95215517-95215539 ATTATGATAAATCCAACAGATGG + Intronic
1102048175 12:109842979-109843001 GAAATGATAAATACGAGTGATGG - Intergenic
1104133820 12:125918977-125918999 AAGAAGATAAAGAAGAGAGATGG + Intergenic
1107627855 13:42308350-42308372 AAGATGATAAAAACAAGAAATGG - Intronic
1109075326 13:57826753-57826775 AAGATAATAAATGTGGCAGAAGG + Intergenic
1109224083 13:59671298-59671320 AAGATGATACCTAGGACATATGG + Intronic
1110059989 13:71028890-71028912 AACAGGATTAATAGGACAGATGG - Intergenic
1110251509 13:73385579-73385601 AAGATGATAAAATGGAAAGAAGG + Intergenic
1111897431 13:94158652-94158674 AAGAAGAAAAATAAGACAGAGGG + Intronic
1112198569 13:97251799-97251821 AAGATAATAAATATCACACATGG - Intronic
1113594747 13:111523137-111523159 ATGATGAGAAATATTACAGAAGG + Intergenic
1114255727 14:20999911-20999933 AAAATGATAAACAGGACAAAGGG + Intronic
1114719444 14:24864841-24864863 ATGATGAAAAATACTAAAGAAGG - Intronic
1114877654 14:26741538-26741560 AAGATGGTAAACAAGACACAGGG + Intergenic
1115015946 14:28614374-28614396 AAGATGATAAACATGAGAAAGGG + Intergenic
1116273991 14:42806801-42806823 AACAGGATTAATAGGACAGAAGG + Intergenic
1116973326 14:51091662-51091684 AAGAAAAAAAATAAGACAGAAGG - Intronic
1117195026 14:53331152-53331174 AAGATGATAAATGAGAGAAATGG - Intergenic
1117250918 14:53936508-53936530 TAGATAATAAATACGATAGGAGG - Intergenic
1118794673 14:69130472-69130494 AAGATGAAAAATTCTAAAGATGG + Intronic
1120155649 14:81090186-81090208 TAGATGATATAAACTACAGAAGG + Intronic
1120389787 14:83891001-83891023 AAAACTATAAATAAGACAGAAGG - Intergenic
1121139896 14:91532209-91532231 AAAATGAAAAATTCAACAGATGG + Intergenic
1125379799 15:39075592-39075614 CAGATTATAAATACCACAAACGG + Intergenic
1126542984 15:49842364-49842386 AACAGGATTAATAGGACAGATGG + Intergenic
1129798127 15:78393480-78393502 CAGATAATAAATAGGACAGAAGG - Intergenic
1133601042 16:7340879-7340901 AAAATGATCAAAATGACAGATGG - Intronic
1133650970 16:7814349-7814371 AAGATGACACATATGACACATGG - Intergenic
1134098608 16:11436017-11436039 AAGAGGAGAAATGAGACAGAGGG + Intronic
1136520973 16:30795486-30795508 AAGATAATAAGGACCACAGAGGG - Intergenic
1139501015 16:67365606-67365628 AAAATAATAAATACAAAAGAAGG - Intronic
1146013781 17:29216552-29216574 ATGATGATGAACAAGACAGATGG - Intergenic
1146526762 17:33573372-33573394 AACATTATAAATACAACAGAAGG + Intronic
1149197882 17:54144650-54144672 AATATGAGAAATTCGACATAAGG - Intergenic
1149717302 17:58804849-58804871 AAAATGATAAATACTCAAGATGG - Intronic
1150361875 17:64542583-64542605 AACATGTTAAATACCACAAATGG + Intronic
1152845501 17:82597241-82597263 AAGATGCTGAATAAGGCAGAAGG - Intronic
1153372809 18:4338658-4338680 AAGATGATAAATACGACAGACGG + Intronic
1153663812 18:7350291-7350313 AAGATGATAAATAGAGTAGAAGG + Intergenic
1156423538 18:36982425-36982447 AAAATGATAAATATGACAGCAGG + Intronic
1158995977 18:62920121-62920143 CAGATGATAAACAAGACAAATGG - Intronic
1159502138 18:69286960-69286982 AAGATGATAAATACAAAATCAGG + Intergenic
1163176884 19:15570492-15570514 TAGATGATAAATAGGATAGATGG - Intergenic
1164056360 19:21625256-21625278 AACAGGATTAATAGGACAGATGG + Intergenic
1164194258 19:22940818-22940840 AACATTAAAAATAGGACAGATGG + Intergenic
1164293110 19:23885192-23885214 AACAGGATTAATAAGACAGATGG - Intergenic
1166878076 19:45910155-45910177 AAGAAGGCAAAAACGACAGATGG + Intergenic
925961041 2:9016766-9016788 AAGATCATAAATAGAACATAAGG + Intergenic
926466668 2:13198618-13198640 AATATGATAAATATTAGAGATGG - Intergenic
927951670 2:27174363-27174385 AAGATGGTTAGTAAGACAGAAGG - Intergenic
928633638 2:33219712-33219734 AAAAAGAAAAATAAGACAGATGG - Intronic
928678894 2:33679028-33679050 TAGATGATAAATAGGATAGATGG - Intergenic
929371298 2:41226884-41226906 CAGATGATAAACACAACATAGGG + Intergenic
930233933 2:48871177-48871199 AAGATGTATAATAGGACAGAAGG - Intergenic
930616142 2:53596470-53596492 AAGATGATAGAGCAGACAGATGG + Intronic
931248887 2:60513282-60513304 AAGATGCTAAATATGAGACAAGG + Intronic
935766501 2:106373322-106373344 AAGTTGAGAAAGACCACAGACGG + Intergenic
936366500 2:111861488-111861510 AAGTTGAGAAAGACCACAGACGG - Intronic
936698237 2:114976921-114976943 AAGATGATAGATATGGAAGATGG - Intronic
938993441 2:136653216-136653238 ACAATGATGAATACGACATATGG + Intergenic
939486637 2:142820987-142821009 GATATGAAAAATACAACAGAAGG + Intergenic
939740435 2:145899783-145899805 AAAATGATATATACTACAAAAGG + Intergenic
939999409 2:148951828-148951850 AAGATGAGAGAAAGGACAGATGG + Intronic
941194794 2:162436124-162436146 AAGCAGAGAAATATGACAGAGGG + Intronic
941356048 2:164493211-164493233 AAGAGGATAAATTACACAGAAGG + Intronic
942111464 2:172686921-172686943 AAGATGATATCAAAGACAGATGG - Intergenic
943370790 2:187013406-187013428 GAGCTGATAAATAAGACATAAGG - Intergenic
943625766 2:190197644-190197666 AAGATGTTAAATCCCACAGATGG - Intronic
944099592 2:196008962-196008984 AACATTATAATTACGGCAGAAGG + Intronic
944178397 2:196859726-196859748 AATATGATAAATAACACAAATGG + Intronic
944530859 2:200666826-200666848 AAGATGATGAATAAGACTGATGG - Intronic
945518751 2:210796890-210796912 GTGAAGATAAATACTACAGAAGG - Intergenic
946488728 2:220126790-220126812 AAGAGGAAAATTACGAGAGAGGG - Intergenic
1170298726 20:14858231-14858253 AAGGTGATAAATACGCCCCAAGG + Intronic
1170344836 20:15373313-15373335 AAGATAATAAATAAGATATATGG - Intronic
1170864853 20:20144422-20144444 AAGATGAAAAATACACCAGAAGG + Intronic
1176961460 21:15163754-15163776 AAGATGATAAAACAGACACAGGG + Intergenic
1180860871 22:19081401-19081423 AAGTTGCTAAAAACGACATATGG - Intronic
949387921 3:3525250-3525272 AAGATGAAAAACAAGACAAAAGG + Intergenic
950891492 3:16408549-16408571 AATATGATATTTACTACAGAAGG - Intronic
951293569 3:20904105-20904127 ACAATGATAAATATGACATAGGG + Intergenic
952073028 3:29662009-29662031 AAAATGATAAATAGGACTGTTGG - Intronic
952618589 3:35306944-35306966 AAGAACATAAATAAGAGAGAGGG + Intergenic
953756734 3:45653133-45653155 AAGATAATAAGTCTGACAGATGG + Intronic
953919211 3:46940396-46940418 AATAAGATAAATACTACAGAGGG + Intronic
954995555 3:54878191-54878213 AAGATGAAAAAGACAAGAGAGGG + Intronic
955959500 3:64325473-64325495 AAGATAATAACTAGGACTGATGG + Intronic
957677683 3:83391819-83391841 AACATGATTAATAGGATAGAAGG + Intergenic
958472542 3:94539059-94539081 AAGATGAGAAATCAGACACAGGG - Intergenic
958513755 3:95084843-95084865 AAGACCATAAATTGGACAGAAGG + Intergenic
960184972 3:114627168-114627190 AATATGATGAAAACTACAGATGG - Intronic
961471571 3:127116489-127116511 AAGATGATTAAAATGACAAAGGG - Intergenic
961849440 3:129800627-129800649 AAAATGAGAAAAGCGACAGAAGG - Intronic
961849730 3:129803876-129803898 AAGATGCTAAGTATGAGAGATGG - Intronic
962835926 3:139188425-139188447 AAGATGTTAATAAAGACAGAAGG - Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964128779 3:153264644-153264666 AAGGTGAGAAATAAGAGAGATGG + Intergenic
964640682 3:158906975-158906997 ATAATGATAGATACGACAGTTGG - Intergenic
965095475 3:164219523-164219545 AACAGGATTAATAGGACAGATGG - Intergenic
967001259 3:185337593-185337615 AAGATGAGAAATTCCACAGAAGG + Intronic
967218709 3:187231263-187231285 GAGATGAAAAATACAAGAGAGGG - Intronic
967309674 3:188094097-188094119 AAGATTACAAATACGAGAGAGGG - Intergenic
969637194 4:8376249-8376271 AAGATGATAAATGGGAGACAGGG - Intronic
971038898 4:22728097-22728119 AAGATGGTAAAGAAAACAGAAGG - Intergenic
971369478 4:26004432-26004454 AAGATGATAGATTAGATAGATGG + Intergenic
972218810 4:36929129-36929151 AAGATAATAAATAAAACAAAGGG + Intergenic
973157298 4:46972576-46972598 AAGATAATAAATAAGAAGGAGGG - Intronic
974191519 4:58510121-58510143 AAGAAGATAAATACAACAGAGGG - Intergenic
974866995 4:67593098-67593120 AAAAGGATAAATAAGACACAGGG + Intronic
975436927 4:74364528-74364550 CAAATGGCAAATACGACAGAAGG + Intergenic
976987415 4:91319088-91319110 CAGATGGTAATTAAGACAGACGG + Exonic
978064119 4:104375072-104375094 ATGAAGAAAAATACAACAGAAGG + Intergenic
978482896 4:109214681-109214703 AAGATGAAACATACAACAAAAGG + Intronic
978506832 4:109466862-109466884 AATATCAAAAATATGACAGATGG + Intronic
980174012 4:129323317-129323339 AACATGGTAAATACCACATAAGG - Intergenic
980549519 4:134316392-134316414 AAGATGATAAATAAAACTGAGGG - Intergenic
981119114 4:141028133-141028155 AATATGATTAATTCCACAGAGGG - Intronic
981753669 4:148118315-148118337 AAGTTGATAACCCCGACAGAAGG - Intronic
982573406 4:157076987-157077009 AAGATGAAAAACATGACATAAGG + Intronic
987767503 5:22252181-22252203 AAAGAGATAAATACTACAGAAGG + Intronic
990166469 5:52999212-52999234 ACAATGATAAATAGGACAGAAGG - Intronic
990779895 5:59348734-59348756 AAAATGATAAAGAGGAAAGATGG - Intronic
991347503 5:65685238-65685260 AAGAGGATAAATAAAACATAAGG - Intronic
992577811 5:78137025-78137047 AAGATGAAAAATTCTAGAGATGG - Intronic
992942798 5:81779421-81779443 AAGATCATAGATACCTCAGAGGG - Intergenic
993316596 5:86414886-86414908 AATATGCTAAAAACCACAGATGG - Intergenic
993738073 5:91501573-91501595 TATATGATATATAGGACAGAAGG + Intergenic
993825422 5:92679597-92679619 TAGAGGATAAATTCCACAGATGG - Intergenic
995235093 5:109819807-109819829 AATATGATAAATACTGAAGAAGG + Exonic
995292951 5:110481291-110481313 AAAAAGACAAATACGACAAAAGG + Intronic
995769628 5:115654317-115654339 AGGATGAGAAATAGGAAAGAAGG - Intergenic
996767733 5:127051496-127051518 AAAAGGATAAATAAGACAAATGG + Intronic
998702861 5:144724224-144724246 AAGCTGATAAAATCCACAGAAGG - Intergenic
999796681 5:154995503-154995525 AAAAAGAAAAATAAGACAGAAGG + Intergenic
1000764335 5:165266982-165267004 ATTATGAAAAATACGAGAGAAGG - Intergenic
1001721370 5:173859788-173859810 CAGATGATAAATAAGAAAGCTGG + Intergenic
1003822016 6:9908745-9908767 AAGATGATAATTACAAAAAAGGG - Intronic
1003992419 6:11499262-11499284 AAGATGGTAAATACAAAATAGGG - Intergenic
1005289777 6:24368186-24368208 TAGATGAAAAATATGAAAGAAGG + Intergenic
1007743711 6:44029396-44029418 AAGATGGGAGATACGGCAGAAGG - Intergenic
1008088457 6:47268700-47268722 TAGATGATAATCAAGACAGAAGG - Intronic
1009854800 6:69248150-69248172 AAGATGAAAAATAATACATAGGG - Intronic
1010350090 6:74863272-74863294 AAAATGAGAAATAATACAGAAGG + Intergenic
1010615825 6:78010969-78010991 AAGGAGATAAATATGAGAGAGGG - Intergenic
1010625992 6:78136750-78136772 AACAGGATTAATAAGACAGATGG + Intergenic
1011585585 6:88921676-88921698 AAAATGATAATTACCAAAGAGGG - Intronic
1011884285 6:92074996-92075018 AGGATTATAAATTTGACAGAGGG + Intergenic
1012028269 6:94026138-94026160 AAGTTGATAAATAATACGGAGGG + Intergenic
1012388460 6:98708887-98708909 AACATGATAAAGAGCACAGAAGG + Intergenic
1016016560 6:139192412-139192434 AGCATGCTAAATGCGACAGAAGG - Intergenic
1016217059 6:141617287-141617309 ATGATGGTAAATATGACAGCTGG + Intergenic
1016624286 6:146147421-146147443 AAGATGATAATTAAGACATAAGG + Intronic
1018409642 6:163531078-163531100 AAGATGAAAAATTTGATAGAAGG - Intronic
1020001033 7:4755759-4755781 AAGAAGATAAATATAAAAGAGGG + Intronic
1021912852 7:25403566-25403588 GAGAAAAAAAATACGACAGATGG + Intergenic
1022036942 7:26543428-26543450 AAAAGGATGAATACGAAAGAGGG - Intergenic
1027422579 7:78031844-78031866 AAGATCATGAATACCCCAGAAGG - Intronic
1027455926 7:78392060-78392082 AACATGCTAAATAAGACAGAAGG + Intronic
1027731310 7:81876845-81876867 AAGATAATAAATATGACTCATGG + Intergenic
1028442222 7:90876707-90876729 AAGATGACAAATAGAACATATGG - Intronic
1029182156 7:98710674-98710696 AAGATGAAAAATTCTAGAGATGG - Intergenic
1030306842 7:108027627-108027649 AAGATAATAAATACAACCAAGGG + Intronic
1032662181 7:133996736-133996758 AACAGAATAAATACTACAGAAGG - Intronic
1036171595 8:6491402-6491424 AAGATTATTATTAGGACAGAAGG + Intronic
1036405479 8:8451188-8451210 AAGATGAAAAAAAAGACAAAAGG + Intergenic
1040896822 8:52376549-52376571 AAGATGATGAGTACTATAGATGG - Intronic
1040931767 8:52742601-52742623 GAGATGAAAAATACACCAGATGG + Intronic
1043467530 8:80527117-80527139 AAGATGAAAAATTAGACAAATGG + Intergenic
1043601816 8:81948733-81948755 AAGATGATTCATAAGAGAGAAGG + Intergenic
1046077348 8:109329085-109329107 AAGATGAAAAATACACCAGATGG + Intronic
1046220639 8:111209502-111209524 TAGATGACAGATAAGACAGATGG - Intergenic
1047156314 8:122323177-122323199 AAGATTATAAATACCATATAAGG + Intergenic
1047900549 8:129416994-129417016 GAGATGTTATATAGGACAGACGG - Intergenic
1048562696 8:135559000-135559022 AAGATTATAGATACAAGAGAAGG - Intronic
1048716600 8:137277841-137277863 AAGATTCTAATTATGACAGAAGG + Intergenic
1050052124 9:1613490-1613512 AACAGGATAAATGCGACAAAAGG - Intergenic
1051836821 9:21348065-21348087 AATATGATAAACATGAAAGAAGG + Intergenic
1052578743 9:30325785-30325807 ATAATGATAACTACGATAGAGGG + Intergenic
1058594110 9:106596761-106596783 AAAATGATCAAGAAGACAGAGGG + Intergenic
1061694029 9:132357344-132357366 AAGATGATAAGGCCTACAGAGGG - Intergenic
1186211892 X:7258242-7258264 ATGATGATAGATATGATAGATGG + Intronic
1186281899 X:8002266-8002288 AAGATGAGAAATCAGACTGAAGG - Intergenic
1186286802 X:8053111-8053133 AAGATGATAAAAATCACAGCTGG + Intergenic
1188170835 X:26923337-26923359 CAGATGATAAAGACAACATATGG - Intergenic
1190226272 X:48547957-48547979 AATTTGGTAAATAAGACAGAGGG - Intronic
1192128258 X:68522714-68522736 AAGATCATAAATACAACTGATGG - Intronic
1192215468 X:69155113-69155135 AAGATGATATATAAGAAACAGGG - Intergenic
1193159828 X:78215868-78215890 AACAGGATTAATAGGACAGATGG - Intergenic
1193210274 X:78799402-78799424 AATATGATCAATAAGACAAAAGG - Intergenic
1193417750 X:81244466-81244488 AAGATGATAAATACACCTTAGGG - Intronic
1198443308 X:136685622-136685644 AGGAAGAAAAATACGAAAGATGG + Intronic
1198527922 X:137520970-137520992 CAGCTGATAAATATGCCAGAAGG + Intergenic
1198638521 X:138727924-138727946 AATATGAAAAAGAAGACAGATGG + Intronic
1199618641 X:149679546-149679568 AAGAGGATTAATAGGACAGATGG - Intergenic
1199624001 X:149723703-149723725 AAGAGGATTAATAGGACAGATGG + Intergenic
1200177045 X:154124272-154124294 AAGCTGACAAATACAACAAAAGG - Intergenic
1201401618 Y:13609829-13609851 AACAGGATTAATAGGACAGAGGG + Intergenic
1201747118 Y:17388919-17388941 TAGATGATAGATTAGACAGATGG + Intergenic