ID: 1153376825

View in Genome Browser
Species Human (GRCh38)
Location 18:4390315-4390337
Sequence CAAGTGTACCACTGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153376825 Original CRISPR CAAGTGTACCACTGTGATAT GGG (reversed) Intronic
902164363 1:14558033-14558055 CAAGAGTGGCACTGTGATCTGGG - Intergenic
902271623 1:15309141-15309163 CAAGAGCACCAGTGTGAGATGGG - Intronic
904521327 1:31098388-31098410 CAAATGTACCACTCTGATGGGGG - Intergenic
904763896 1:32827049-32827071 CAAATGTACCACTGTGGTGTAGG - Intronic
905578777 1:39067482-39067504 CAAATGTACCACTGTAGTGTGGG - Intergenic
907149372 1:52269042-52269064 CAAGTGTACCACTCTGGTAGGGG - Intronic
907407031 1:54259995-54260017 CATGAATACCACTGTGATAATGG + Intronic
909590137 1:77339035-77339057 AAAGCAAACCACTGTGATATGGG + Intronic
910124268 1:83823084-83823106 CAAAAGTACCACACTGATATAGG + Intergenic
911324526 1:96454443-96454465 CAAGTGTACCACTTTGAAGGGGG - Intergenic
911723385 1:101215547-101215569 CAAGTGTGCCACTCTGGTGTGGG + Intergenic
913092691 1:115490283-115490305 CAAATGTACCACTCTGATGTGGG + Intergenic
913462834 1:119106264-119106286 CAAATGTACCACTATGGTGTGGG - Intronic
914194731 1:145440439-145440461 CAAGTGTAGCATTGTTACATGGG + Intergenic
914476005 1:148023004-148023026 CAAGTGTAGCATTGTTACATGGG + Intergenic
916602744 1:166308809-166308831 AAAATGTACCACTGTGGTGTGGG - Intergenic
918646539 1:186912259-186912281 CAAATGTACCACTCTGGTGTGGG - Intronic
920162211 1:204007718-204007740 CAAATGTACCATTCTGGTATGGG + Intergenic
921063378 1:211605662-211605684 CATGTGTAGCTCTGTGGTATGGG - Intergenic
921582495 1:216911635-216911657 CAAATGTACCACTCTGGTAGGGG + Intronic
921826637 1:219679349-219679371 CAAATGTACCACTCTGGTAGGGG + Intergenic
921856333 1:219989495-219989517 CCAGTGTACCACTGGGAACTTGG + Intronic
922328096 1:224547790-224547812 GATGTACACCACTGTGATATTGG - Intronic
924836744 1:247656471-247656493 AAAATGTACCACTGTGGTGTGGG - Intergenic
1063631050 10:7734246-7734268 CAAATGCACCACTCTGATGTGGG + Intronic
1064767272 10:18687385-18687407 CAAATGTACCGCTGTGGTACAGG - Intergenic
1066171026 10:32846246-32846268 CCAATGTAACACTATGATATAGG - Intronic
1067978866 10:51058481-51058503 CAAATGTACTACTCTGATAGTGG - Intronic
1068231816 10:54177466-54177488 CAAATGTATCACTTTGGTATGGG + Intronic
1073810785 10:107150515-107150537 CAAGTGAAGCACTGTGCTTTTGG + Intronic
1078738052 11:14039376-14039398 CAAATGTATCATTCTGATATAGG + Intronic
1085753403 11:79183590-79183612 CAAATGTACCACTCTGGTTTGGG + Intronic
1087558627 11:99754712-99754734 CAAGTGTACCACTCTGGTTCAGG - Intronic
1087869569 11:103275297-103275319 CAAGTGTACCACTCTGGTGCAGG - Intronic
1088249885 11:107853220-107853242 CAAGTCTACCAGGGTGAGATAGG - Intronic
1088423352 11:109673111-109673133 CAAACGTACCACTCTGATATGGG - Intergenic
1089803195 11:121055901-121055923 CAAATGTACCATTTTGCTATGGG - Intronic
1089831611 11:121333827-121333849 CAAATGCACCACTGTGGAATGGG + Intergenic
1090683474 11:129087778-129087800 CAAATGTACCACTGTGGTGTGGG + Intronic
1091464613 12:673099-673121 CAAATGTACCACTCTGGTGTGGG - Intergenic
1094309319 12:29061077-29061099 ATAATGTACCACTGTGATGTGGG - Intergenic
1097765242 12:63518866-63518888 CAAATGTTCCACTCTGATGTGGG - Intergenic
1097925865 12:65125596-65125618 CAAATGTACCATTCTAATATAGG + Intergenic
1099527800 12:83736789-83736811 CAAATGTACCACTCTGGTAAGGG + Intergenic
1101366498 12:104076351-104076373 CAAGTCTCCCACTGTGATTGTGG + Intronic
1105654259 13:22418465-22418487 CAAATGTACCACTCTGATGGAGG + Intergenic
1107767883 13:43756801-43756823 TAACTGTCCCACTGTGATTTAGG + Intronic
1108392996 13:49966285-49966307 CAAGTGTACCATTATGGTATGGG + Intergenic
1108552798 13:51563437-51563459 CAAATGTACCACTGTGGTGGGGG + Intergenic
1108761746 13:53575541-53575563 CAAGTGTACCACTCTCAGCTGGG - Intergenic
1108975871 13:56442520-56442542 CAATTGTGCAACTGTGATAGGGG + Intergenic
1109354346 13:61219892-61219914 GAAGTATACCCCTGTGATATGGG - Intergenic
1110214918 13:73014605-73014627 CAAATGTACCATTGTGCTAAGGG + Intronic
1110314527 13:74090403-74090425 CATATGTACCACTCTGATATGGG - Intronic
1110314624 13:74091856-74091878 CATATGTACCACTCTGATAGGGG + Intronic
1110615092 13:77532732-77532754 CAAATGTCCCACTGTGATGTGGG + Intergenic
1111400027 13:87722156-87722178 CATGTATTCTACTGTGATATGGG - Intergenic
1111516268 13:89335760-89335782 GAAGTGTACCACTGTGGTATGGG + Intergenic
1112407013 13:99130198-99130220 CAAATGTACCACTCTGGTAGGGG + Intergenic
1112787081 13:102962967-102962989 CAAATGTATCATGGTGATATAGG - Intergenic
1114169924 14:20262060-20262082 GAAGTGTACCACTCTGGGATGGG + Intronic
1114546172 14:23503236-23503258 CAAATGTACCACTGAGACGTGGG - Intronic
1115064897 14:29246260-29246282 CAAATGTACTACTGTGGTGTGGG - Intergenic
1115093856 14:29611188-29611210 CAAATGTACCACTGTGGTGGGGG + Intronic
1115583174 14:34782911-34782933 ACAGTGTACACCTGTGATATTGG + Intronic
1115888102 14:37996043-37996065 CAAATGTACCACTGTGGTGAAGG - Intronic
1116147581 14:41095301-41095323 CAAGCGTACCACTGTGTTGTGGG - Intergenic
1117421701 14:55553004-55553026 CAAGTGTACTACTCTGGTATGGG + Intergenic
1118717017 14:68567432-68567454 CAAATGTACCACTCTGGTGTGGG - Intronic
1120554639 14:85914622-85914644 CAAGTGTACCACTCTGATGGGGG - Intergenic
1121150530 14:91629563-91629585 CAAATGTACCACTTTGGTGTGGG + Intronic
1121811732 14:96897385-96897407 CAAATGCACCACTCTGATAGGGG + Intronic
1124228612 15:27919821-27919843 CAACTGTACCACTGTGATGGAGG + Intronic
1124530997 15:30506429-30506451 CAAATGTACCACTCTGGTGTGGG + Intergenic
1124767658 15:32501266-32501288 CAAATGTACCACTCTGGTGTGGG - Intergenic
1125119913 15:36143537-36143559 CAAATGTACCACTCTGATATGGG + Intergenic
1126017422 15:44365880-44365902 CAAATGTACCACTTTGGTAGGGG + Intronic
1126632734 15:50754223-50754245 CAAATGTACCACTCTGCTGTGGG - Intronic
1127068036 15:55260970-55260992 CAAACGTACCACTCTGGTATGGG + Intronic
1127163115 15:56212545-56212567 CAACTGTACCACTCTAATGTAGG + Intronic
1127586971 15:60387773-60387795 CAAATGTACCACCCTGATACGGG + Intronic
1128470986 15:67953050-67953072 CAAAGGTACCATTGTGGTATGGG + Intergenic
1131574158 15:93569634-93569656 CAACTCTACCTATGTGATATTGG - Intergenic
1131790270 15:95957245-95957267 CAAATGTACCACTCTGATGAGGG + Intergenic
1131917756 15:97289259-97289281 TAAATGTACCACTGTGGTAAGGG - Intergenic
1135264625 16:21012536-21012558 GAAGTATCCGACTGTGATATTGG - Intronic
1135753882 16:25080430-25080452 GAAGTGTCCCACTGAGAGATAGG + Intergenic
1138889542 16:61125936-61125958 TAAGTGTACCACTGTGGTGTAGG - Intergenic
1138978528 16:62238527-62238549 CAAATGTACCACTTTGATGAGGG + Intergenic
1139259467 16:65577882-65577904 CAAGTCGGCCACTGTGATCTAGG - Intergenic
1141284272 16:82656526-82656548 CAAATGTACCATTCTGATGTGGG - Intronic
1141466499 16:84209322-84209344 CAAATGTACCACCATGGTATGGG - Intergenic
1143228230 17:5326677-5326699 CAAATGTGCCACTGTGGTACAGG + Intronic
1144012507 17:11163156-11163178 CAAATGAACCACTGTGATAATGG + Intergenic
1144234169 17:13240908-13240930 CAAATGTGCCATTGTGACATGGG - Intergenic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1145130809 17:20346614-20346636 CAAGTGGTCCACATTGATATTGG + Intergenic
1148234511 17:45959234-45959256 CAAGTGTACCACTCTGGTGCAGG - Intronic
1148398532 17:47331528-47331550 CAAATGTACCACTCTGGTACAGG - Intronic
1149508977 17:57221579-57221601 CAAATGCACCTCTGTGATATGGG + Intergenic
1149725856 17:58893652-58893674 CAAATGTACCACTCTGTTATGGG + Intronic
1151007324 17:70452811-70452833 CAAATGTACCATTGTGATGCAGG + Intergenic
1151119477 17:71776615-71776637 CAAGAGTACTACTTTGCTATTGG - Intergenic
1151603190 17:75119116-75119138 CCAGTGTACCAGTGTCATAGAGG - Intronic
1153376825 18:4390315-4390337 CAAGTGTACCACTGTGATATGGG - Intronic
1153436930 18:5077898-5077920 CAAGTGCACCACTCTGCTAGGGG + Intergenic
1154274262 18:12946343-12946365 CAAAGGTACCACTTTGGTATGGG + Intergenic
1154319287 18:13332359-13332381 CAAATGTACCACTGTGGTGTGGG - Intronic
1154986396 18:21555447-21555469 CAAATGTACAACTATGATAAGGG + Intronic
1155764413 18:29609634-29609656 CAAATGTACCACTCTGATGGAGG - Intergenic
1156077962 18:33303532-33303554 CAAGTGTACCACTTGGATGTGGG + Intronic
1157602101 18:48900167-48900189 TAAGTGTACCACATTGATATGGG + Intergenic
1157868286 18:51205424-51205446 CAAATGTTCCACTGTGGTACTGG + Intronic
1157973077 18:52293202-52293224 CAAATGTACCACTGTGGTTTGGG + Intergenic
1159146829 18:64465426-64465448 CAAATGTACCACTCTGGTAGAGG - Intergenic
1159373102 18:67554916-67554938 CAAATATACCACTCTGATGTGGG - Intergenic
1159523605 18:69558878-69558900 AAAATGTACCATTGTTATATAGG + Intronic
1159818292 18:73105612-73105634 CAAATGCACCACTGTGGTAGGGG - Intergenic
1161147997 19:2691053-2691075 CGAATGTACCACTGTGGTACGGG + Intronic
1164401876 19:27908213-27908235 CAACTGTACCACTGTGGCATAGG - Intergenic
1167728301 19:51234231-51234253 CAAATGTACCACTCTGATGGGGG - Intronic
1167977384 19:53240877-53240899 CAAATGTACCACTGTGATGGGGG + Intronic
925360309 2:3275414-3275436 AAAGTCTCCCACTATGATATTGG - Intronic
925739138 2:6989994-6990016 CAAATGTGCCACTGTGGTATGGG - Intronic
926846899 2:17151455-17151477 CTAGTGTACCACAGAGATACTGG - Intergenic
927427483 2:22996943-22996965 TGAGTGTACCACTGAGATAAAGG + Intergenic
929067009 2:37987733-37987755 CAAATGTACCACTGTGAAGTGGG + Intronic
929301471 2:40308592-40308614 AAAGTATAGCACTATGATATTGG - Intronic
929679985 2:43983864-43983886 AAATTCTACCACTGTGATCTGGG + Intronic
930177874 2:48318162-48318184 CAAATGTACCATTGTAATGTAGG - Intronic
930493000 2:52100347-52100369 CAAGTGTACCACTGTGGTGGGGG - Intergenic
931401510 2:61935579-61935601 GAAGTGTAGCAGTGTGATCTCGG - Intronic
931405748 2:61976808-61976830 CAAATGTACCACAGTGATGTGGG + Intronic
933864561 2:86504292-86504314 CAAATGTACCACTCTGGTGTGGG + Exonic
936829730 2:116629031-116629053 CAAATGTACCACTGTGGTATAGG + Intergenic
937695517 2:124804285-124804307 CAAGTCTAACCCTGTGATAATGG - Intronic
939207544 2:139126929-139126951 CAAGTGAAATACTGTGTTATTGG + Intergenic
939857845 2:147382014-147382036 CAAATGTACCACTCTGGTGTGGG + Intergenic
940044135 2:149391642-149391664 TAAGTGTACCACTGTGAAACAGG - Intronic
940313017 2:152298356-152298378 CAAATGTACCGCTGTGGTGTGGG - Intergenic
940980369 2:159994922-159994944 CAAATGTACGACTGTGGTGTGGG + Intronic
940980423 2:159995859-159995881 TAAATGTACCACTGTGGTGTAGG - Intronic
941956221 2:171207560-171207582 CAGATGTACCACTGTGGTGTGGG + Intronic
942230040 2:173852426-173852448 CAAGAGCACCACTATGTTATAGG - Intergenic
943952023 2:194142516-194142538 CAAATGTACCACTCTTGTATGGG - Intergenic
944879940 2:204002470-204002492 TAAGTCTAAGACTGTGATATTGG - Intergenic
945280306 2:208029525-208029547 TAAGTGTACCACTGTGGTGCAGG - Intergenic
946902002 2:224381726-224381748 CACATGTACCACTCTGATAAAGG + Intronic
1168867369 20:1099173-1099195 CAAATGTACCACTCTGGTGTGGG + Intergenic
1169182074 20:3578290-3578312 GAAGTGTACCAGTCTAATATTGG + Intronic
1169292756 20:4366658-4366680 CAAATGTACCACTCTGGTAGGGG - Intergenic
1170008203 20:11692138-11692160 CAAAAGTACCACTGTGGTGTAGG + Intergenic
1170636279 20:18107517-18107539 CAAATGTACCACTTTGGTAGGGG - Intergenic
1170762059 20:19259678-19259700 TTAATGTACCACTGAGATATTGG + Intronic
1172477523 20:35250001-35250023 CAAGTGTACTGGTGTGATCTTGG + Intronic
1172496141 20:35385957-35385979 CAAATGCACCACTCTGGTATGGG - Intronic
1173175374 20:40760786-40760808 CAAATGTATCACTGTGCTGTAGG - Intergenic
1177008941 21:15708230-15708252 CAAGTCAACTACTGTTATATTGG - Intergenic
1177349654 21:19920580-19920602 CACATGTACCACTCTGATAGAGG + Intergenic
1177853983 21:26381471-26381493 TAAGTGAACCACTGACATATTGG + Intergenic
1178101702 21:29275875-29275897 CAAATGTACCACTCTGGTAGGGG - Intronic
949428848 3:3950492-3950514 CAAATGTACCACTCTGGTACAGG + Intronic
949499295 3:4663601-4663623 CAAATGTCTCACTGTGATGTAGG - Intronic
950745780 3:15087457-15087479 CAAGTGTGCTGCTGTGATCTTGG - Intronic
950845683 3:16013577-16013599 CAATTGTACCACTCTGGTGTGGG - Intergenic
950959246 3:17087691-17087713 CAAGTATACCACTGTGGTGCGGG + Intronic
951133544 3:19076526-19076548 CAAATGTACCATTCTGATAAGGG + Intergenic
951361615 3:21731451-21731473 CAAATGTACCACTGTGGTGGAGG - Intronic
951829685 3:26912231-26912253 CAAATGTACCACTGTGGTGCAGG + Intergenic
951905149 3:27698924-27698946 CAAATGTACCACTGTGGTGGGGG + Intergenic
952475369 3:33704267-33704289 CAAGTGTATCACTCTGGTAGGGG + Intronic
953192661 3:40702109-40702131 CAAATGTACCACTGTGGTGCAGG - Intergenic
953615183 3:44483503-44483525 CTAATGTACCACTGTGGTTTGGG - Intergenic
953753389 3:45626773-45626795 CAAGTGTACCACTCTGGTGGGGG + Intronic
954555236 3:51512489-51512511 CAAATGTACCACTCTGTTGTAGG + Intergenic
955986136 3:64575761-64575783 TAATTGTAACACAGTGATATTGG - Intronic
957005423 3:74940209-74940231 CAAATGTACCACTCTGATGTGGG + Intergenic
959413581 3:106056526-106056548 CAAATGTACCACTCTGCTAAGGG + Intergenic
959778018 3:110192579-110192601 CAAATGTACCACTCTGGTAGGGG - Intergenic
960438154 3:117653060-117653082 CAAATGTACCACTTTGATGGTGG + Intergenic
960722197 3:120635834-120635856 CAAGTTTGCTACTGTGCTATAGG - Intronic
963339260 3:144014847-144014869 CAAATGTACCATTGTGTTGTGGG + Intronic
963912434 3:150826299-150826321 AATGTGTTCCACTGTGATAGGGG + Intergenic
964205583 3:154171316-154171338 CAAATGTACCATTCTGATGTGGG - Intronic
965029494 3:163346497-163346519 CAAATGTACCACTCTGGTGTAGG + Intergenic
965181689 3:165412147-165412169 CAAATGTACCACTCTGATGTGGG + Intergenic
965362918 3:167763428-167763450 CAAGTGTAGCGGTGTGATCTTGG + Intronic
966321341 3:178704492-178704514 CAAGTGTTCCATTGTCATATGGG + Intronic
971752779 4:30672567-30672589 CAAATGTACCACTGTGGTGAGGG + Intergenic
973291808 4:48478239-48478261 CAAGTGTATAAATGTAATATTGG + Intergenic
974394020 4:61311931-61311953 CAAATGTACCACTCTCATGTGGG + Intronic
974574812 4:63704744-63704766 TAAATGTACCACTGTGGTTTGGG - Intergenic
975160472 4:71119102-71119124 AAAATGTACCACTCTGGTATGGG + Intergenic
976818701 4:89180254-89180276 CAAATGTACCACTCTGGTGTGGG - Intergenic
977000809 4:91499427-91499449 CAAATGTACCACTGTGTTACAGG - Intronic
977003835 4:91540183-91540205 CAAATGTACCACTGTGATGTGGG - Intronic
977822196 4:101486068-101486090 CAAATGTACCACTGTGGTGCAGG - Intronic
978033012 4:103958987-103959009 CAAATGTACCACTGTGGTGGGGG + Intergenic
978051973 4:104212196-104212218 CAAATGTACCCCTGTGATACAGG - Intergenic
978129547 4:105178610-105178632 CAAATATACCACTCTGGTATGGG + Intronic
978207377 4:106093947-106093969 CAAATGTACCACTCTGATGGGGG + Intronic
978675698 4:111312788-111312810 CAAATGTACCACTCTGGTAATGG - Intergenic
978686153 4:111445993-111446015 CAAATGTACCACTCTGATTAGGG + Intergenic
978788059 4:112631769-112631791 CAAATTAACCACTGTGATATGGG + Intronic
978998716 4:115189452-115189474 CAAATGTACCACTGTGGTTGGGG - Intergenic
980063782 4:128159584-128159606 CAAATGTACCACTGTGGTAGGGG - Intronic
981118260 4:141017453-141017475 CAAATGTACCACATTAATATGGG - Intronic
981486397 4:145291121-145291143 CAAATGTACCACTCTGGTGTGGG - Intergenic
981523063 4:145684643-145684665 CAAATGTACCACTGTGGTGGGGG + Intronic
982382069 4:154759950-154759972 TAACTGTAGCACTGTGATCTTGG - Intergenic
982807310 4:159782463-159782485 CAAATGTACCATTGTGGTGTGGG - Intergenic
982978555 4:162100706-162100728 TAAATGTACCACTCTGATACAGG + Intronic
983080955 4:163384781-163384803 CAAACGTACCACTGTGGTATCGG + Intergenic
984049705 4:174849196-174849218 AAAAAGTACCACTGTGATAAGGG - Intronic
984404587 4:179311537-179311559 CAAATGTACCACTGTGGTGCGGG - Intergenic
984636492 4:182115989-182116011 CAAATGTACCACTGTGTTGTGGG - Intergenic
986531734 5:8744128-8744150 CAAATGCACCACTGTGGTGTGGG - Intergenic
987514181 5:18884529-18884551 CAAATGTAACACTTTGATGTGGG + Intergenic
987934697 5:24449188-24449210 CAAATGTACCACTCTGGTGTGGG - Intergenic
988313649 5:29594734-29594756 CAAGTGTACCATAGTGATCTAGG + Intergenic
989154488 5:38331203-38331225 CAAATGTACCACTCTGATAGGGG - Intronic
990083821 5:51950616-51950638 TAAGTTTAACACTGTGATAGTGG + Intergenic
991118680 5:62984896-62984918 AAAATGTACCACTCTGGTATGGG - Intergenic
992536890 5:77715337-77715359 CAAGGTTAACACTGTGCTATAGG + Intronic
992895868 5:81244756-81244778 CCTGTGTAGCACTGTGATAAAGG - Intronic
993260378 5:85650210-85650232 CAACTGTACATCTGTAATATAGG - Intergenic
994392327 5:99202797-99202819 CAGGGGTGCCCCTGTGATATTGG + Intergenic
996248872 5:121302137-121302159 CAAATGTACCACTCTGATAATGG + Intergenic
996752166 5:126899870-126899892 CACATGTACCACTGTGGTGTGGG - Intronic
997871774 5:137512234-137512256 CAAATGTACCACTCTGGTAGGGG + Intronic
999418911 5:151423829-151423851 CAAATGTACTACTGTGGTAGTGG + Intergenic
999713091 5:154335774-154335796 CAAATGTACCACTATGGTATGGG - Intronic
1000864296 5:166493440-166493462 CAAATGAACCATTGTGGTATGGG + Intergenic
1001462846 5:171933541-171933563 CAAATGTATCCCTGTGGTATGGG + Intronic
1002686797 5:181018506-181018528 CAAATGTACCATTGTGGTACAGG - Intergenic
1003358374 6:5397486-5397508 CAAGTGTACCACTCTGGTGGAGG + Intronic
1005523046 6:26617003-26617025 CAAATGTACCACTCTGGTACAGG + Intergenic
1006216409 6:32447078-32447100 CAAGTGTACCACATTAATACAGG - Intergenic
1006220845 6:32489813-32489835 CAAGTGTACCACAATGATGCAGG - Intergenic
1006225967 6:32536316-32536338 CAAGTGTACCACACTGATGCAGG - Intergenic
1006254010 6:32814871-32814893 CAAGTCAGCCACTGTGATCTTGG - Intronic
1006333612 6:33409643-33409665 CAGGTGAACCAGTGTGTTATTGG + Exonic
1006873144 6:37271465-37271487 CAAATGTACCACTGTGGTGGCGG + Intronic
1008354671 6:50537979-50538001 CAAGTGTAGGTCTGTTATATAGG - Intergenic
1009515327 6:64609090-64609112 CAAATGTACCACTCTGTCATGGG + Intronic
1011169274 6:84487987-84488009 CAAATGTACCACTCTGATGGGGG + Intergenic
1011880626 6:92020165-92020187 CAAGTGTGCCACTGTGGTGCAGG - Intergenic
1012701937 6:102469263-102469285 CAAATGTAGCACTGTGGCATAGG - Intergenic
1015851445 6:137577657-137577679 AAAGAGAACCACTGTGAGATCGG + Intergenic
1016602492 6:145878263-145878285 CAAATGTACAACTGTGATGTGGG - Intronic
1022139807 7:27483620-27483642 TAAATGTACCACTGTGGTAGAGG - Intergenic
1025524550 7:61788196-61788218 AAGGTGTACCTCTGTGAGATGGG + Intergenic
1025547910 7:62200414-62200436 AAGGTGTACCTCTGTGAGATGGG + Intergenic
1027393656 7:77730351-77730373 CAAATGTACCACTCTGATAGGGG - Intronic
1027982830 7:85249021-85249043 CAAATGTACCACTCTGATAGGGG + Intergenic
1028194652 7:87892045-87892067 CAAATGTACCACTCTGGTGTGGG - Intronic
1030072319 7:105708568-105708590 CAATTTTCCCACTGTGAAATGGG + Intronic
1031447069 7:121867928-121867950 CAAATGTACCACTTTGATGTGGG + Intergenic
1032646511 7:133830721-133830743 CAAATGCACCACAGTAATATAGG - Intronic
1032679482 7:134167389-134167411 CAAGTCCATCACTGTGATACAGG - Intronic
1032957654 7:136990171-136990193 CAAATGTACCACTCTGATAGAGG - Intronic
1034352135 7:150423498-150423520 GAAGTGTACCACTCTGATAGTGG - Intergenic
1034609209 7:152349827-152349849 CAAATGTACCACTCTAGTATAGG + Intronic
1035412161 7:158653823-158653845 CAAATGCAGCACTGGGATATTGG + Intronic
1037662259 8:20938020-20938042 CTAGTGTACCTCTGTGAATTTGG - Intergenic
1039312890 8:36338102-36338124 CAAATGTACCACTCTGATGAGGG + Intergenic
1039591013 8:38747898-38747920 CAAATGCACCACTCTGGTATGGG + Intronic
1039642220 8:39236613-39236635 CAAATGTACCACGCTGATGTAGG - Intronic
1039722907 8:40184180-40184202 CAAGTGTACCACTCTGGTGGGGG + Intergenic
1040004842 8:42611208-42611230 CAAATGCACCACTGTGGTGTGGG + Intergenic
1040631433 8:49217627-49217649 CTAGAGTACCACTGTCATTTAGG - Intergenic
1041625293 8:60018777-60018799 CAAGTAAACCTCTGTGATCTTGG - Intergenic
1042474476 8:69231671-69231693 CAAATGTACTACTCTGATGTGGG + Intergenic
1042905649 8:73769131-73769153 CAAGTGTACCACACTGATGGAGG - Intronic
1045139211 8:99261077-99261099 CAAATGTATCACTCTGATAGGGG - Intronic
1045142356 8:99300794-99300816 CAAGTATCCCACTGTGAAATAGG + Intronic
1045521924 8:102911238-102911260 CAAGTGTACCACTCTGGTAAGGG - Intronic
1046230335 8:111347576-111347598 CAAGTGTACAGATGTGATTTTGG - Intergenic
1046983554 8:120362640-120362662 CAAATGTACCACTCTGATGGAGG + Intronic
1047677926 8:127223308-127223330 CAACTGGACCAGTGTGAAATTGG - Intergenic
1049072508 8:140367771-140367793 CAAATGTACCACCCTGGTATGGG + Intronic
1050146255 9:2571159-2571181 CAAGTGTAGCCCAGTGATAGTGG + Intergenic
1050796072 9:9544066-9544088 GAAGTGTATCACAGAGATATGGG - Intronic
1051988832 9:23125890-23125912 CAAACGTACCACTCTGATACAGG - Intergenic
1052234603 9:26194824-26194846 CAAATGTACCACTCTGATGAAGG - Intergenic
1053541700 9:38980285-38980307 CAAGTGTACCACTCTGGTGAGGG - Intergenic
1053806043 9:41802917-41802939 CAAGTGTACCACTCTGGTGAGGG - Intergenic
1054624439 9:67383626-67383648 CAAGTGTACCACTCTGGTGAGGG + Intergenic
1055972252 9:81923269-81923291 CAAATGTACCACTCTAGTATGGG + Intergenic
1055974005 9:81938341-81938363 CAAATGTACCACTCTAGTATGGG + Intergenic
1059203961 9:112445933-112445955 CAAATGTACCACTCTGGTAGAGG - Intronic
1059412676 9:114142840-114142862 TAATTGTAACAGTGTGATATGGG + Intergenic
1059854860 9:118385223-118385245 CTAGTTGACCATTGTGATATAGG - Intergenic
1059892716 9:118821929-118821951 CAAATGTACCACTCTGGTACAGG - Intergenic
1061163893 9:128911504-128911526 CAAGGGCAGCACTGTGCTATGGG - Intronic
1061581810 9:131542180-131542202 CAAATGTACCACTCTGGTGTGGG - Intergenic
1186307886 X:8283957-8283979 CAAATGGACCACTGTGATGCAGG + Intergenic
1186710590 X:12191916-12191938 TAAATGTACCACTGTGATATGGG + Intronic
1187128138 X:16473657-16473679 CAAATGAACCACTGTGGTGTGGG + Intergenic
1187800586 X:23058243-23058265 CCAGTGTACCACTCTGGTAGTGG + Intergenic
1188269056 X:28116111-28116133 CAAGTGTACCACTCTGGTGGGGG - Intergenic
1188342881 X:29026988-29027010 CAACTGTACCACTCTGGTAGAGG - Intronic
1188600562 X:31958548-31958570 CAAATGAACCAAAGTGATATGGG - Intronic
1188622170 X:32239475-32239497 CAAATGTACCACTCTGGTGTGGG - Intronic
1188859603 X:35241886-35241908 CAAATGTACCACTCTGGTGTGGG - Intergenic
1189022613 X:37356856-37356878 CAAATGTACCACTGTGGTACAGG - Intronic
1189146047 X:38655937-38655959 GAAGTGTGCCACTGTCAGATTGG + Intronic
1189775359 X:44465471-44465493 CAAATGTACCACTCTGGTAGGGG - Intergenic
1193552193 X:82908522-82908544 CAAATGTATCACTGTGATGTGGG + Intergenic
1194359566 X:92932738-92932760 CAAATGTACCACTGTGATGGGGG + Intergenic
1194669516 X:96713445-96713467 CAAATGTATCACTGTGGTGTAGG - Intronic
1195736671 X:108019128-108019150 TAAGTGTTCCACTCTGGTATTGG + Intergenic
1195943457 X:110184098-110184120 CAAATGTGCCACTCTGATACAGG + Intergenic
1196169370 X:112570588-112570610 ACAATGTACCACTGTCATATGGG - Intergenic
1197292991 X:124682980-124683002 CAAATGTACCATGGTGATATAGG + Intronic
1198199315 X:134399435-134399457 CAAATGTACCACTCTGGTGTAGG + Intronic
1198461436 X:136866487-136866509 CAAGTTTACCTTTGGGATATGGG - Intronic
1200667766 Y:6048570-6048592 CAAATGTACCACTGTGATGGGGG + Intergenic