ID: 1153379350

View in Genome Browser
Species Human (GRCh38)
Location 18:4419406-4419428
Sequence TTCCTTTACCACTTTTTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1261
Summary {0: 1, 1: 0, 2: 5, 3: 106, 4: 1149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153379350_1153379353 12 Left 1153379350 18:4419406-4419428 CCCTTCAAAAAGTGGTAAAGGAA 0: 1
1: 0
2: 5
3: 106
4: 1149
Right 1153379353 18:4419441-4419463 GAAAGAATATGATAGCAAACAGG 0: 1
1: 0
2: 2
3: 36
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153379350 Original CRISPR TTCCTTTACCACTTTTTGAA GGG (reversed) Intronic
903340409 1:22650904-22650926 TTCTTTTTCCACTCTTTGCAGGG + Intergenic
904331950 1:29765178-29765200 TTCTTTGCCCACTTTTTGACGGG - Intergenic
904758133 1:32780692-32780714 TCCCTCCACCACTTTCTGAAGGG + Intronic
906081864 1:43096238-43096260 ATCCTTTGTCACTTTTTGATGGG - Intergenic
906600715 1:47126664-47126686 ATCCTTGCCCACTTTTTGATGGG - Intergenic
906676116 1:47694674-47694696 TTCCTTTGCCACTCCCTGAAAGG + Intergenic
906714963 1:47961532-47961554 TCCTTTGCCCACTTTTTGAAGGG - Intronic
906813916 1:48857993-48858015 TGCCTTTACCCATTTTTGATTGG - Intronic
906894901 1:49760120-49760142 ATCCTTTGCCACTTTTTGATGGG + Intronic
906939234 1:50241318-50241340 TCCTTTGCCCACTTTTTGAAGGG + Intergenic
906954805 1:50364744-50364766 TCCTTTGCCCACTTTTTGAAGGG - Intergenic
907435516 1:54443773-54443795 ATCCTTTGCCCCTTTTTGATGGG + Intergenic
907629571 1:56066684-56066706 GTCCTTCACCTCTTCTTGAAGGG + Intergenic
907837773 1:58127280-58127302 TTCCTCGCCCACTTTTTGATGGG + Intronic
908004107 1:59710613-59710635 TTCTTTGCCCACTTTTTGATGGG - Intronic
908063714 1:60379626-60379648 TTCTTTGCCCACTTTTTGATGGG + Intergenic
908083555 1:60606613-60606635 TTCTTTGCCCACTTTTTGATGGG - Intergenic
908541119 1:65122983-65123005 ATCCTTTGCCACTTTTTGATGGG + Intergenic
908563332 1:65329124-65329146 TTCCTTTCCCACCTTGTGAGTGG + Intronic
908723560 1:67151274-67151296 TGCTTTGACCACTTTTTGAGGGG + Intronic
909181942 1:72435410-72435432 TTTCTTTACCACTGTTTTCAAGG - Intergenic
909259662 1:73471018-73471040 TCCTTTTACCAGTTTTTGATGGG - Intergenic
909266315 1:73562753-73562775 TTCTTTGCCCACTTTTTGATGGG - Intergenic
909312705 1:74173770-74173792 TTCCTTCAGCACTTCTTGTAAGG + Intronic
909426198 1:75527608-75527630 TTTCTTTACCACCTATTGATTGG + Intronic
909515965 1:76507737-76507759 TTCCTTTACAACTCTTTGTGTGG + Intronic
910147786 1:84102896-84102918 TTGTTTTCCCTCTTTTTGAATGG + Intronic
910394947 1:86782883-86782905 TCCCTTTAGCAATTTTTGTAAGG - Intergenic
910517934 1:88084567-88084589 TCCCTTGCCCACTTTTTGATGGG + Intergenic
910560470 1:88584296-88584318 TTCCTTTAGCATTTCTTGTAGGG - Intergenic
910679733 1:89850420-89850442 TTCCTTCTCCACTTTTCAAAAGG + Intronic
910709415 1:90164122-90164144 TTCCTGTAACTCTTTCTGAATGG + Intergenic
910717870 1:90252302-90252324 ATCCTTCACCACTTTTTGATGGG - Intergenic
910792375 1:91064707-91064729 GTTCTTTCCCATTTTTTGAATGG + Intergenic
910827328 1:91423195-91423217 TTCTTTGCCCACTTTTTGATGGG + Intergenic
910979147 1:92941651-92941673 ATCCTTTCTCACTTTTAGAAAGG - Intronic
911065006 1:93780141-93780163 TTCCTTTGCCACCTTTTTCATGG + Intronic
911101377 1:94098504-94098526 TTCCTTTACCACTCTGTTAGAGG + Intronic
911290578 1:96052398-96052420 TTCTTTGCCCACTTTTTGATGGG + Intergenic
911599460 1:99832688-99832710 TTCTTTGCCCACTTTTTGATGGG - Intergenic
911821762 1:102432418-102432440 TCCCTTTAACATTTTTTGTAGGG - Intergenic
911876002 1:103163891-103163913 TCCTTTGCCCACTTTTTGAATGG + Intergenic
911901265 1:103508707-103508729 CTCCTCTGCCACTTTTTGATGGG - Intergenic
911923431 1:103795955-103795977 TCCTTTGCCCACTTTTTGAAGGG + Intergenic
911984536 1:104603888-104603910 TTCCTTTTTTACTATTTGAAAGG - Intergenic
912069231 1:105787204-105787226 TTCTTTGCCCACTTTTTGATAGG + Intergenic
912071529 1:105816498-105816520 TCCTTTGACCACTTTTTGATGGG + Intergenic
912149846 1:106844992-106845014 TTTATTTACCTCTTTTTGAATGG + Intergenic
913020566 1:114785150-114785172 ATCCTTTGCCACTTTTTGATTGG + Intergenic
913125207 1:115780676-115780698 TCCCTTGCCCACTTTTTGATGGG - Intergenic
913428264 1:118759150-118759172 TTCCTTTAGCATTTCTTGAGAGG + Intergenic
913557873 1:119987072-119987094 TTCATTTACCAGGTTTTGAAGGG - Exonic
914076824 1:144360656-144360678 TTCTTTGCCCACTTTTTGATGGG + Intergenic
914102354 1:144605841-144605863 TTCTTTGCCCACTTTTTGATGGG - Intergenic
914171274 1:145226233-145226255 TTCTTTGCCCACTTTTTGATGGG + Intergenic
914296545 1:146331358-146331380 TTCTTTGCCCACTTTTTGATGGG + Intergenic
914526383 1:148470206-148470228 TTCTTTGCCCACTTTTTGATGGG + Intergenic
914640019 1:149596911-149596933 TTCTTTGCCCACTTTTTGATGGG - Intergenic
914940176 1:152015629-152015651 TAACTTTACCTCTTTTTGCATGG + Intergenic
915764032 1:158344948-158344970 TCCTTTTCCCACTTTTTGATGGG + Intergenic
916343628 1:163763618-163763640 TCCCTTGCCCACTTTTTGATGGG - Intergenic
916599486 1:166277776-166277798 GTCCTTTCCCACTTTTTAATAGG + Intergenic
916818737 1:168377918-168377940 TTCTCTTACCAATGTTTGAATGG - Intergenic
916864407 1:168840055-168840077 TTCATCTACCAGTTTTTGATGGG + Intergenic
916905058 1:169274287-169274309 TTCTTTGTCCACTTTTTGATGGG + Intronic
917812502 1:178672836-178672858 TCCCTTTAGCATTTTTTGTAAGG - Intergenic
917884889 1:179374144-179374166 TCCTTTGCCCACTTTTTGAAGGG - Intronic
918049538 1:180962254-180962276 GTATTTTACCACTTTTTAAAAGG - Intergenic
918085682 1:181243241-181243263 TTCTTTGCCCACTTTTTGATGGG + Intergenic
918225636 1:182479072-182479094 TTCCTTTAGCACTTTTTGTAAGG - Intronic
918542062 1:185643224-185643246 TCCCTTGCCCACTTTTTGATGGG - Intergenic
918853994 1:189727352-189727374 GTTCTTTACCAATTTTTTAATGG + Intergenic
918906657 1:190505220-190505242 TCCCTTGCCCACTTTTTGATAGG + Intergenic
918959448 1:191254406-191254428 TTCCTTTAGCATTTCTTGTAAGG + Intergenic
919381132 1:196862729-196862751 ATCCTTGACTACTTTTTGATGGG + Intronic
919499600 1:198320216-198320238 ATCCTTAACCACTTTTTAAATGG - Exonic
919547145 1:198938156-198938178 TTAATTTACCACTTTATGTAAGG + Intergenic
920088698 1:203436813-203436835 TCCTTTGCCCACTTTTTGAATGG - Intergenic
920522894 1:206642098-206642120 TTCCTTGCCCACTTTTTGATGGG - Intronic
920582975 1:207130204-207130226 TTCCTTTAGCATTTCTTGTAAGG + Intronic
920700291 1:208213012-208213034 TTTCTTTCCCACTTTCTGCAGGG + Intronic
920951994 1:210581147-210581169 TCCTTTTCCCACTTTTTGATGGG + Intronic
921197191 1:212769596-212769618 TTCCTTAAGCATTTTTTGGAGGG - Intronic
921455892 1:215371016-215371038 TCCTTTGACCACTTTTTGATGGG + Intergenic
922318971 1:224467919-224467941 TTTCTTCACCAATTGTTGAAAGG + Intronic
922331155 1:224577378-224577400 TTCTTTGCCCACTTTTTGATGGG - Intronic
922389893 1:225129988-225130010 TCCCTTGCCCACTTTTTGATGGG - Intronic
923555958 1:235000469-235000491 TTCCTTTGCCCCTTTTTGCGTGG - Intergenic
923669791 1:236030533-236030555 TTCCAATACAACTTTTTGACTGG - Intronic
924211993 1:241779024-241779046 TTCTTTTAACATTTCTTGAAAGG + Intronic
924535708 1:244933921-244933943 TTCCTTTCCCTCCTTCTGAAGGG - Intergenic
924880585 1:248157705-248157727 TTCTTTGCCCACTTTTTGATGGG + Intergenic
924935640 1:248766951-248766973 TCCTTTTCCCACTTTTTGATGGG - Intergenic
1062946159 10:1463851-1463873 TCCCTTTACCATTTTTTGTTGGG - Intronic
1063192719 10:3712606-3712628 TTCAATTTCCACTCTTTGAAAGG + Intergenic
1063732788 10:8718657-8718679 TTCCTTTATCATTTATTGTAAGG + Intergenic
1063796142 10:9516019-9516041 TTCCTTCAGCGCTTTTTAAAAGG - Intergenic
1064107476 10:12512222-12512244 TTCCAGTACCTCTTTTGGAAGGG - Intronic
1064813149 10:19224660-19224682 TCCTTTTCCCACTTTTTGATGGG + Intronic
1064869271 10:19920066-19920088 TCACTTTACCACTTTTAGATGGG + Intronic
1064975113 10:21106007-21106029 ATCCTTTCCCACTTTTTGATGGG + Intronic
1064975635 10:21111910-21111932 ATCCTTTCCCACTTTTTGATGGG - Intronic
1065460691 10:25960173-25960195 TTCCTTTACTAGTGTTTTAATGG + Intronic
1066033571 10:31455578-31455600 ATCCTTGCCCACTTTTTGATGGG - Intronic
1066470412 10:35692379-35692401 TTCCTTTACCTTCTTTGGAAAGG + Intergenic
1066750834 10:38655002-38655024 TCCCTTTAACATTTTTTGTAAGG - Intergenic
1066966210 10:42268110-42268132 TCCCTTTAACATTTTTTGTAAGG + Intergenic
1067027092 10:42852660-42852682 TTCCTGCAGCACTTGTTGAAAGG + Intergenic
1067209439 10:44246970-44246992 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1067326357 10:45271109-45271131 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1067730640 10:48808766-48808788 TTCTTTTCCATCTTTTTGAAAGG + Intronic
1068231916 10:54178737-54178759 TTCTTTGCCCACTTTTTGATGGG - Intronic
1068373904 10:56154602-56154624 CTCCTAAAACACTTTTTGAAGGG + Intergenic
1068400932 10:56526923-56526945 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1068413655 10:56689126-56689148 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1068583416 10:58768438-58768460 TTCGTTTACCATTTCTTGTAAGG - Intronic
1068664801 10:59662301-59662323 ATCCTTCACCACTTTTTGATGGG - Intronic
1069195714 10:65548694-65548716 TTCTTTTACCACTTTTTAACAGG - Intergenic
1069469711 10:68677086-68677108 TTCCTTGCTCACTTTTTGGAGGG + Intronic
1069511333 10:69044695-69044717 TGCCTTTAGCACTTTTGCAAGGG - Intergenic
1069734084 10:70640299-70640321 TCCTTTTCCCACTTTTTGATGGG + Intergenic
1070316184 10:75314875-75314897 TCCCTTTAGCATTTTTTGTAAGG - Intergenic
1070413515 10:76167128-76167150 TTTCTTGCCCACTTTTTGATAGG + Intronic
1070476880 10:76837501-76837523 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1070892673 10:79953286-79953308 TTCCTTTAGCACTTCTTGCAAGG + Intronic
1071023547 10:81085806-81085828 TCCCTTTAGCATTTTGTGAATGG + Intergenic
1071059531 10:81553441-81553463 TACTTTGACCACTTTTTGATGGG - Intergenic
1072341942 10:94460280-94460302 TTCTTTTAACATTTTTTGCAAGG + Intronic
1072393874 10:95018281-95018303 TCCTTTTCCCACTTTTTGATGGG + Intergenic
1072406240 10:95156203-95156225 TCCTTTGCCCACTTTTTGAAGGG - Intergenic
1072561018 10:96574243-96574265 TTCTTTGCCCACTTTTTGATGGG - Intronic
1072864899 10:99048398-99048420 GTCCTTTGCCCCTTTTTGAATGG - Intronic
1073062416 10:100740540-100740562 CTCCTTTACCTCTTTGTGAAAGG + Intronic
1073522938 10:104151569-104151591 GTCCTTGACCACTTTTTAATGGG + Intronic
1073616234 10:104999084-104999106 CTCCTTTTCCACTTTTACAACGG - Intronic
1073699804 10:105913932-105913954 ATCCTTTGCCAATTTTTAAATGG - Intergenic
1073997791 10:109336203-109336225 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1074542984 10:114381050-114381072 TTCATGTACAAGTTTTTGAATGG - Intronic
1078120141 11:8499243-8499265 TCCCTTGCCCACTTTTTGATGGG - Intronic
1078722015 11:13893766-13893788 TCCCTTGCCCACTTTTTGATGGG + Intergenic
1078755959 11:14210082-14210104 TTCTTTGCCCACTTTTTGATGGG + Intronic
1079267528 11:18948477-18948499 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1079611199 11:22434866-22434888 TCCTTTGCCCACTTTTTGAAAGG + Intergenic
1079735017 11:23986220-23986242 TTCCTTGCCCACTTTTTAACAGG + Intergenic
1079798276 11:24834914-24834936 TTCTTTGCCCACTTTTTGATAGG + Intronic
1080149642 11:29035899-29035921 TTCCTCAATCACTTTTTTAATGG - Intergenic
1080184847 11:29470198-29470220 TTCCTTTGCCAATTTTTAATAGG - Intergenic
1080324998 11:31061260-31061282 GTCCTTTACCCTTTTTTAAATGG - Intronic
1080334903 11:31184589-31184611 TCCTTTTTCCACTTTTTGATAGG - Intronic
1080352460 11:31401048-31401070 TTCTTTGCCCACTTTTTGATGGG - Intronic
1080675741 11:34424880-34424902 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1081042946 11:38234478-38234500 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1081217390 11:40418280-40418302 TTCCTTTGCCACTTTTTAATGGG - Intronic
1083229830 11:61309578-61309600 TTTCTTTGCTACTCTTTGAAAGG - Intronic
1085005863 11:73089462-73089484 TTCATTTACCAGTTTTTGTGTGG - Intronic
1085064233 11:73477810-73477832 TTTCTTTAGTATTTTTTGAAAGG - Intronic
1085369504 11:75987068-75987090 TTCATATACAACTTTTTGTAGGG + Intronic
1085594613 11:77797828-77797850 TCCCTTGCCCACTTTTTGATGGG - Intronic
1086030764 11:82352413-82352435 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1086256065 11:84877882-84877904 TTCTTCTCCCACTTTTTGATGGG - Intronic
1086442573 11:86843585-86843607 TTCTTTGCCCACTTTTTGATGGG - Intronic
1086512011 11:87569090-87569112 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1086652791 11:89314073-89314095 TCCCTTGCCCACTTTTTGATGGG + Intergenic
1087220090 11:95537454-95537476 TTCCTTCACTACTTCATGAAGGG - Intergenic
1087358988 11:97134205-97134227 TCCTTTTCCCACTTTTTGATGGG - Intergenic
1087395670 11:97594000-97594022 TTCCTTGCCAACTTTTTGATGGG - Intergenic
1087433536 11:98083042-98083064 TTTCTTTACAACTTTTTTAAAGG - Intergenic
1087484584 11:98745862-98745884 ATTCTTTCCCACTTTTTGATGGG - Intergenic
1087490676 11:98823059-98823081 TACCTTGACCACTTTTAAAATGG + Intergenic
1087532036 11:99395360-99395382 GTCCTTTACTCATTTTTGAATGG + Intronic
1087545086 11:99574731-99574753 TTCTTTGCCCACTTTTTGATGGG + Intronic
1087572232 11:99943357-99943379 TCCCTTGCCCACTTTTTGATGGG + Intronic
1087602457 11:100334099-100334121 TTCTTTGCCCACTTTTTGATGGG - Intronic
1087613790 11:100465561-100465583 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1087968351 11:104447965-104447987 GTTCTTTACCCCCTTTTGAATGG - Intergenic
1087972365 11:104500296-104500318 TCCTTTGACCACTTTTTGATGGG - Intergenic
1088038357 11:105346344-105346366 TTCCTTTAGCATTTCTTGTAGGG - Intergenic
1088092635 11:106060962-106060984 TTCTTTGCCCACTTTTTGATGGG - Intronic
1088134980 11:106544282-106544304 TTCCTTTAATATTTTTTGTAGGG - Intergenic
1088159379 11:106851161-106851183 TTCTTTGCCCACTTTTTAAATGG + Intronic
1089538512 11:119175144-119175166 TTCCTTGCCCACCTTTTGCAGGG - Exonic
1089938413 11:122389632-122389654 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1090082115 11:123620630-123620652 TTCCATCAACACTTTTTGAAAGG - Intronic
1090107988 11:123872314-123872336 ATGCTTTAAAACTTTTTGAATGG + Intergenic
1090142682 11:124281575-124281597 TTCATGTCCCACTTTTTGATGGG - Intergenic
1090179435 11:124683213-124683235 TTCCTTGAACACTTCTTGTAGGG - Intronic
1090757975 11:129811521-129811543 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1091125850 11:133095943-133095965 TTCCTTTAATATTTCTTGAAAGG - Intronic
1092250411 12:6891952-6891974 TTCTTTCTCCTCTTTTTGAAAGG - Intronic
1092443852 12:8534841-8534863 TTACTTTACCTCTTTTTGCTGGG - Intronic
1092577386 12:9801668-9801690 TCCTTTGCCCACTTTTTGAATGG + Intergenic
1092637157 12:10464396-10464418 ATCCTTTCCCACTTTTTGATGGG + Intergenic
1092661561 12:10744102-10744124 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1092758574 12:11788392-11788414 TTCCTAGACCACTTTTTAACAGG - Intronic
1093085449 12:14862184-14862206 TCCATTTCCCACTTTTTGATGGG + Intronic
1093122577 12:15290561-15290583 TTCATGTACAAGTTTTTGAATGG + Intronic
1093331868 12:17853357-17853379 TTTCTATAACACATTTTGAAAGG + Intergenic
1093365909 12:18298348-18298370 TTGCTTGCCCACTTTTTGATGGG + Intronic
1093541622 12:20294063-20294085 GTCCTTTGCCCATTTTTGAATGG + Intergenic
1093597208 12:20976413-20976435 TCCTTTGACCACTTTTTGATGGG + Intergenic
1093694546 12:22145300-22145322 TTCCTTCAGCACTTCTTGTAGGG - Intronic
1094032345 12:26026925-26026947 TTCATGTACAACTTTTTGCATGG - Intronic
1094302463 12:28980445-28980467 TGCCTTTCCCACTTTCTTAATGG - Intergenic
1094423148 12:30293462-30293484 TTCTTTTCCCACTTTCTGATGGG - Intergenic
1094428367 12:30339374-30339396 CTCCTTTACCACTTTTAAAATGG - Intergenic
1094481861 12:30889799-30889821 TTCCTTGCCCACTTCTTGATAGG + Intergenic
1095336514 12:41034618-41034640 TTCCTTTACCCCATTTTTCATGG + Intronic
1095547081 12:43385277-43385299 ATCCTTCACCACTTTTTAATGGG + Intronic
1095845743 12:46742298-46742320 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1096379927 12:51147959-51147981 ATCCTTAGCCACTTTTTGATGGG - Intronic
1096932894 12:55234969-55234991 TACCTTTAGCATTTTTTGTAAGG - Intergenic
1097358846 12:58633745-58633767 TCCCTTTAGCATTTTTTGTAAGG - Intronic
1097368712 12:58748807-58748829 TTCTTTGCCCACTTTTTGATGGG + Intronic
1097472437 12:60011201-60011223 TTCCTTTTCCAGTTTTTCATGGG - Intergenic
1097536340 12:60874685-60874707 TTTCTTTTCCAATTTTTGAATGG + Intergenic
1097576497 12:61400433-61400455 GTCCTTTGCCAGTTTTTGATGGG + Intergenic
1097660182 12:62421731-62421753 TTCTTAGACCACTTTTTGATGGG - Intergenic
1097949555 12:65412658-65412680 TTTCTTTCCCACTCTTTGAGAGG + Intronic
1098001471 12:65948477-65948499 TTCCTTTCCCTTTTTATGAATGG + Intronic
1098054116 12:66485783-66485805 ATCCATTATCATTTTTTGAAAGG + Intronic
1098183308 12:67870403-67870425 TTTCTTTGCCATATTTTGAAAGG - Intergenic
1098399696 12:70061242-70061264 GTCCTTTACCCATTTTTTAACGG - Intergenic
1098473107 12:70868357-70868379 ATCCTTTCCCACTTTTTGATGGG - Intronic
1099007220 12:77248078-77248100 TTCCTTTACCCTTTTTTGGGGGG + Intergenic
1099143726 12:79012630-79012652 TCCCTTCAGCTCTTTTTGAAAGG - Intronic
1099224585 12:79954654-79954676 TTCCTTTAGCACTTTTTGTAAGG + Intergenic
1099250187 12:80244982-80245004 TTCTTTGCCCACTTTTTGATGGG + Intronic
1099416924 12:82400425-82400447 TTGTTTTACCATTTTTTAAATGG + Intronic
1099531529 12:83788164-83788186 TCCTTTGACCACTTTTTGATGGG + Intergenic
1099567135 12:84265940-84265962 TTACTTTCCCACATTTGGAAAGG - Intergenic
1099792916 12:87359779-87359801 TTCTTGTACCAGTTTTCGAAGGG + Intergenic
1099962376 12:89408945-89408967 TCCTTTGCCCACTTTTTGAAGGG + Intergenic
1100025872 12:90127306-90127328 GTCCTTTACCACTTTCTAATGGG - Intergenic
1100067186 12:90663757-90663779 TCTCTTTATCATTTTTTGAAGGG + Intergenic
1100425861 12:94485598-94485620 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1100741988 12:97604036-97604058 ATCCTTGCCCACTTTTTGATGGG + Intergenic
1100848186 12:98681498-98681520 TTACTTTAACCCTTTTTCAAAGG + Intronic
1100907314 12:99316492-99316514 TCCTTTGACCACTTTTTGATGGG + Intronic
1100944287 12:99762828-99762850 GTCCTTTACCCATTTTTTAATGG - Intronic
1100982076 12:100169836-100169858 TTTCTTGTTCACTTTTTGAAAGG + Intergenic
1103649833 12:122423394-122423416 TTCCTTTAAAAGCTTTTGAAAGG + Intergenic
1103652710 12:122445318-122445340 TTCGTGTACCAGTTTTTGTATGG - Intergenic
1103730460 12:123023951-123023973 CTCCTTTGCCAGTTTTTGAATGG - Intronic
1104101333 12:125614836-125614858 TTCCTTTACCATTTCTTGTAAGG + Intronic
1104577947 12:129985279-129985301 TTCCTTGACTACTTTTGGCATGG + Intergenic
1104880302 12:132066317-132066339 TCCATTTACCATTTTTTAAATGG + Intronic
1105244564 13:18637248-18637270 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1105277087 13:18941655-18941677 TACCTTTACAACTTTTTTGAAGG + Intergenic
1106060530 13:26286820-26286842 TCCCTTGCCCACTTTTTGATGGG - Intronic
1106238840 13:27890810-27890832 GTCCTTTGCCCATTTTTGAAAGG + Intergenic
1106371043 13:29133183-29133205 GTCCTTTGCCTGTTTTTGAATGG + Intronic
1106649752 13:31677591-31677613 TCCCTTGCCCACTTTTTGATGGG - Intergenic
1106767668 13:32931163-32931185 TCCCTTGCCCACTTTTTGATGGG + Intergenic
1107241775 13:38243992-38244014 ATCCTTTACCACTTTTTAATTGG - Intergenic
1107380215 13:39849097-39849119 ATCCTTTCCCAATTTTTGATGGG + Intergenic
1107712619 13:43165272-43165294 TCCTTTTCCCACTTTTTGATGGG + Intergenic
1107783749 13:43933484-43933506 CTCCTTTACCCCTCTTTCAAGGG + Intergenic
1107860950 13:44660579-44660601 TTCCATTGCCCCTTTTTGGATGG + Intergenic
1108106736 13:47018787-47018809 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1108298085 13:49045156-49045178 TTCCTTTCCTTCTTTTTTAATGG + Intronic
1108327116 13:49344786-49344808 TGCCTTAACCACTTTTAAAATGG + Intronic
1108477374 13:50834356-50834378 TCCTTTTCCCACTTTTTGATGGG - Intronic
1108584697 13:51860330-51860352 TTCCTTTAATTCTTTTGGAATGG - Intergenic
1108925350 13:55735613-55735635 TACTTTTCCCACTTTTTGATGGG - Intergenic
1109194566 13:59363882-59363904 TTTCTTTACCACCTTTTTAATGG + Intergenic
1109489349 13:63075661-63075683 TTCCTTTGTCACTTTTTTCAAGG + Intergenic
1109513995 13:63417362-63417384 TCCTTTCACCACTTTTTGATGGG - Intergenic
1109572553 13:64211876-64211898 ATCCTTTGCCACTTTTTGATGGG + Intergenic
1109686368 13:65825464-65825486 ATCCTTTCCCACTTTTTAATGGG + Intergenic
1109721450 13:66281460-66281482 TCCTTTAACCACTTTTTGATGGG + Intergenic
1109804389 13:67418989-67419011 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1109806467 13:67450956-67450978 TTCTTTTCCCACTTTTTGATGGG + Intergenic
1110095760 13:71518237-71518259 TGCCTTTTCCTCTTTTTGTAAGG - Intronic
1110394904 13:75018499-75018521 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1110746107 13:79054994-79055016 CTCCTTCTTCACTTTTTGAAGGG - Intergenic
1110969725 13:81746243-81746265 TTTCTTGACCACATTTTCAAAGG + Intergenic
1111214263 13:85122724-85122746 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1111263571 13:85776470-85776492 TACCATTACCACTCTGTGAAGGG - Intergenic
1111439505 13:88261277-88261299 TTCCACTACCATTTTTAGAAAGG + Intergenic
1111933117 13:94531955-94531977 TCCTTTGACCACTTTTTGATGGG - Intergenic
1112740658 13:102469254-102469276 TCCTTTTCCCACTTTTTGATGGG + Intergenic
1112766231 13:102747487-102747509 TTACTTTACCATATTTTAAAAGG - Exonic
1112791648 13:103009447-103009469 ATCCTTTACCAATTTTGGATTGG + Intergenic
1112848019 13:103667944-103667966 CTCCTTTACCATTTTCTAAATGG + Intergenic
1113406797 13:110048321-110048343 TCCTTTTCCCACTTTTTGATGGG - Intergenic
1114135953 14:19851075-19851097 TTCCATTACTATCTTTTGAATGG - Intergenic
1114343049 14:21765447-21765469 TCCCTTGCCCACTTTTTGATGGG - Intergenic
1115006766 14:28495000-28495022 CTCCATCACCACTTGTTGAAAGG - Intergenic
1115382293 14:32754652-32754674 TTCCTTTAGCATTTCTTGTAAGG + Intronic
1115547624 14:34477247-34477269 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1115833762 14:37374204-37374226 TCCCTTGCCCACTTTTTGATGGG + Intronic
1116022367 14:39476838-39476860 TTCTTTGCCCACTTTTTGATAGG + Intergenic
1116139713 14:40975876-40975898 TTCCTTTACAACTTGCTGATAGG + Intergenic
1116361148 14:43999639-43999661 TTCCTCTACTCCTTTTTGGATGG - Intergenic
1116550141 14:46227103-46227125 TCCCTTGCCCACTTTTTGATGGG - Intergenic
1116560451 14:46372386-46372408 TCCTTTTCCCACTTTTTGATGGG + Intergenic
1116723826 14:48535385-48535407 TTCTTTTACCATTTCTTGCAAGG + Intergenic
1116955421 14:50918001-50918023 GTCCTTTGCCACTTTTTCATGGG - Intronic
1117078052 14:52123548-52123570 TTCCTTTTAGACTTTTTCAAGGG + Intergenic
1117259715 14:54019422-54019444 GTCCTTTGCCACTTTTTGATGGG - Intergenic
1117646160 14:57855358-57855380 TTCTTTGCCCACTTTTTGATGGG - Intronic
1117697599 14:58381682-58381704 TTGCTTTAGCTCTTTTTGGAGGG - Intergenic
1118578961 14:67273943-67273965 TTCTTTGCCCACTTTTTGATGGG + Intronic
1118719240 14:68582324-68582346 TCCTTTGACCACTTTTTGATGGG - Intronic
1119107037 14:71934095-71934117 TTAATTTATCACTTTTTCAATGG + Intronic
1119874983 14:78051346-78051368 TTCTTTGCCCACTTTTTGACGGG + Intergenic
1120606647 14:86586676-86586698 TTCCTCTCCTACTTTTTGCAAGG - Intergenic
1120708588 14:87770622-87770644 TTCCTTTCATGCTTTTTGAATGG - Intergenic
1120829788 14:88987673-88987695 TTCCTTAACCACTTCCTTAAAGG - Intergenic
1122304744 14:100756025-100756047 TTCCTTTAGCATTTTTTGTAAGG - Intergenic
1123426717 15:20177181-20177203 TTCCTGCAGCACTTGTTGAAAGG + Intergenic
1123828202 15:24104961-24104983 TCCTTTTCCCACTTTTTGATGGG + Intergenic
1123955526 15:25330650-25330672 TTCCGTTAACACATGTTGAAGGG + Intergenic
1124457917 15:29861611-29861633 GTCCTTTGCCACTTTTTAATTGG + Intronic
1124473904 15:30014267-30014289 GTCCTTTGCCAATTTTTTAACGG + Intergenic
1124924035 15:34053994-34054016 TTCTTTGCCCACTTTTTGATGGG - Intronic
1126128555 15:45318479-45318501 TCCCTTGCCCACTTTTTGATGGG - Intergenic
1126233874 15:46359071-46359093 TTCTTTACCCACTTTTTTAATGG - Intergenic
1126264876 15:46742259-46742281 TTCCTCTAACCCTTTTTCAAGGG - Intergenic
1126635236 15:50773361-50773383 ATCTTTTCCCACTTTTAGAAAGG - Intergenic
1126833384 15:52633713-52633735 TTCCTTTAACATTTTTGGTAGGG - Intronic
1127096937 15:55521365-55521387 GTCCTTTGCCATTTTTTTAATGG + Intergenic
1127322934 15:57865101-57865123 TTGCTTTACTATGTTTTGAATGG + Intergenic
1127552297 15:60052773-60052795 TTTCTTTACCTCTCCTTGAATGG - Intronic
1128721398 15:69952644-69952666 TTCCAGCACCACTTATTGAATGG - Intergenic
1129495083 15:75972190-75972212 TTCTTTGCCCACTTTTTGATGGG + Intronic
1129693457 15:77726908-77726930 GTCCTTTGCCAATTTTTGATTGG - Intronic
1130125543 15:81091082-81091104 TCCTTTGACCACTTTTTGATGGG - Intronic
1130840704 15:87698170-87698192 TCCTTTTCCCACTTTTTGATGGG - Intergenic
1131362962 15:91810676-91810698 TTCTTTTAACATTTTTTGCAAGG - Intergenic
1131543354 15:93293799-93293821 TTTCTTTTCCACTCTTTGATTGG - Intergenic
1131839578 15:96421793-96421815 TACCTTTACCTTTATTTGAAAGG - Intergenic
1131942111 15:97578301-97578323 ATCCTTAGCCACTTTTTGATGGG + Intergenic
1132310977 15:100857937-100857959 TTCATTCACCACTTTTTGATGGG + Intergenic
1133124013 16:3632944-3632966 TTCTTTTAACATTTTTTGCAAGG + Intronic
1133900932 16:9973896-9973918 TTCCTTTAGCATTTCTTGAAGGG - Intronic
1134784479 16:16928995-16929017 TTCCTTTAGCTGTTTTTGGATGG - Intergenic
1134898451 16:17911715-17911737 ATCCTTTGCCACTTGTTGATTGG - Intergenic
1135229145 16:20688750-20688772 TTCCTTTAGCATTTCTTGTAGGG - Intronic
1136857533 16:33672324-33672346 TTCCTGCAGCACTTGTTGAAAGG - Intergenic
1136991049 16:35151621-35151643 TTCCTTGTCCACTTTTTAACTGG + Intergenic
1137471559 16:48764035-48764057 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1137925392 16:52535690-52535712 TTCCTTGACCATTTCTTCAATGG + Intronic
1138227769 16:55312651-55312673 ATCCTTTACCCATTTTTTAATGG + Intergenic
1138714139 16:59002309-59002331 ATCCTTCACCACTTTTTGATGGG + Intergenic
1138739020 16:59286025-59286047 TTCCTTGTCCACTTTTTAATGGG - Intergenic
1138751046 16:59421414-59421436 TTCTTTGCCCACTTTTTGATAGG + Intergenic
1138772383 16:59681270-59681292 ATCCTTCACCACTTTTTGATGGG + Intergenic
1138788215 16:59871064-59871086 ATCCTTCGCCACTTTTTGATGGG + Intergenic
1138801416 16:60034789-60034811 TTCCTTTAGCAATTTTCTAAGGG - Intergenic
1139028731 16:62852850-62852872 TTTCTTTACCACTTGGTGAGTGG + Intergenic
1139256183 16:65544846-65544868 ATGCCTTATCACTTTTTGAAAGG + Intergenic
1139286554 16:65820250-65820272 TTGCTTTACGCCTTTTTGAGGGG - Intergenic
1140184803 16:72759002-72759024 TCTCTTTACCATTTCTTGAACGG + Intergenic
1140524092 16:75607756-75607778 TTCATGTACCACTTTTTGCATGG - Intronic
1140563767 16:76015327-76015349 TTCCTTTAACAATTCTTGTAAGG + Intergenic
1141001853 16:80315890-80315912 TTCCGTTACCTGTTTTTGAGTGG - Intergenic
1141117983 16:81327230-81327252 TTCCTTGACAACATTTTGGAAGG + Intronic
1203119106 16_KI270728v1_random:1520809-1520831 TTCCTGCAGCACTTGTTGAAAGG - Intergenic
1144112690 17:12051830-12051852 CTCCTTTACTTCTTTTTCAAGGG - Intronic
1144465755 17:15495899-15495921 TTTCTTAAACACTTTATGAAAGG + Intronic
1144517009 17:15925563-15925585 TTACTTCACCTCTATTTGAAGGG - Intergenic
1145034495 17:19531647-19531669 TTCCTGTGCTACTTTTTGGAAGG + Intronic
1145121618 17:20265428-20265450 TTCCTTTGCCTATTTTTTAATGG + Intronic
1145199008 17:20923023-20923045 TTCCTTTTTCAATTATTGAATGG - Intergenic
1146279395 17:31535589-31535611 TTCCTTTTCCTGTTGTTGAATGG + Exonic
1146744676 17:35317291-35317313 TTCTTTGCCCACTTTTTGATTGG + Intergenic
1147544067 17:41386176-41386198 TTCCTTTAACATTTTTTGTAAGG + Intronic
1148626291 17:49071710-49071732 TTCCTGTACCAGTTTTTGCATGG + Intergenic
1149153653 17:53599821-53599843 ATCCTTTGCCAATTTTTTAATGG + Intergenic
1149162077 17:53706485-53706507 TACCTTTACTACTTTCTCAATGG - Intergenic
1150497806 17:65622347-65622369 TTCCTTTGCCACTTCTTTGAAGG + Intronic
1150845682 17:68655542-68655564 GTCCTTCGCCACTTTTTGATGGG - Intergenic
1153056686 18:952638-952660 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1153201551 18:2653021-2653043 TTCCTTTACCAGTTTTTTTGAGG + Intergenic
1153220982 18:2861057-2861079 ATCCTTTGCCACTTTTTGATGGG + Intronic
1153260953 18:3224433-3224455 CTCCTTTCCCAGTTTTGGAAAGG + Intergenic
1153379350 18:4419406-4419428 TTCCTTTACCACTTTTTGAAGGG - Intronic
1153542318 18:6168998-6169020 TTCTTTGCCCACTTTTTGATGGG - Intronic
1153548400 18:6234486-6234508 TTCTTTGCCCACTTTTTGATGGG - Intronic
1153575733 18:6518926-6518948 TTCTTTGCCCACTTTTTGATGGG + Intronic
1153680371 18:7494851-7494873 TTCCTTGCCCACTTTTTAATGGG + Intergenic
1154126668 18:11698076-11698098 TTCCTCCAGCCCTTTTTGAAAGG - Intronic
1154291711 18:13114024-13114046 TTCCTTTAAAAATTTTTAAAAGG - Intronic
1154401904 18:14046893-14046915 GTCCTTTGCCCATTTTTGAATGG + Intergenic
1154444369 18:14422653-14422675 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1154473148 18:14724285-14724307 TTCCTATACAAGTTTTTGTATGG + Intergenic
1154489726 18:14910946-14910968 GTCCTTTCCCACTTTTTGGTGGG + Intergenic
1155272244 18:24152208-24152230 TTTCTGTATCACTTTTTAAATGG + Intronic
1155376690 18:25166036-25166058 TACCTTTAAGACTTTTTGACAGG - Intronic
1155723277 18:29046563-29046585 TTCTTTTCCCACTTTTTAATGGG + Intergenic
1155771401 18:29705015-29705037 TCCTTTGCCCACTTTTTGAAGGG + Intergenic
1156587526 18:38447921-38447943 TTCTTATACAACTTTTTGGAAGG + Intergenic
1156756428 18:40532705-40532727 TTTTTTTACCTCTTTTTGATAGG + Intergenic
1156965276 18:43084054-43084076 TTCTTTGCCCACTTTTTGATGGG - Intronic
1157034370 18:43953427-43953449 TTCCTTTACCACAGTTTCACTGG - Intergenic
1157042451 18:44056915-44056937 TAACTTTACTACTTTTTCAAAGG + Intergenic
1157508922 18:48253745-48253767 TTCTTTTACCCCTTTTTGGGTGG - Intronic
1157810291 18:50690228-50690250 TTCCTTTTCTACTATTTGTAAGG - Intronic
1157996652 18:52565662-52565684 TCCTTTGACCACTTTTTGATGGG + Intronic
1158148178 18:54339707-54339729 TCCCTTTAGCATTTTTTGTAAGG - Intronic
1158301790 18:56060822-56060844 GTTCTTTGACACTTTTTGAAAGG - Intergenic
1158811413 18:61040859-61040881 TTCATATACCAGTTTTTGTATGG + Intergenic
1158824646 18:61202744-61202766 GCCTTTGACCACTTTTTGAAGGG - Intergenic
1158872401 18:61700866-61700888 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1159391283 18:67795901-67795923 TACCTTTACCACTATTGCAAGGG + Intergenic
1159630272 18:70741154-70741176 ATCCTTCACCACTTTTTGATGGG - Intergenic
1159686673 18:71430338-71430360 TTCCTTTAGCACCTTTGGACAGG - Intergenic
1159724811 18:71943519-71943541 TTCCTTTGCCACACTTTCAATGG - Intergenic
1160144011 18:76349323-76349345 TTCCTTTATCCGTTTTTGAAGGG - Intergenic
1160498608 18:79390071-79390093 TTCCTTTAGTATTTTTTGTAAGG - Intergenic
1160558706 18:79742485-79742507 TTCCTTTAGAACTTCTTGTAAGG - Intronic
1162625687 19:11882842-11882864 TTCCTTTAATCATTTTTGAAGGG - Intronic
1165983817 19:39749931-39749953 ATCCTTCGCCACTTTTTGATGGG - Intergenic
1167911286 19:52703924-52703946 TTCAGTTAGTACTTTTTGAAAGG - Exonic
925432779 2:3810410-3810432 ATCTTTTACCACTTTTTGATGGG + Intronic
925758568 2:7160355-7160377 TTCTTTTACCACTTCTTGCAAGG + Intergenic
925935428 2:8753676-8753698 TTCCCATTTCACTTTTTGAAGGG - Intronic
926237970 2:11062856-11062878 ATCCTTGCCCACTTTTTGATGGG - Intergenic
926516139 2:13849611-13849633 TTCTTTTCTCACTTTTTGATGGG + Intergenic
926823263 2:16876809-16876831 TTCTTTGCCCACTTTTTGATGGG + Intergenic
926902464 2:17768716-17768738 TTTTTTTCCCACTTTCTGAAAGG + Exonic
927345922 2:22039785-22039807 TTCCTTTAACATTTATTGTATGG - Intergenic
927565555 2:24109606-24109628 TTCTTTGCCCACTTTTTGATGGG - Intronic
927747651 2:25636251-25636273 TTCCTTTACTTTTTGTTGAAAGG - Intronic
928354382 2:30596463-30596485 TCCCTTGCCCACTTTTTTAATGG + Intronic
928355237 2:30606904-30606926 TCCCTTGCCCACTTTTTTAATGG - Intronic
928791914 2:34967158-34967180 TTCATTTACAAGTTTTTGTATGG - Intergenic
929092637 2:38234662-38234684 TTCTTTGCCCACTTTTTGATGGG - Intergenic
929319797 2:40529223-40529245 TTCTTTGCCCACTTTTTGATGGG + Intronic
930307396 2:49692672-49692694 ATCCTTTACCACTTTTTGATGGG + Intergenic
930552004 2:52847696-52847718 TACTTTTCCCACTTTTTGATGGG + Intergenic
930580587 2:53206741-53206763 GTCCTTTGCCACTTTTTAATGGG - Intergenic
930981404 2:57530040-57530062 TTCTTGTACCAGTTTTTCAAAGG - Intergenic
931113276 2:59136681-59136703 TTCCATCACCACATTTGGAAAGG - Intergenic
931529338 2:63196327-63196349 TTCCTTTTCCTTTTTTAGAATGG - Intronic
931539003 2:63308065-63308087 TTCTTTGCCCACTTTTTGATGGG - Intronic
931901734 2:66796876-66796898 TTCTTTGCCCACTTTTTGATGGG + Intergenic
931974127 2:67624141-67624163 TCCTTTTCCCACTTTTTGATAGG + Intergenic
932056192 2:68446637-68446659 TTCTTTGCCCACTTTTTGATGGG + Intergenic
932152195 2:69383559-69383581 TTCCTTTACTGCTTTTAAAAAGG + Intronic
932222931 2:70014336-70014358 TTCCTTTGCCCTTTTTTGAATGG - Intergenic
932858222 2:75261486-75261508 TTGCTCTACAAATTTTTGAAAGG - Intergenic
932914374 2:75839317-75839339 TCCTTTGCCCACTTTTTGAAGGG - Intergenic
933020078 2:77179166-77179188 CTTCTTTACCACTTATTGACTGG - Intronic
933152113 2:78928134-78928156 GTCCTTTAACACATTTTCAAAGG - Intergenic
933300737 2:80538051-80538073 TCCCTTGCCCACTTTTTGATAGG + Intronic
933304807 2:80584261-80584283 TTAATTTACCATTTTTAGAAAGG - Intronic
933474180 2:82767742-82767764 TCCCTTTAGCACTTCTTGTAAGG - Intergenic
934313835 2:91897160-91897182 TCCCTTTAACATTTTTTGTAAGG - Intergenic
934878056 2:97944631-97944653 TTCCTTGTCCATTTTTTGATTGG - Intronic
934954282 2:98604273-98604295 CTCCTTTAACACTTTTAAAAAGG - Intronic
935409331 2:102742905-102742927 TTCTTTTAACATTTTTTGAAAGG - Intronic
935523137 2:104134581-104134603 TCCTTTGCCCACTTTTTGAAGGG - Intergenic
935799040 2:106674293-106674315 TTGCTTTCCCACTTTTTGATGGG + Intergenic
935864258 2:107368329-107368351 TTCTTTGACCACTTTTTAATGGG - Intergenic
936720059 2:115240424-115240446 TCCTTTGACCACTTTTTGATGGG + Intronic
936725269 2:115306763-115306785 TTGTTTTACCACTTTTTAAATGG + Intronic
936808229 2:116363169-116363191 TCCTTTGCCCACTTTTTGAATGG - Intergenic
936808601 2:116368228-116368250 TTCTTTGCCCACTTTTTGATGGG + Intergenic
936815698 2:116457376-116457398 TTCCTGAATCACTTATTGAAAGG + Intergenic
936942253 2:117897119-117897141 TTCCTTTAACACTTCTTTCAAGG + Intergenic
937645296 2:124259679-124259701 TCCCTTGCCCACTTTTTGATGGG + Intronic
937862955 2:126725894-126725916 TTTCTTTAGCATTTTTTGGATGG - Intergenic
938176154 2:129132142-129132164 TACTTTTACCAGTTTTTAAATGG + Intergenic
938600459 2:132833191-132833213 GTCCTTTACCCCATTTTTAATGG + Intronic
938686956 2:133747767-133747789 ATCCTTTACCCATTTTTGATGGG - Intergenic
938825372 2:134999506-134999528 TTGCTTTGCAACTTTTTTAATGG + Intronic
938834681 2:135088733-135088755 TTCTTTGCCCACTTTTTGATGGG + Intronic
939056030 2:137365560-137365582 TACCTTGCCCACTTTTTGATGGG - Intronic
939192595 2:138933391-138933413 GTCTTCTACCAGTTTTTGAAGGG - Intergenic
939208026 2:139132978-139133000 GTCCTTTGCCAGTTTTTTAATGG + Intergenic
939371270 2:141304084-141304106 TTCCTTTACCTACTTTTTAATGG + Intronic
939573760 2:143871278-143871300 TTCCTTTAGCATTTCTTGTAGGG - Intergenic
939678770 2:145105080-145105102 TTCCATTACAACTTTATGTATGG - Intergenic
939793211 2:146606752-146606774 TTCTTTGCCCACTTTTTGATGGG + Intergenic
940030025 2:149252126-149252148 ATCCTTTGCCACTTTTTGATAGG + Intergenic
940679144 2:156762210-156762232 GTCCTTGCCCACTTTTTGATGGG - Intergenic
940720283 2:157274650-157274672 TTCTTTGCCCACTTTTTGATGGG + Intronic
940967582 2:159857057-159857079 TTACTTTTCCACTTGTTTAAAGG + Intronic
941141145 2:161783345-161783367 TTCCCTTAGCATTTTTTGTAGGG - Intronic
941539859 2:166768727-166768749 TCCTTTTCTCACTTTTTGAATGG + Intergenic
941569657 2:167154229-167154251 ATCCTTGGCCACTTTTTGATGGG + Intronic
941570492 2:167163882-167163904 TTCCAGTACCATTTTTTGAAAGG + Intronic
941593498 2:167448005-167448027 TTCTTTATCCACTTTTTGATTGG + Intergenic
941603439 2:167565673-167565695 ATCCTTGCCCACTTTTTGATGGG - Intergenic
942376015 2:175338827-175338849 TTCTTTGCCCACTTTTTGATGGG + Intergenic
942731991 2:179070444-179070466 TTTCTTTACCACTTATAGAAGGG - Intergenic
943178829 2:184515110-184515132 TTCCTTTACCTCTTTTGGGTTGG - Intergenic
943818135 2:192282351-192282373 TCCTTTTCCCACTTTTTAAATGG - Intergenic
943866079 2:192925989-192926011 TTCTTTGCCCACTTTTTGATGGG + Intergenic
943935993 2:193918062-193918084 TCCCTTGCCCACTTTTTGATGGG - Intergenic
943959896 2:194250841-194250863 TCCTTCTCCCACTTTTTGAAGGG + Intergenic
943979132 2:194524281-194524303 TTCTTTGCCCACTTTTTGATGGG - Intergenic
944147523 2:196522303-196522325 GTCCTTGCCCACTTTTTGATGGG + Intronic
944174387 2:196813744-196813766 ATCCTTCGCCACTTTTTGATGGG - Intergenic
944570319 2:201038062-201038084 TTCTTTGCCCACTTTTTGATGGG - Intronic
944764856 2:202853673-202853695 TTCTTTGCCCACTTTTTGATGGG - Intronic
945140014 2:206675751-206675773 TCCCTTGCCCACTTTTTGATGGG - Intronic
945348360 2:208747310-208747332 TTCTTTGCCCACTTTTTGATGGG + Intronic
945383429 2:209168210-209168232 GTCCTTGCCCACTTTTTGATGGG - Intergenic
945429390 2:209746999-209747021 GTCCTTGCCCACTTTTTGATGGG + Intergenic
945463826 2:210143983-210144005 TCCCTTTACCATTTCTTGTAAGG + Intronic
945515573 2:210759787-210759809 TTCTTTGCCCACTTTTTGATGGG + Intergenic
945626470 2:212213232-212213254 TCCCTTTCCCACTTTCTGATGGG - Intronic
945674333 2:212837286-212837308 TTCTTTTAACATTTTTTGCAAGG + Intergenic
945845444 2:214938781-214938803 TCCTTTGACCACTTTTTGATGGG + Intronic
945919263 2:215738721-215738743 TTCGTTCACCATTTTTTCAAGGG - Intergenic
946697569 2:222375180-222375202 TTCTTTGCCCACTTTTTGATGGG + Intergenic
947259058 2:228199957-228199979 GTCCTTTGCCACTTTTTGATGGG + Intergenic
947305565 2:228742237-228742259 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1170051100 20:12146284-12146306 TTCCTTTGCCCCCTTTTTAATGG + Intergenic
1170132800 20:13040745-13040767 TCCCTTTAGTACTTCTTGAAAGG + Intronic
1170176202 20:13472654-13472676 TTCTTTGCCCACTTTTTGATGGG - Intronic
1170180120 20:13520943-13520965 TTCTTTGCCCACTTTTTGATGGG - Intronic
1170324121 20:15136878-15136900 TTCTTTGCCCACTTTTTGATGGG - Intronic
1170413792 20:16118956-16118978 GTCCTTTGCCACTTTTTAATGGG - Intergenic
1170745333 20:19093742-19093764 TCCCATTACCACTTTGTTAATGG + Intergenic
1171241879 20:23576317-23576339 TCCTTTGACCACTTTTTGATGGG + Intergenic
1171357330 20:24558148-24558170 GTTCTTCACTACTTTTTGAAAGG + Intronic
1171480001 20:25447421-25447443 TTTCACTACCATTTTTTGAAAGG + Exonic
1172999250 20:39093645-39093667 TTCTTTCTCCACATTTTGAACGG - Intergenic
1173299239 20:41786048-41786070 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1173412250 20:42822716-42822738 ATCCTTTGCCACTTTTTGATGGG - Intronic
1174136253 20:48382119-48382141 TTCCCTTACCATTCTGTGAAAGG - Intergenic
1174908609 20:54580187-54580209 TTCTTTGCCCACTTTTTGATGGG - Intronic
1175232985 20:57486715-57486737 TTCTTTACCCACTTTTTGATGGG - Intergenic
1175505030 20:59476358-59476380 TGACTTCACCAGTTTTTGAAAGG - Intergenic
1175506021 20:59484639-59484661 TTCTTTTCCAAATTTTTGAATGG - Intergenic
1175555016 20:59845438-59845460 TTCCTTTAGGACTTGGTGAAAGG + Intronic
1177313677 21:19429471-19429493 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1177463836 21:21447714-21447736 TTCTTTGCCCACTTTTTGATGGG - Intronic
1177579570 21:23003439-23003461 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1177942439 21:27427781-27427803 TATCTATACCACATTTTGAATGG + Intergenic
1177951405 21:27542514-27542536 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1178033985 21:28560283-28560305 TTCTTTACCCACTTTTTGATGGG - Intergenic
1178099283 21:29249975-29249997 CTCCTTTGCCAGTTTTTTAATGG + Intronic
1178232615 21:30804178-30804200 TCCTTTTCCCACTTTTTGATGGG - Intergenic
1178236895 21:30853529-30853551 TCCTTTTCCCACTTTTTGATGGG - Intergenic
1178243329 21:30927426-30927448 TTCCTTAAGCATTTTTTGTAAGG - Intergenic
1178271552 21:31194380-31194402 TTCCTTTAACATTATTTGTATGG + Intronic
1178800764 21:35793252-35793274 TTCTTTTACTACCTTTTTAATGG + Intronic
1178813151 21:35903050-35903072 ATCCTTCACCATTTTTTGATGGG - Intronic
1179002195 21:37472082-37472104 TTCCCTTAGGACTGTTTGAAAGG + Intronic
1179232935 21:39521650-39521672 GTCCTTTCCCACTTTTTGATGGG + Intergenic
1180111377 21:45655823-45655845 TGCCTTGCCCACTTTTTGATGGG - Intronic
1180656769 22:17428148-17428170 TCCCTTGCCCACTTTTTGATGGG + Intronic
1182040451 22:27234954-27234976 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1182763823 22:32744243-32744265 ATCCATTTCCACATTTTGAAGGG - Intronic
1182870797 22:33645762-33645784 TACCTTCGCCACTTTTTGATGGG - Intronic
1182986799 22:34726360-34726382 TCCCTTTAGAACTTTTTGTAAGG - Intergenic
1183610520 22:38900811-38900833 TTCCTTCACTACTATTTTAATGG + Intergenic
1183839053 22:40482580-40482602 TTCCTTTAGCACTTTTAGGTAGG + Intronic
1183888365 22:40904285-40904307 TTGCTTTACTTCTTTTTGTAAGG - Intronic
949129054 3:479350-479372 TCCATTGCCCACTTTTTGAATGG - Intergenic
949302537 3:2601022-2601044 TTCATTGCCCACTTTTTGATGGG + Intronic
949579411 3:5372299-5372321 TTCTTTGCCCACTTTTTGATGGG + Intergenic
949580132 3:5379457-5379479 TTCTTCTCCCACTTTTTGATGGG + Intergenic
950319175 3:12034359-12034381 TCCTTTTCCCACTTTTTGATTGG + Intronic
950353205 3:12377943-12377965 TTCCTTTATCATTTTTTAACTGG - Intronic
950353964 3:12387542-12387564 TCCCTTACCCACTTTTTGATGGG + Intronic
950402112 3:12777028-12777050 TTTCTTAACAACTTTTTAAATGG + Intergenic
951432170 3:22621070-22621092 TTCCTTTCTCAATTTTAGAATGG - Intergenic
951653255 3:24976591-24976613 TCCTTTGTCCACTTTTTGAAGGG + Intergenic
951921354 3:27858088-27858110 TTCTTTGACCACTTTTTAATGGG - Intergenic
952021779 3:29031444-29031466 TTTCTTTACCATTTTTACAAGGG - Intergenic
952086936 3:29834182-29834204 TCCCTTTACCATTTCTTGTAAGG - Intronic
952099923 3:29999082-29999104 TTCTTTGCCCACTTTTTGATGGG - Intronic
952194289 3:31056683-31056705 TCCCTTGCCCACTTTTTGATGGG + Intergenic
952511391 3:34060412-34060434 TCCCTTGACCACTTTTTGATGGG - Intergenic
952522195 3:34172635-34172657 TTCTTTGCCCACTTTTTGATGGG + Intergenic
952613322 3:35237938-35237960 TTCCTTCACCTCTTTCTGACAGG - Intergenic
953132707 3:40155813-40155835 TCCTTTGACCACTTTTTGATGGG + Intronic
953193044 3:40707230-40707252 TTCGTTTAACATTTCTTGAAAGG + Intergenic
953866964 3:46592505-46592527 GTCCTTACCCACTTTTTGATGGG - Intronic
954230919 3:49216807-49216829 TTCTTTGCCCACTTTTTGATGGG - Intronic
954563060 3:51574667-51574689 TCCTTTAACCACTTTTTGATGGG + Intronic
954572416 3:51653099-51653121 TCCTTTAACCACTTTTTGATGGG - Intronic
954591333 3:51786145-51786167 TTCCTTTACCCATTCTTAAAGGG + Intergenic
954840099 3:53503953-53503975 TTCCTTTCCCACTGTGGGAAGGG + Intronic
955105337 3:55892349-55892371 TTTCTTTTCTACTTTTTGTAGGG - Intronic
955168923 3:56543959-56543981 ATCTTTTCCCACTTTTTGATGGG - Intergenic
955211971 3:56950450-56950472 ATCTTTTCCCACTTTTTGATGGG - Intronic
955213384 3:56962681-56962703 TTTCTTTCCCACCTTTTGTAAGG - Intronic
955528470 3:59846732-59846754 TCCCTTTAGCATTTCTTGAAGGG + Intronic
955652051 3:61205643-61205665 TCCTTTTCCCACTTTTTGATGGG + Intronic
955759659 3:62265111-62265133 ATCCTTTACCATTTTTTAACTGG + Intronic
956096179 3:65718901-65718923 TTCTTTTAGTGCTTTTTGAAAGG - Intronic
956333075 3:68132697-68132719 TTCTTTGCCCACTTTTTGATGGG + Intronic
956769392 3:72511867-72511889 TTCGTTTTCTACTTTTTGCAGGG - Intergenic
957172152 3:76751610-76751632 TTCTTTGCCCACTTTTTGATGGG - Intronic
957422989 3:79995810-79995832 TTCCTTTACCACCCTTTTATAGG - Intergenic
957481410 3:80801698-80801720 GTCTTTTACCCATTTTTGAATGG - Intergenic
957534761 3:81487367-81487389 TTCTTTGCCCACTTTTTGATGGG + Intergenic
957598601 3:82301878-82301900 TTCCTTGTCGACTTTATGAAGGG + Intergenic
957749347 3:84392060-84392082 TTCTTTGCCCACTTTTTGATGGG + Intergenic
958013235 3:87907350-87907372 TTCTTAGCCCACTTTTTGAAGGG + Intergenic
958024388 3:88033541-88033563 TTCCTTTAGGTCTGTTTGAATGG - Intergenic
958127058 3:89369826-89369848 TCCTTTTCCCACTTTTTGATGGG - Intronic
958410138 3:93806268-93806290 TCCTTTTCCCACTTTTTGATGGG + Intergenic
958443600 3:94187097-94187119 TTCCTTTACTACTTTTCTATTGG + Intergenic
958597730 3:96251194-96251216 TTCTTTGCCCACTTTTTGATGGG + Intergenic
959007291 3:101034738-101034760 TCCCTTTCCCACTTTTTAATGGG - Intergenic
959101396 3:102013514-102013536 TCCTTTTCCCACTTTTTGATGGG - Intergenic
959218054 3:103478975-103478997 TCCTTTGTCCACTTTTTGAAGGG + Intergenic
959271817 3:104221261-104221283 TCCTTTGACCACTTTTTGACGGG + Intergenic
959502015 3:107117476-107117498 TTCCTTTTAGACTTTTTGTATGG - Intergenic
959508907 3:107187578-107187600 TTCCTTTATCAGTTTTTAAATGG - Intergenic
959736948 3:109670106-109670128 TCCTTTGCCCACTTTTTGAAGGG - Intergenic
959801466 3:110500359-110500381 TTCTTTGCCCACTTTTTGATGGG - Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
959987545 3:112592573-112592595 TTCCTTTAGCACTTCTTACAGGG + Intergenic
960019848 3:112936625-112936647 TTCCTTACCCACTTTTTAATGGG + Intronic
960361737 3:116720513-116720535 ATCATTTTCCACTTCTTGAAGGG + Intronic
960481445 3:118196135-118196157 TTCCTTTATCACTTTTTCAAAGG + Intergenic
960630417 3:119725164-119725186 TTCCTTTACCTGCTTTTGCAAGG + Intronic
960852680 3:122072551-122072573 TCCCTTGCCCACTTTTTGATGGG + Intronic
961031851 3:123612797-123612819 TTTCTTTTCCACTGTTTGTAAGG - Exonic
961690431 3:128665611-128665633 TTCCTTTACCACTTAAAGACAGG + Intronic
962059846 3:131914190-131914212 TTGCTTTACCACTTTGTGGCTGG - Intronic
962157270 3:132961205-132961227 TCCTTTGCCCACTTTTTGAAGGG - Intergenic
962158492 3:132974539-132974561 TTCCTTGACCTCTCTTTTAAGGG - Intergenic
962340541 3:134578734-134578756 TTCTTTCCCCACTTTTTGATGGG + Intergenic
962634355 3:137315060-137315082 TTCTTTGCCCACTTTTTGATGGG + Intergenic
962717796 3:138142375-138142397 TTCTTTGCCCACTTTTTGATGGG - Intergenic
963050229 3:141136164-141136186 TCCTTTGCCCACTTTTTGAAGGG + Intronic
963387463 3:144615434-144615456 TCCTTTGACCACTTTTTGATGGG + Intergenic
963459864 3:145597846-145597868 TTCCTTTAGCATTTCTTGTAAGG + Intergenic
963647605 3:147935528-147935550 TTCTTTTATTACTGTTTGAATGG + Intergenic
964130929 3:153285561-153285583 TTCCTTGATCATATTTTGAAAGG + Intergenic
964280361 3:155057266-155057288 TTCTTTGCCCACTTTTTGATGGG - Intronic
964332141 3:155615104-155615126 GTCCTTACCCACTTTTTGATAGG - Intronic
964350694 3:155800749-155800771 CTCTTTTGCCCCTTTTTGAATGG - Intronic
964358162 3:155869476-155869498 TTCGCTTACCTTTTTTTGAACGG - Intergenic
964392727 3:156214157-156214179 TTACTTTACCAGTTTATTAAAGG - Intronic
964552655 3:157901999-157902021 TCCTTTGCCCACTTTTTGAAGGG - Intergenic
964560881 3:157994752-157994774 TTCTTTGCCCACTTTTTGATGGG - Intergenic
964831732 3:160891304-160891326 TTCTTTGCCCACTTTTTGATGGG - Intronic
965618196 3:170616131-170616153 TCCTTTTCCCACTTTTTGATGGG + Intronic
965693126 3:171378957-171378979 TTCCAGGTCCACTTTTTGAAAGG - Intronic
965828526 3:172754973-172754995 TTCCTTTACCACTTTATAAATGG + Intronic
966270180 3:178095582-178095604 GTCCTTTGCCACTTTTTTATGGG - Intergenic
966308485 3:178565265-178565287 TTCCTTTCCATCTTTTTTAATGG - Intronic
966392933 3:179472137-179472159 TTTCTTTACCTCTCTTTGAAAGG - Intergenic
966616160 3:181915035-181915057 TTCAAATATCACTTTTTGAATGG + Intergenic
966637415 3:182151243-182151265 TCCCTTGCCCACTTTTTGATGGG + Intergenic
967203722 3:187100175-187100197 CCCTTTTCCCACTTTTTGAAGGG - Intergenic
967318817 3:188175768-188175790 CTCCTTTTCCAATTTTTAAAAGG + Intronic
967331158 3:188291016-188291038 TTGGCATACCACTTTTTGAAAGG + Intronic
967382739 3:188878253-188878275 TTCCATTATCAAGTTTTGAAGGG + Exonic
967551304 3:190798688-190798710 TTCCTTTAGCATTTCTTGTAGGG - Intergenic
967654356 3:192028802-192028824 TTCCTTTAACATTTCTTGCAAGG - Intergenic
968400031 4:286074-286096 TTCCTTCAGCACTTTTTGTCAGG - Intronic
970283728 4:14485983-14486005 TCCTTTGACCACTTTTTGATGGG - Intergenic
970357152 4:15267120-15267142 TTCTTTGCCCACTTTTTAAAAGG + Intergenic
970412561 4:15823493-15823515 TTCTTTGCCCACTTTTTGATGGG - Intronic
970605249 4:17674011-17674033 TTCCTTTAGCATTTCTTGTAAGG - Intronic
970864588 4:20743932-20743954 TCCTTTGCCCACTTTTTGAAGGG - Intronic
970884164 4:20968096-20968118 TCCTTTGACCACTTTTTGATGGG - Intronic
970907995 4:21239545-21239567 ATCCTTCCCCACTTTTTGATGGG - Intronic
971016701 4:22496443-22496465 TTATTTTACCACATTTTCAATGG + Intronic
971036387 4:22697465-22697487 TTCTTTTTCCAATTTTTTAAGGG - Intergenic
971686720 4:29779017-29779039 TTCCTAAACCACTTTGTGGAAGG + Intergenic
971771847 4:30907420-30907442 TTCTTTGCCCACTTTTTGATGGG - Intronic
971863927 4:32144288-32144310 TTCTTTGCCCACTTTTTGATAGG - Intergenic
971869101 4:32212637-32212659 AACCTTTACCTCTTGTTGAAAGG - Intergenic
971970274 4:33610552-33610574 TTCCTTGCCCACTTTTTAATGGG - Intergenic
972032121 4:34475059-34475081 TTCTTTGTCCACTTTTTGATGGG - Intergenic
972165514 4:36279299-36279321 TTCATTTACCACTTATTTACTGG + Intergenic
972207981 4:36800655-36800677 TTCCTTTAGCATTTCTTGTAGGG - Intergenic
972261521 4:37413291-37413313 ATCCTTTGCCACTTTTTGATGGG - Intronic
972887776 4:43513534-43513556 GTCCTTCACCACTTTTTGATGGG + Intergenic
972892561 4:43576744-43576766 TCCCTTGCCCACTTTTTGATGGG - Intergenic
973018231 4:45168001-45168023 TTCTTTGCCCACTTTTTGATGGG + Intergenic
973031555 4:45348297-45348319 TCCTTTGACCACTTTTTGATAGG - Intergenic
973081398 4:45998138-45998160 TCCTTTGGCCACTTTTTGAAGGG + Intergenic
973956021 4:56064167-56064189 GTCCTTCACCCATTTTTGAATGG + Intergenic
974181502 4:58389395-58389417 GTCCTTTGCCACTTTTTGATGGG + Intergenic
974352512 4:60767808-60767830 TTCCAGTACCATTTATTGAAGGG + Intergenic
975051779 4:69874168-69874190 TACCTTTAATACTTTCTGAAAGG + Intergenic
975252536 4:72196885-72196907 TCCTTTGCCCACTTTTTGAAGGG + Intergenic
975291645 4:72684599-72684621 TCCATTGACCACTTTTTGATGGG - Intergenic
975354890 4:73390376-73390398 ATTCTTTCCCACTTTTTGATGGG + Intergenic
975753073 4:77544567-77544589 TTCTTTGCCCACTTTTTGATGGG + Intronic
975922833 4:79413496-79413518 TTCTTTCCTCACTTTTTGAAAGG + Intergenic
976071097 4:81240756-81240778 TTCTTTGCCCACTTTTTGATGGG - Intergenic
976079895 4:81344464-81344486 TCCTTTTCCCACTTTTTGAGGGG - Intergenic
976093270 4:81479262-81479284 TTCTTTGCCCACTTTTTGATGGG - Intronic
976347223 4:84018400-84018422 TTCCCTTATCTCTTCTTGAAAGG - Intergenic
976379141 4:84379562-84379584 TTCCTTTCCCACTCTTTGGAAGG - Intergenic
976511615 4:85916237-85916259 GTCCTTCACCACTTTTTGGTGGG + Intronic
976545282 4:86328172-86328194 ATCCTTTGCCACTTTTTGATGGG - Intronic
976562282 4:86515657-86515679 TTCTTTGCCCACTTTTTGATGGG + Intronic
976760537 4:88544240-88544262 TTCTTCGTCCACTTTTTGAAGGG - Intronic
977002560 4:91521701-91521723 TTCTTTGCCCACTTTTTGATGGG + Intronic
977478451 4:97542289-97542311 ATCCTTTGCCACTTTTTGATGGG - Intronic
977637261 4:99313878-99313900 TTCCTTTAGCACTTCCTGAATGG + Exonic
977639674 4:99342852-99342874 TTCCTTTAGCACTTCCTGAATGG + Exonic
977655289 4:99514424-99514446 TTACTTGCCCACTTTTTGATGGG - Intronic
977753665 4:100639258-100639280 TTCCTTTTCTTTTTTTTGAATGG - Intronic
977767946 4:100823157-100823179 TGCCTTTATGCCTTTTTGAAAGG + Intronic
977825906 4:101531276-101531298 TCCTTTTCCCACTTTTTGATGGG + Intronic
977946041 4:102915226-102915248 TCCCTTTAACATTTTTTGTAAGG - Intronic
978007121 4:103630500-103630522 TCCCTTGCCCACTTTTTGATGGG - Intronic
978019720 4:103792573-103792595 TCCTTTTCCCACTTTTTGAATGG - Intergenic
978243023 4:106539276-106539298 TTCCTTTAGGACCTCTTGAAGGG + Intergenic
978260862 4:106757024-106757046 TCCCTTTAGCAGTTTTTGTAAGG - Intergenic
978391323 4:108228548-108228570 TTCTTTGACCATTTTTTAAATGG + Intergenic
978476717 4:109139152-109139174 TCCTTTGCCCACTTTTTGAAGGG + Intronic
978722522 4:111928329-111928351 ATCCTTTGCCAATTTTTTAATGG + Intergenic
978763270 4:112378551-112378573 TTCTTTAACCAATTTTTGAGAGG + Intronic
978900194 4:113939732-113939754 TCCCTTGCCCACTTTTTGATGGG + Intronic
978934361 4:114357453-114357475 TCCCTTTAGCACTTTTTGTAAGG + Intergenic
978948099 4:114523372-114523394 TTCTTTGCCCACTTTTTGATGGG + Intergenic
979044149 4:115839553-115839575 TTCTTTGCCCACTTTTTGATAGG - Intergenic
979272377 4:118777931-118777953 ATCCTTTGCCACTTTTTGATGGG + Intronic
979365028 4:119812060-119812082 TTCCTTTAGCATTTCTTGCAAGG + Intergenic
979750219 4:124270189-124270211 AGCCTTTGCCACTTTTTGATGGG + Intergenic
979896850 4:126169195-126169217 TCCTTTGCCCACTTTTTGAAGGG - Intergenic
980017291 4:127665496-127665518 TTCTTTTACCTCTTCCTGAAAGG + Intronic
980392479 4:132164695-132164717 TTATTTGCCCACTTTTTGAAGGG + Intergenic
980746860 4:137029422-137029444 TTCCTTGCCTACTTTTTTAATGG + Intergenic
980756630 4:137172892-137172914 TCCTTTGACCACTTTTTGATGGG - Intergenic
980904856 4:138938299-138938321 TTCCTTTAACGAGTTTTGAAGGG + Intergenic
981222997 4:142258523-142258545 TTCTTTGCCCACTTTTTGATGGG - Intronic
981265936 4:142783334-142783356 TCCTTTGCCCACTTTTTGAAGGG - Intronic
981278671 4:142931782-142931804 TCCTTTGCCCACTTTTTGAAGGG - Intergenic
981287897 4:143041773-143041795 TTCCTTTGCCCATTTTTTAATGG - Intergenic
981402319 4:144327782-144327804 GTCCTTTACCCATTTTTTAATGG - Intergenic
981478221 4:145209627-145209649 TTCTTCTTCCACATTTTGAAGGG + Intergenic
981496810 4:145402957-145402979 ATCCATTGCCACTTTTTGATGGG - Intergenic
981619638 4:146679792-146679814 ATCCTTTGCCCCTTTTTGATGGG - Intergenic
981901825 4:149874418-149874440 TTCCAGAACCACTTATTGAAAGG + Intergenic
981910289 4:149971829-149971851 TTCCAACACCATTTTTTGAAAGG - Intergenic
982295789 4:153827534-153827556 TCCTTTTCCCACTTTTTGATGGG - Intergenic
982686882 4:158501147-158501169 TTTCTCTCCCACTTTTTGATGGG + Intronic
982747164 4:159116252-159116274 TCCTTTGCCCACTTTTTGAAGGG - Intronic
982799757 4:159689792-159689814 TTCCTTTAACATTTCTTGCAGGG - Intergenic
982879387 4:160692265-160692287 GTCCTTTGCCTCTTTTTCAATGG - Intergenic
982970146 4:161974922-161974944 TCCTTTGCCCACTTTTTGAAGGG - Intronic
983016337 4:162617818-162617840 TTCTTTGCCCACTTTTTGATGGG - Intergenic
983397250 4:167215379-167215401 TCCCTGAAGCACTTTTTGAAAGG - Intronic
983496417 4:168447201-168447223 TTCTTTGCCCACTTTTTGATGGG - Intronic
983501614 4:168506030-168506052 TTCCTTGACCATATTTTCAATGG + Intronic
983665609 4:170178646-170178668 TTCCTTTAGCATTTCTTGTAGGG + Intergenic
983965831 4:173808789-173808811 TGCCATTACTACCTTTTGAAGGG + Intergenic
984032810 4:174625797-174625819 TCCATTGCCCACTTTTTGAAGGG + Intergenic
984372878 4:178889250-178889272 ATCCTTGCCCACTTTTTGATGGG - Intergenic
984619133 4:181932334-181932356 TTCTTTGTCCACTTTTTGATGGG - Intergenic
984953934 4:185026885-185026907 TCCCTTGCCCACTTTTTGATGGG - Intergenic
985076616 4:186222804-186222826 TCCCTTTAGCATTTTTTGTAAGG + Intronic
985078099 4:186238078-186238100 TTCCTTTACCCCTTTGCGAGGGG + Intronic
985248651 4:188001219-188001241 TACCTTTGCCTCTTTTTTAAAGG + Intronic
985332879 4:188859771-188859793 TTCTTTGACCACTTTTTGATGGG + Intergenic
985353077 4:189087501-189087523 TTCTTTTACCATTTTTAGTATGG - Intergenic
985428123 4:189850284-189850306 TTCCTTAACCAGCTTTTAAAAGG - Intergenic
986141049 5:5030362-5030384 TTCTTTGCCCACTTTTTGATGGG - Intergenic
986239681 5:5949352-5949374 TTCCTTTAGTATTTTTTGGAAGG + Intergenic
986341930 5:6796653-6796675 TTCCATTACCACCCATTGAATGG + Intergenic
986373626 5:7107236-7107258 ATCCTTGCCCACTTTTTGATGGG + Intergenic
986620845 5:9672453-9672475 GTCCTTGCCCACTTTTTGATGGG - Intronic
986650686 5:9960609-9960631 ATTCTTTGCCACTTTTTGATAGG + Intergenic
986838340 5:11667586-11667608 ATCCTTGCCCACTTTTTGATGGG + Intronic
986900425 5:12424494-12424516 TTCCTTCACCAGTTTTTACATGG - Intergenic
987233426 5:15918541-15918563 TTCCTTTAGCTCTTCTAGAAGGG - Intronic
987616497 5:20281028-20281050 TCCTTTTCCCACTTTTTGATGGG + Intronic
987902272 5:24028278-24028300 TTCTTTTCCCTCTTTTTGATAGG - Intronic
987902377 5:24029510-24029532 TCCTTTTCCCACTTTTTGATGGG + Intronic
988411850 5:30896021-30896043 CTCCTTTACTTCTTTTGGAAGGG - Intergenic
988412524 5:30905406-30905428 TTCTTTGCCCACTTTTTGATGGG - Intergenic
988465357 5:31485686-31485708 TTTCTTTAATTCTTTTTGAAAGG + Intronic
988575268 5:32416876-32416898 TTCCTTTAATTATTTTTGAAGGG - Intronic
988934992 5:36072869-36072891 GTCCTTTCCCACTTTTTAATTGG + Intergenic
989302091 5:39907039-39907061 TTACTTAATCACTTCTTGAATGG - Intergenic
989336136 5:40319285-40319307 TTCCTTTCCCACATTTAGCATGG - Intergenic
989682334 5:44044258-44044280 GTCCTTTGCCACTTTTTGATGGG - Intergenic
989740050 5:44760224-44760246 TTCTTTGCCCACTTTTTGATGGG - Intergenic
989985578 5:50693183-50693205 TTCCCCTACCAATTTTTAAATGG + Intronic
990067837 5:51740166-51740188 TGCCTTTGCCAGCTTTTGAATGG + Intergenic
990100264 5:52176085-52176107 TTCAATCACCACATTTTGAAAGG + Intergenic
990733965 5:58839778-58839800 TTCCTTGAACACTTCTTGTAAGG + Intronic
990832069 5:59970527-59970549 GTCCTTCACCACTTTTTGATGGG - Intronic
991005688 5:61825835-61825857 TTTAGTTTCCACTTTTTGAAGGG + Intergenic
991273903 5:64820689-64820711 TTCCAGTACCATTTGTTGAAAGG - Intronic
991576376 5:68107895-68107917 TCCCTTGCCCACTTTTTGATGGG - Intergenic
991626280 5:68604416-68604438 TTCCTATACCATTTTTGGAATGG - Intergenic
992260703 5:74967390-74967412 TTCTTTTCCCACTTCTTTAATGG + Intergenic
992276334 5:75124106-75124128 GTCCTTTGCCAGTTTTTTAATGG - Intronic
992337747 5:75790555-75790577 TTCATTGCCCACTTTTTAAAGGG + Intergenic
993266152 5:85729339-85729361 TCCTTTGACCACTTTTTGATGGG + Intergenic
993474773 5:88350993-88351015 TTCTTTGCCCACTTTTTGATGGG - Intergenic
993537066 5:89099570-89099592 TCCTTTTCCCACTTTTTGATTGG + Intergenic
993586854 5:89742031-89742053 TCCTTTTCCCACTTTTTGATGGG + Intergenic
993598834 5:89893908-89893930 TCCCTTTAGCATTTTTTGGAAGG - Intergenic
993648954 5:90494707-90494729 ATCCTTTACCTCTTTTTAATTGG + Intronic
993673069 5:90785571-90785593 TCCTTTGACCACTTTTTGATGGG - Intronic
993840618 5:92874417-92874439 TCCCTTAAGCACTTTTTGTAAGG + Intergenic
994188606 5:96842610-96842632 TTCTTTGCCCACTTTTTGATGGG + Intronic
994317653 5:98350968-98350990 TCCCTTTACCATTTTTTGTGAGG - Intergenic
994408094 5:99371216-99371238 TTCCTGTACAAGTTTTTGAGGGG - Intergenic
994500088 5:100564461-100564483 TTCTTTTGCCACTTTCTGAAAGG - Intronic
994597192 5:101854437-101854459 TTCTTTGCCCACTTTTTGATGGG - Intergenic
994623225 5:102187917-102187939 TTCTTTGCCCACTTTTTGATGGG + Intergenic
994645412 5:102463088-102463110 TTCTTTGCCCACTTTTTGATGGG - Intronic
994680638 5:102882544-102882566 GTCCTTAGCCACTTTTTGATGGG + Intronic
994685825 5:102950611-102950633 CTCCTTTACCCCTTTTTTGAGGG - Intronic
994710846 5:103261891-103261913 TTTATTTACCAATATTTGAAAGG + Intronic
994858109 5:105151882-105151904 TTCTTTTAACATTTTTTGAAAGG + Intergenic
994871676 5:105359098-105359120 TACCTTCAGCATTTTTTGAAGGG - Intergenic
994922958 5:106074798-106074820 TTCCTCGCCCACTTTTTGATGGG - Intergenic
995262784 5:110124732-110124754 GTGCTTTGCCACTTTTTGATGGG + Intergenic
995289839 5:110439236-110439258 TTCCTTGGCTACTTTTTAAAGGG + Intronic
995302301 5:110598179-110598201 TTCTTTGCCCACTTTTTGATGGG - Intronic
995382986 5:111555683-111555705 ATCCTTTGCCCATTTTTGAATGG + Intergenic
995464887 5:112441287-112441309 TCCTTTGCCCACTTTTTGAAGGG - Intergenic
995580423 5:113594623-113594645 TTCCTTAGAGACTTTTTGAAGGG + Exonic
995587984 5:113669190-113669212 GTCCTTTGCCCCTTTTTGATGGG - Intergenic
995607935 5:113878393-113878415 GTCCTTTGCCCATTTTTGAATGG + Intergenic
995812344 5:116121802-116121824 TCCTTTGCCCACTTTTTGAATGG + Intronic
995947274 5:117663722-117663744 TTCTTTGCCCACTTTTTGATGGG - Intergenic
996100874 5:119444357-119444379 TTCTTTGACCACTTTTTGATGGG - Intergenic
996539912 5:124619515-124619537 TTCCTAGACCACTTATTTAAAGG - Intergenic
996684224 5:126262868-126262890 TCCCTGTACCATTTATTGAAAGG - Intergenic
996865958 5:128122105-128122127 TTCCTCAACCACTTTTTGCTTGG + Intronic
996878602 5:128267642-128267664 TCCTTTTCCCACTTTTTGATAGG + Intronic
996952784 5:129147997-129148019 ATCCTTTGCCACCTTTTGATGGG + Intergenic
997081060 5:130738710-130738732 TTCCTTTAGTACTTCTTGTAAGG - Intergenic
997971895 5:138410446-138410468 TTCCAGTACCATTTGTTGAAAGG - Intronic
998211200 5:140199943-140199965 TTCTTTGCCCACTTTTTGATGGG + Intronic
998480767 5:142460780-142460802 TTCAGCTACCACTTTGTGAATGG + Intergenic
998541486 5:142986328-142986350 TTCTTTGCCCACTTTTTGATGGG + Intronic
998650525 5:144115568-144115590 TTCATTTACAAGTTTTTGTATGG - Intergenic
998731970 5:145088848-145088870 TTCTTTGCCCACTTTTTGATGGG + Intergenic
998752199 5:145334641-145334663 TTCCTTCAGCACTTTTTGTAAGG + Intergenic
998779662 5:145642336-145642358 TCCTTTGCCCACTTTTTGAAGGG + Intronic
998809729 5:145954377-145954399 TTCCTTGCCCACTTTTTAATAGG + Intronic
998865393 5:146495096-146495118 TTGATTTTCCACTTTTTAAAAGG + Intronic
999034038 5:148327330-148327352 TCCCTTGCCCACTTTTTGATGGG + Intronic
999549070 5:152664102-152664124 TTCCTTTAGCATTTCTTGTAAGG - Intergenic
999558504 5:152772949-152772971 TCCTTTGACCACTTTTTGATGGG - Intergenic
999669074 5:153942785-153942807 TTCTTTGCCCACTTTTTGATGGG - Intergenic
999800882 5:155034576-155034598 TTCCATCACCATTTGTTGAAAGG + Intergenic
1000271199 5:159684908-159684930 TCCCTTGCCCACTTTTTGATGGG + Intergenic
1000403910 5:160865736-160865758 GTCCTTTGCCATTTTTTGATGGG - Intergenic
1000584369 5:163078485-163078507 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1000735561 5:164894728-164894750 TTCCTTTACCTCTCTTCCAAAGG + Intergenic
1000774858 5:165406987-165407009 TTCTTTGCCCACTTTTTGATAGG + Intergenic
1002438302 5:179247858-179247880 TTTCTTTAACACTTATTGGAGGG - Intronic
1003064014 6:2887187-2887209 TTATTTTACTACTTTATGAATGG + Intergenic
1003165400 6:3673016-3673038 TCCCTTGCCCACTTTTTGATGGG + Intergenic
1003215942 6:4112192-4112214 TTCCTTTAACATTTCTTGTAGGG + Intronic
1003249872 6:4417052-4417074 TTCCTTTACTACCTCTTTAAAGG + Intergenic
1003472140 6:6446695-6446717 TCCCTTGTCCACTTTTTGATGGG - Intergenic
1003510704 6:6777712-6777734 ATCCTTTGCCACTTTTTGATGGG - Intergenic
1003542493 6:7030655-7030677 ATTCTTTGCCACTTTTTGATGGG - Intergenic
1003744342 6:8982839-8982861 TTTCTTTGCCAAGTTTTGAATGG + Intergenic
1004068181 6:12271727-12271749 TTCCTTAAACATTTTTTGTAAGG + Intergenic
1004549548 6:16633383-16633405 TTTCTTTTCCAGTTTTGGAAGGG + Intronic
1005067103 6:21829144-21829166 TTCCTTTTCCATTCTTTGATTGG + Intergenic
1005259061 6:24037697-24037719 TCCCTTGCCCACTTTTTGAAGGG + Intergenic
1005570293 6:27138972-27138994 TTCCTTTAACATTATTTGTATGG - Exonic
1006061151 6:31420348-31420370 GTCCATTACCCATTTTTGAATGG + Intergenic
1006842826 6:37041037-37041059 TTCCTTTTCCTCTTTCTCAATGG - Intergenic
1006890655 6:37424856-37424878 TTCCTTGAGCATTTCTTGAAGGG + Intergenic
1007844969 6:44746443-44746465 ATCCTTCACCACTTTTTGATGGG + Intergenic
1008219731 6:48841338-48841360 TTCCCTTACCATTTGCTGAAAGG + Intergenic
1008240227 6:49101197-49101219 TCTTTTTCCCACTTTTTGAAGGG - Intergenic
1008287578 6:49672641-49672663 TACTTTTCCCACTTTTTGATGGG - Intergenic
1008436381 6:51481186-51481208 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1009034788 6:58103548-58103570 TTCTTTTAACATTTCTTGAAGGG - Intergenic
1009037356 6:58133810-58133832 TTCCTTTACTACATTTCAAAAGG - Intergenic
1009213149 6:60887432-60887454 TTCCTTTACTACATTTCAAAAGG - Intergenic
1009226195 6:61022203-61022225 TCCTTTGCCCACTTTTTGAAGGG + Intergenic
1009229784 6:61048224-61048246 TCCTTTGCCCACTTTTTGAAGGG + Intergenic
1009233713 6:61096992-61097014 TCCTTTGCCCACTTTTTGAAGGG - Intergenic
1009247086 6:61251802-61251824 ATCCTTTACCCACTTTTGAATGG - Intergenic
1009247298 6:61254716-61254738 TCCTTTTACCACTTTGTAAAAGG - Intergenic
1009432960 6:63586908-63586930 TCCCTTGCCCACTTTTTGATGGG - Intergenic
1009433209 6:63589147-63589169 TACCTTGCCCACCTTTTGAAGGG - Intergenic
1009467662 6:63992074-63992096 TTCCTTTAGCATTTCTTGTAAGG - Intronic
1009558549 6:65207786-65207808 TTCCATCACCATTTTTTAAATGG - Intronic
1009621912 6:66088187-66088209 TTCCTTTGCCAGTTTTTCACTGG - Intergenic
1010265716 6:73863680-73863702 ATCCATTGCCACTTTTTGACTGG - Intergenic
1010295341 6:74189571-74189593 TCCCTTGCCCACTTTTTGATGGG + Intergenic
1010382457 6:75240763-75240785 TCCCTTCCCCACTTTTTTAAGGG - Intronic
1010476990 6:76299837-76299859 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1010615136 6:78003429-78003451 TTCCCATACCACTATTTGACAGG + Intergenic
1010796310 6:80120683-80120705 TTCTTTGCCCACTTTTTGATGGG + Intronic
1011204802 6:84880036-84880058 ATCTTTGCCCACTTTTTGAAGGG + Intergenic
1011314203 6:86013334-86013356 GTCCTTTGCCACTTTTTAAGGGG + Intergenic
1011366571 6:86588631-86588653 TTCATTTACCTCTTTTTGTTAGG - Intergenic
1012042270 6:94223339-94223361 TTCTTTTCCCACTTTTTAATGGG + Intergenic
1012098479 6:94997687-94997709 TTCCTTTACCATTTCTTATAGGG + Intergenic
1012166116 6:95954714-95954736 GTCCTTTTCCACTTTTTAATAGG + Intergenic
1012406553 6:98906992-98907014 TTCTTTGCCCACTTTTTGATGGG + Intronic
1012489658 6:99767560-99767582 TTCTATTACCATTTGTTGAAAGG + Intergenic
1012512499 6:100019684-100019706 TTCCAGAACCACTTATTGAAGGG - Intergenic
1012601241 6:101099731-101099753 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1012714688 6:102653171-102653193 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1012813126 6:103986055-103986077 ATCCTTTACCCATTTTTAAAAGG - Intergenic
1012818663 6:104057127-104057149 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1013241020 6:108245773-108245795 TCCTTTGCCCACTTTTTGAAGGG + Intronic
1013397111 6:109752660-109752682 TCCTTTTCCCACTTTTTGATGGG + Intronic
1013930196 6:115521408-115521430 TCCTTTTCCCACTTTTTGATGGG - Intergenic
1014246380 6:119074220-119074242 TTCCTTGACCAACTTTGGAAGGG + Intronic
1014279319 6:119423253-119423275 ATCCTTACCCACTTTTTGATGGG - Intergenic
1014353082 6:120368177-120368199 TCCCTTGTCCACTTTTTGATGGG - Intergenic
1014561147 6:122892284-122892306 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1014884200 6:126759729-126759751 TTTATTTACCATTTTTTCAATGG + Intergenic
1014973524 6:127848746-127848768 TCCCTTGCCCACTTTTTGATGGG + Intronic
1015212769 6:130716972-130716994 TTCCTATCCCTCTTTTTAAAGGG - Intergenic
1015585830 6:134775438-134775460 TTACTTTACCACAATTTTAATGG - Intergenic
1015681515 6:135813771-135813793 TTTCTTTAACACTTTTTTCATGG - Intergenic
1016018367 6:139210028-139210050 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1016148287 6:140703509-140703531 GTTCTTTAACACTTTTTGAGAGG + Intergenic
1016265661 6:142230196-142230218 TACTTTTCCCACTTTTTGATGGG + Intergenic
1016462676 6:144294517-144294539 TTGCTTTTCCATTTTTTAAAAGG + Intronic
1016609353 6:145970941-145970963 TCCTTTGACCACTTTTTGATGGG + Intergenic
1017144612 6:151223112-151223134 TTCCAACACCATTTTTTGAAAGG + Intergenic
1017224916 6:152009760-152009782 TTTATTTACAAGTTTTTGAATGG - Intronic
1017438549 6:154441222-154441244 TTGCTTTTCCTCTTCTTGAAAGG - Intronic
1017571780 6:155752830-155752852 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1018509881 6:164513756-164513778 TCCTTTGCCCACTTTTTGAAGGG + Intergenic
1019073557 6:169369111-169369133 TTCATTTAACACTTACTGAAGGG - Intergenic
1019865050 7:3700185-3700207 TTCCTTTACCTGTTCTTTAAGGG - Intronic
1020348935 7:7196885-7196907 TCCTTTTCCCACTTTTTGATGGG + Intronic
1020675199 7:11175131-11175153 TTCCTCTAATATTTTTTGAAAGG + Intergenic
1020738140 7:11977790-11977812 TTCCTTTAGCACTTTTTTGTAGG - Intergenic
1020822042 7:12982424-12982446 TTACTTTAATACTTGTTGAAGGG + Intergenic
1020980636 7:15063964-15063986 ATCCTTGGCCACTTTTTGATGGG + Intergenic
1021012031 7:15481640-15481662 TTCTTTTATCAGTTTTTGAGAGG - Intronic
1021213870 7:17891184-17891206 TTTCTTTTCCATTTTTTAAAAGG + Intronic
1021801444 7:24310848-24310870 CTCCATTCCCACTCTTTGAAGGG - Intergenic
1021967122 7:25930746-25930768 TTCCTTAACGCCTTATTGAATGG - Intergenic
1022423846 7:30248735-30248757 TTCTTTTACCTCTTTTTTCAGGG - Intergenic
1022435624 7:30381500-30381522 TTCTTTGCCCACTTTTTGATGGG + Intronic
1022634031 7:32114784-32114806 TTCTTTGCCCACTTTTTGATGGG - Intronic
1022995030 7:35746708-35746730 TTCCTTTAATACTTTTTGCATGG - Intergenic
1023662813 7:42488211-42488233 TTCACTTACAAGTTTTTGAAAGG + Intergenic
1023666636 7:42529372-42529394 TCCTTTTCCCACTTTTTGATGGG - Intergenic
1023762314 7:43477556-43477578 GTCCTCTACCAATTTTTCAAGGG + Intronic
1024013293 7:45288882-45288904 TTCCTTGACATATTTTTGAATGG - Intergenic
1024296703 7:47849516-47849538 GTCCTTGCCCACTTTTTGATGGG - Intronic
1024316448 7:48022989-48023011 TCCCTTTAGCACTTCCTGAAGGG - Intronic
1024456104 7:49609005-49609027 ATCCTTTACCTATTTTTTAATGG + Intergenic
1024708662 7:51990052-51990074 TTCCTTACCCACTTTTTGATGGG + Intergenic
1024714930 7:52068121-52068143 TTCATCTACCATTTGTTGAAAGG - Intergenic
1024744918 7:52394953-52394975 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1024820902 7:53328702-53328724 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1024992071 7:55242872-55242894 TTCCTTTTCCACTTTTCCATTGG + Intronic
1025502625 7:61323843-61323865 TTCTTTGCCCACTTTTTGATAGG - Intergenic
1025517493 7:61670065-61670087 TTCTTTGCCCACTTTTTGATAGG - Intergenic
1025541818 7:62098715-62098737 TTCTTTGCCCACTTTTTGATAGG - Intergenic
1025570244 7:62553198-62553220 TTCCTCGCCCACTTTTTGATGGG - Intergenic
1025828456 7:65030046-65030068 TTAACTCACCACTTTTTGAATGG + Intergenic
1025863194 7:65353215-65353237 TCCCTTTAGCACTTTTAGTAGGG + Intergenic
1025915979 7:65866477-65866499 TTAACTCACCACTTTTTGAATGG + Intergenic
1026582566 7:71630432-71630454 TTCCTTGACCTCTTTTTGTCTGG + Intronic
1027335079 7:77141739-77141761 ATCCTTTGCCTCTTTTTGATGGG + Intronic
1027380578 7:77604886-77604908 CTCCTTTGCCACTTACTGAACGG + Intronic
1027639742 7:80718300-80718322 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1028049362 7:86162686-86162708 TTCTTTGTCCACTTTTTGACAGG - Intergenic
1028338080 7:89682619-89682641 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1028368550 7:90063764-90063786 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1028379726 7:90185971-90185993 TCCTTTGACCACTTTTTGATGGG - Intronic
1028567739 7:92251352-92251374 TTCCTTTACCATACTCTGAAGGG - Intronic
1028669136 7:93381194-93381216 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1028678094 7:93491576-93491598 TCCTTTTCCCACTTTTTGATGGG - Intronic
1028691586 7:93658860-93658882 TTCTTTGCCCACTTTTTGATGGG + Intronic
1028837224 7:95388260-95388282 TTCTTTGCCCACTTTTTGACGGG - Intronic
1029006603 7:97216513-97216535 TGCCTTTTCCATTTTTTGCAAGG + Intergenic
1029066190 7:97850983-97851005 TCCTTTGCCCACTTTTTGAAGGG + Intergenic
1030040559 7:105446217-105446239 TTCTTTTAACAGTTTTTGCAAGG - Intronic
1030479789 7:110088531-110088553 TTCCTGTAAAACTTTTTAAATGG - Intergenic
1030520770 7:110595191-110595213 TTCCTTTAAAACATTTTAAAAGG - Intergenic
1030669183 7:112316293-112316315 TCCTTTGCCCACTTTTTGAAGGG + Intronic
1030770658 7:113470859-113470881 TCCTTTAACCACTTTTTGATGGG + Intergenic
1031307769 7:120154520-120154542 TCCTTTGCCCACTTTTTGAAGGG + Intergenic
1031444597 7:121835476-121835498 GTCCTTTACCCATTTTTTAATGG + Intergenic
1031610097 7:123816096-123816118 ATACTTTAACACTTTTTGATGGG + Intergenic
1031766859 7:125789619-125789641 TTCATTTAACACTTTATTAATGG - Intergenic
1031859703 7:126964478-126964500 TCCTTTGCCCACTTTTTGAAGGG - Intronic
1031905509 7:127456259-127456281 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1032768873 7:135027611-135027633 TTTTTCCACCACTTTTTGAAGGG + Intronic
1033102436 7:138486160-138486182 TTCTTTGCCCACTTTTTGATGGG + Intronic
1033432020 7:141298178-141298200 TTCTTTGCCCACTTTTTGATGGG + Intronic
1033503905 7:141980905-141980927 TCCTTTTCCCACTTTTTGATGGG + Intronic
1033517573 7:142123776-142123798 TCACTTTATCACTTTTTCAATGG + Intronic
1033736092 7:144223176-144223198 ATCCTTTACCTCTTTTATAAGGG + Intergenic
1033746961 7:144327776-144327798 ATCCTTTACCTCTTTTATAAGGG - Intergenic
1034020005 7:147632145-147632167 CTCTTTTCCCACTTTTTGATGGG - Intronic
1034114713 7:148574221-148574243 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1034402414 7:150872008-150872030 TTCATGTACAACTTTTTGTATGG - Intergenic
1034617067 7:152427425-152427447 CTGCTTTACAACTTTTGGAAAGG + Intronic
1035495998 7:159326624-159326646 CTCCTTTAAAACTTTTTCAAAGG - Intergenic
1035518121 8:253992-254014 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1035710036 8:1706083-1706105 TTCCTTTAGCACTTTGTTTATGG - Exonic
1035860570 8:3023643-3023665 GAAATTTACCACTTTTTGAAGGG - Intronic
1036843424 8:12144482-12144504 GTCTTGTACCAGTTTTTGAAAGG + Intergenic
1037047682 8:14328844-14328866 TTCATTTACCTCTTTTATAAGGG - Intronic
1037064278 8:14557255-14557277 GTCCTTACCCACTTTTTGATGGG + Intronic
1037158984 8:15744086-15744108 TTCCTTTAACATTTTTTAAAAGG + Intronic
1037439555 8:18901686-18901708 TCCCTTGAGCACTTTTTGTAAGG + Intronic
1037531821 8:19783706-19783728 TCCTTTGACCACTTTTTGATAGG - Intergenic
1037923040 8:22821325-22821347 TTCTATTACTACTATTTGAATGG - Intronic
1038368285 8:26960596-26960618 TACCTTTATTACTTCTTGAAAGG - Intergenic
1038593124 8:28859435-28859457 TTCCTTTGCCACTTGTTCAAAGG - Exonic
1039181970 8:34877098-34877120 TTCAGTTACAACTTTTGGAAAGG - Intergenic
1039188033 8:34939265-34939287 TTGCATTACCAATTTTTGACAGG + Intergenic
1039761136 8:40576643-40576665 TTCCTTAAACATTTTTTGTAAGG - Intronic
1040437383 8:47404520-47404542 TCCCTTGCCCACTTTTTGATTGG - Intronic
1040655728 8:49505563-49505585 TCCTTTTCCCACTTTTTGATGGG - Intergenic
1040710809 8:50186697-50186719 TCCTTTTAACACTTTTTGATGGG + Intronic
1040736475 8:50514266-50514288 TTCTTTTTCTAGTTTTTGAATGG + Intronic
1040821303 8:51560951-51560973 GTCCTTTACCCATTTTTAAATGG - Intronic
1041041371 8:53849530-53849552 GTCCTTTCCCACTTTTTAATGGG + Intergenic
1041363373 8:57074913-57074935 TTCCTTGTCCGCTTTTTGATGGG + Intergenic
1041424023 8:57700414-57700436 TTCTTTGCCCACTTTTTGATAGG - Intergenic
1041696568 8:60742491-60742513 GTCCTTGACCACTGTTTGATGGG - Exonic
1042167468 8:65959554-65959576 TCGCTTTCCCCCTTTTTGAAAGG + Intergenic
1042431913 8:68716597-68716619 TTCTTTTACAACCTTTTGATTGG + Intronic
1042465765 8:69128942-69128964 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1042625785 8:70755079-70755101 ATCCTTTGCCACTTTTTGATGGG - Intronic
1042700671 8:71609673-71609695 GTCTTTTGCCACTTTTTAAAAGG - Intergenic
1042778169 8:72458826-72458848 TTCTTTTAACACTTCTTGCAAGG + Intergenic
1042888055 8:73574075-73574097 TTCTTTGCCCACTTTTTGATGGG - Intronic
1043165395 8:76896921-76896943 TTCTTTGACCACTTTTTAACGGG + Intergenic
1043202224 8:77384701-77384723 TTCCTTTAGCCATTTTTTAAGGG - Intergenic
1043216526 8:77597300-77597322 TTCCTTTAACAGTTTTTATAAGG - Intergenic
1043217683 8:77615436-77615458 TTCTTTTAGCAATTTTTAAAGGG - Intergenic
1043505884 8:80901838-80901860 TTTCTTTAGCACTTGTTGGAAGG - Intergenic
1043589600 8:81813563-81813585 TTATTTTATCACTTTTTTAATGG - Intronic
1043652338 8:82612017-82612039 TCCTTTTCCCACTTTTTGATGGG + Intergenic
1043696904 8:83231307-83231329 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1043748438 8:83905287-83905309 TTCTTTGCCCACTTTTTGATAGG + Intergenic
1044128636 8:88491644-88491666 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1044781429 8:95747380-95747402 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1044984156 8:97743171-97743193 TTCCATTCCCACTAGTTGAAAGG - Intergenic
1045205474 8:100035277-100035299 TTCTTTACCCACTTTTTGATGGG - Intronic
1045374643 8:101558880-101558902 TTCATTTATCACACTTTGAAAGG - Intronic
1045676169 8:104610121-104610143 TTCCAGTACCATTTATTGAATGG + Intronic
1045685832 8:104711045-104711067 TTACTTTGCCACTCTTTTAATGG - Intronic
1045813760 8:106255531-106255553 ATCCTTACCCACTTTTTGATGGG + Intergenic
1045814880 8:106268248-106268270 TTCCTTCACCACTGATAGAAAGG + Intergenic
1045823451 8:106369219-106369241 TTCTTTGCCCACTTTTTGATGGG + Intronic
1045906681 8:107354288-107354310 TTCCTTTACCTTTTTTTAAAAGG + Intronic
1045922395 8:107546663-107546685 GTCCTTTGCCCCTTTTTAAAGGG - Intergenic
1045929514 8:107605592-107605614 TTCCAATACCAATTATTGAATGG + Intergenic
1045953054 8:107873518-107873540 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1045998065 8:108386644-108386666 ATCCTTCGCCACTTTTTGATGGG - Intronic
1046058302 8:109105223-109105245 TTGCTCTTCCATTTTTTGAATGG - Intronic
1046148742 8:110195537-110195559 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1046449033 8:114363411-114363433 TTCTTTGTCCACTTTTTGATGGG - Intergenic
1046502143 8:115092380-115092402 TGCTTTTAACACTTTTTGCAAGG + Intergenic
1046574359 8:116007567-116007589 TTCTATTACCATTTGTTGAAAGG - Intergenic
1046881366 8:119312084-119312106 TCCTTTGACCACTTTTTGATGGG - Intergenic
1047133818 8:122052603-122052625 TTCCTTTAACCCTTTTTTCAAGG - Intergenic
1047164688 8:122424279-122424301 GTCCTTTACCCACTTTTGAATGG + Intergenic
1047328269 8:123860802-123860824 TCCCTTGCCCACTTTTTGATGGG + Intronic
1047602189 8:126436936-126436958 TTGCTTAACCTCTTTATGAATGG + Intergenic
1047917658 8:129599906-129599928 TGCCTTTCCCACTTTTTAATGGG + Intergenic
1047922342 8:129648212-129648234 ATCCTTTGCCACTGTTTGATGGG - Intergenic
1048373173 8:133798116-133798138 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1048449035 8:134515631-134515653 TTCTTTGCCCACTTTTTGATGGG + Intronic
1048587329 8:135786900-135786922 GTCTTGTACCAGTTTTTGAAGGG + Intergenic
1048749212 8:137651690-137651712 TTCCTCATCCACTTTTGGAATGG - Intergenic
1048780820 8:137998692-137998714 TTGCTCTACCAATTTTTGAGAGG - Intergenic
1048884192 8:138896126-138896148 TTCCTTTAGCAATTCTTCAAAGG - Intronic
1050164901 9:2755154-2755176 GTCCTTTGCCCATTTTTGAATGG - Intronic
1050676303 9:8058262-8058284 TCCTTTGACCACTTTTTGATGGG + Intergenic
1051096505 9:13472146-13472168 TCCTTTTACCACTTTTTAATGGG + Intergenic
1051290870 9:15544466-15544488 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1051320059 9:15893599-15893621 TTCTTTGCCCACTTTTTGATGGG - Intronic
1051327990 9:15993760-15993782 ATCCTTTGCCACTTTTTGATGGG - Intronic
1051568076 9:18523262-18523284 TCCTTTTCCCACTTTTTGATGGG + Intronic
1051751922 9:20351494-20351516 TTCCTAAGCCACTTTTTCAAAGG - Intronic
1051946588 9:22576771-22576793 GTCCTTTGCCCCTTTTTTAATGG - Intergenic
1052379868 9:27758431-27758453 TTCCTGTTCGACTTTTTTAAAGG - Intergenic
1052541750 9:29819273-29819295 TTCCTTTAGCATTTCTTGTAAGG - Intergenic
1052639224 9:31143215-31143237 TTCTTCTCCCACTTTTTGATGGG - Intergenic
1052692263 9:31830105-31830127 TTCCTTGCCCACTTTTTAATGGG - Intergenic
1052702361 9:31952580-31952602 TCCCTTTAGCACTTCTTGTAAGG - Intergenic
1052895696 9:33746345-33746367 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1053330676 9:37204127-37204149 TTCTTTGCCCACTTTTTGATGGG + Intronic
1053520751 9:38776421-38776443 TTTCTTTTCCATCTTTTGAAGGG - Intergenic
1053672355 9:40379853-40379875 TCCCATCACCACTTATTGAATGG - Intergenic
1054192907 9:62000414-62000436 TTTCTTTTCCATCTTTTGAAGGG - Intergenic
1054355935 9:64062939-64062961 TCCTTTGACCACTTTTTGATGGG + Intergenic
1054383469 9:64519882-64519904 TCCCATCACCACTTATTGAATGG - Intergenic
1054512269 9:65996456-65996478 TCCCATCACCACTTATTGAATGG + Intergenic
1054645500 9:67588277-67588299 TTTCTTTTCCATCTTTTGAAGGG + Intergenic
1054894517 9:70293773-70293795 TTCTTCTACCGCTTTTTGTATGG + Intronic
1054985699 9:71259715-71259737 TTCTTTGCCCACTTTTTGATGGG + Intronic
1055014798 9:71604711-71604733 TTCCTTTACCATCTGTTGAATGG + Intergenic
1055148191 9:72961683-72961705 TTCTTCTCCCACTTTTTGATGGG - Intronic
1055208915 9:73765497-73765519 TCCTTTTCCCACTTTTTGATGGG - Intergenic
1055211543 9:73800765-73800787 TCCCTTTAGCATTTCTTGAAAGG - Intergenic
1055675315 9:78653245-78653267 TCCTTTGACCACTTTTTGATGGG - Intergenic
1055705644 9:78999257-78999279 TTCCTTTAGCATTTCTTGTAGGG + Intergenic
1055750029 9:79495371-79495393 TCCTTTGCCCACTTTTTGAAGGG + Intergenic
1055831986 9:80390672-80390694 TCCTTCTACCACTTTTTGATGGG - Intergenic
1055847190 9:80579941-80579963 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1056124222 9:83519311-83519333 TCCCTTGCCCACTTTTTGATGGG - Intronic
1056198082 9:84248017-84248039 TTCTTTGCCCACTTTTTGATAGG - Intergenic
1056412517 9:86345059-86345081 TTCCTGTACCACTTTGTCAATGG + Exonic
1056513834 9:87331573-87331595 TTGTTTTCCCACTTTTTGAATGG + Intergenic
1056734354 9:89194005-89194027 TCCCTGTACCACTTACTGAAAGG - Intergenic
1057170234 9:92958792-92958814 TTCCATTACTATTTGTTGAAAGG + Intronic
1058184521 9:101839106-101839128 TCCTTTGACCACTTTTTGATGGG - Intergenic
1058276167 9:103044590-103044612 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1058389167 9:104475246-104475268 TTCCTATACCACTTCAGGAATGG + Intergenic
1058639257 9:107067165-107067187 TTCCTTTACCAATTCTCCAAAGG - Intergenic
1058925648 9:109660988-109661010 TACCTTGCCCACTTTTTGATAGG + Intronic
1059962761 9:119582396-119582418 TACTTTTCCCACTTTTTGATGGG + Intergenic
1059991036 9:119866669-119866691 GTCCTTTGCCAATTTTTAAATGG - Intergenic
1060097714 9:120807586-120807608 TCCCTTTAGCATTTTTTGTAAGG + Intergenic
1060441911 9:123647979-123648001 GTCATTTACTACTATTTGAAGGG - Intronic
1061797437 9:133095548-133095570 TCCCTTTACCATTTATTGTAGGG + Intergenic
1062333688 9:136055727-136055749 TTCCTCTACCACGTGTTTAATGG - Intronic
1185727527 X:2434108-2434130 TTCCTTTACCCATTTGTGGAGGG - Intronic
1185928689 X:4175699-4175721 TTCCTTTGCCCATTTTTAAATGG - Intergenic
1186571559 X:10720368-10720390 TTCTTTGCCCACTTTTTGATGGG - Intronic
1186791219 X:13001082-13001104 TTCCTTTCCCTGATTTTGAAGGG + Intergenic
1186912339 X:14182061-14182083 TTGCTTTACAACTTATTCAATGG + Intergenic
1187422486 X:19147856-19147878 TCCCTTGCCCACTTTTTGATGGG - Intergenic
1187453705 X:19422350-19422372 TTCTTTGCCCACTTTTTGATGGG - Intronic
1187643873 X:21325169-21325191 TTCTTTTAACATTTCTTGAAAGG + Intergenic
1187840789 X:23485316-23485338 TCCCTTGTCCACTTTTTGATGGG - Intergenic
1187845270 X:23529414-23529436 TTCTATTACCAGTTTTTGAGGGG - Intergenic
1187979667 X:24742287-24742309 TTCCTTTTCCACTTTGTAAAAGG + Intronic
1187994566 X:24912129-24912151 TTCCATCATCACTTGTTGAAAGG - Intronic
1188134044 X:26472042-26472064 TTCCTTTGCTACTTTTTGTATGG - Intergenic
1188750824 X:33903988-33904010 TTCTTTACCCACTTTTTTAATGG - Intergenic
1188863057 X:35281037-35281059 TTCCTTTAACACTTATTGTAAGG + Intergenic
1188914015 X:35887877-35887899 ATCCTTTCCAACTTTTTGGAGGG + Intergenic
1189572304 X:42311321-42311343 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1189721385 X:43922720-43922742 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1189892849 X:45623648-45623670 TGCCTATAGCACTTTGTGAATGG + Intergenic
1189967388 X:46388892-46388914 TTATTTTGCCACTTCTTGAATGG - Intergenic
1190378495 X:49814785-49814807 TACTTTGCCCACTTTTTGAAGGG + Intergenic
1190910908 X:54771657-54771679 GTCCTTTGCCAATTTTTTAATGG - Intronic
1190947086 X:55105842-55105864 TTCTTTGCCCACTTTTTGATGGG + Intronic
1190980000 X:55448572-55448594 TCCCTTGCCCACTTTTTGATGGG - Intergenic
1191023328 X:55886521-55886543 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1191130380 X:57002194-57002216 TTCTTTTAACATTTTTTGTAGGG + Intergenic
1191178441 X:57532791-57532813 TCCCTTTAGCATTTCTTGAAAGG + Intergenic
1191652012 X:63549548-63549570 TCCCTTGCCCACTTTTTGATGGG + Intergenic
1191657770 X:63617098-63617120 TCCTTTGCCCACTTTTTGAAGGG - Intergenic
1191775976 X:64813687-64813709 TCCTTTGACCACTTTTTGAAGGG - Intergenic
1191776398 X:64819095-64819117 TTCCTTGCCCACTTATTGATGGG - Intergenic
1191936311 X:66430813-66430835 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1192013610 X:67302997-67303019 TTCTTTGCCCATTTTTTGAAGGG - Intergenic
1192046845 X:67684576-67684598 TTCCTTTCTCCCTTTATGAAAGG - Intronic
1192097677 X:68230083-68230105 TTCTTTGCCCACTTTTTGATGGG - Intronic
1192101523 X:68269908-68269930 TTCTTTGCCCACTTTTTGATGGG - Intronic
1192678154 X:73222031-73222053 TCCTTTGACCACTTTTTGATAGG + Intergenic
1192711576 X:73595996-73596018 TTCTTTGCCCACTTTTTGATGGG + Intronic
1192754651 X:74034763-74034785 ATCCTTTGCCACTTTTTGATGGG + Intergenic
1192912684 X:75621695-75621717 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1192937570 X:75876488-75876510 TTCTTTGCCCACTTTTTGATTGG + Intergenic
1192942014 X:75922394-75922416 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1192956974 X:76082152-76082174 TTCTTTTCCCACTTTTTAATGGG - Intergenic
1193035137 X:76941800-76941822 TTCTTCACCCACTTTTTGAAGGG - Intergenic
1193169287 X:78317153-78317175 TCCCTTTTCCACTTTGTGATGGG - Intronic
1193195528 X:78627117-78627139 ATCCTTCCCCACTTTTTGATGGG + Intergenic
1193227133 X:78997738-78997760 TGCCTTTAACAGTTTTTAAATGG - Intergenic
1193237420 X:79125016-79125038 TTCTTTTATCAGTTATTGAAAGG - Intergenic
1193243464 X:79200589-79200611 TCCTTTGCCCACTTTTTGAAGGG - Intergenic
1193265976 X:79469951-79469973 TCCTTTGACCACTTTTTTAATGG - Intergenic
1193281970 X:79662456-79662478 TTCCTTTAACATTTCTTGCAGGG + Intergenic
1193394079 X:80963363-80963385 TTCCTTGGACACTTTTTGATGGG + Intergenic
1193454437 X:81713020-81713042 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1193559121 X:82995752-82995774 ATCCTTGCCCACTTTTTGATGGG - Intergenic
1193588831 X:83362517-83362539 TCCTTTTCCCACTTTTTGATAGG + Intergenic
1193615533 X:83683744-83683766 TCCTTTTCCCACTTTTTGATGGG + Intergenic
1193725152 X:85029688-85029710 TTCTTTGCCCACTTTTTGATGGG - Intronic
1193749428 X:85324855-85324877 TTCCTTTAGGACTTCTTGTAAGG + Intronic
1193781163 X:85702911-85702933 TGCTTTTCCCACTTTTTGATGGG - Intergenic
1193781866 X:85712737-85712759 TCCTTTTCCCACTTTTTGATGGG + Intergenic
1193799413 X:85916613-85916635 TTCTTTGCCCACTTTTTTAATGG - Intronic
1193910691 X:87302531-87302553 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1193991507 X:88313655-88313677 TCCCTTGCCCACTTTTTGATGGG - Intergenic
1194068484 X:89290966-89290988 TTCCTTTAACAATTTTTGTAGGG - Intergenic
1194168494 X:90552818-90552840 TCCCTATCCCACTTTTTGATAGG - Intergenic
1194248201 X:91540234-91540256 TTCCTTTAGGACTTCTTGTAAGG - Intergenic
1194436404 X:93873269-93873291 TTCCTTTAAGACTTTTAGACTGG + Intergenic
1194489034 X:94524242-94524264 TTCATGTAGCACTTTTTGTAAGG - Intergenic
1194542560 X:95191909-95191931 GTCCTTTGCCACTTTTTAATAGG + Intergenic
1194549330 X:95276067-95276089 TTCCTTTACAAGTTCTTGTATGG - Intergenic
1194564214 X:95463028-95463050 TCCCTTTAGCATTTCTTGAAGGG - Intergenic
1194575775 X:95612787-95612809 TTCTTTGCCCACTTTTTGAAGGG - Intergenic
1194575867 X:95613770-95613792 TTCTTTGCCCACTTTTTGAAGGG + Intergenic
1194617407 X:96122612-96122634 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1194625262 X:96219830-96219852 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1194757949 X:97759688-97759710 TCCTTTTTCCACTTTTTGATGGG + Intergenic
1194790039 X:98136653-98136675 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1194854081 X:98906817-98906839 GTCCTTTACCAACTTTTTAATGG + Intergenic
1194880389 X:99243615-99243637 TCCTTTGCCCACTTTTTGAAGGG + Intergenic
1194904387 X:99556535-99556557 TTCCTTTAGCATTTCTTGTAAGG + Intergenic
1194955013 X:100168397-100168419 TCCTTTGCCCACTTTTTGAAGGG - Intergenic
1194959472 X:100218561-100218583 TTCCCTTAACATTTTTTAAATGG - Intergenic
1194963387 X:100260787-100260809 TCCTTTGCCCACTTTTTGAAGGG - Intergenic
1195124817 X:101797596-101797618 GTCCTTTGCCCATTTTTGAATGG - Intergenic
1195126953 X:101817402-101817424 TCCCTCACCCACTTTTTGAAGGG + Intergenic
1195179918 X:102348029-102348051 GTCCTTTGCCAATTTTTGAATGG + Intergenic
1195548613 X:106140596-106140618 TTCCTTTAGCAGTTCTTGTAAGG - Intergenic
1195660899 X:107376868-107376890 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1195729740 X:107954420-107954442 TCCCTTGCCCACTTTTTGAAGGG + Intergenic
1195788215 X:108551324-108551346 GTCCTTTGCCCATTTTTGAATGG - Intronic
1195799422 X:108690317-108690339 TTTCTTAACGAGTTTTTGAAAGG + Intronic
1195813214 X:108857144-108857166 TTCTTTGCCCACTTTTTGATAGG - Intergenic
1195826100 X:109002849-109002871 TTCTTTTAACATTTTTTGCAAGG - Intergenic
1195887758 X:109658039-109658061 TTCTTTGCCCACTTTTTGATGGG + Intronic
1196092091 X:111755594-111755616 TTCTTTGCCCACTTTTTGATGGG - Intronic
1196225580 X:113162124-113162146 TTCATTGCCCACTTTTTAAATGG + Intergenic
1196945203 X:120817470-120817492 TTCGTTGCCCACTTTTTGATGGG - Intergenic
1197185264 X:123579119-123579141 TCCCTTGCCCACTTTTTGATGGG - Intergenic
1197311420 X:124910379-124910401 TTCCTTTTACACATTTTGGAAGG + Intronic
1197441856 X:126501212-126501234 TCCCTTGTCCACTTTTTGATGGG + Intergenic
1197446613 X:126557440-126557462 TTCCTTTAGCCATTTTTCAAGGG - Intergenic
1197474900 X:126909936-126909958 TCCTTTAACCACTTTTTGATGGG - Intergenic
1197535662 X:127686131-127686153 TTCCTTTATCACTTGTTTCAAGG + Intergenic
1197760930 X:130027664-130027686 TTGTTATAACACTTTTTGAAAGG + Intronic
1197956616 X:131956592-131956614 TTCCTTTAGCATTTATTGTAGGG - Intergenic
1197960107 X:131994809-131994831 TCCTTTTCCCACTTTTTGATGGG - Intergenic
1197961367 X:132009903-132009925 TCCTTTTCCCACTTTTTGATGGG - Intergenic
1198027748 X:132724911-132724933 TTCCAGCACCACTTATTGAAAGG - Intronic
1198450257 X:136760165-136760187 TCCCTTTACCAGTTTTTTAGAGG - Intronic
1198556817 X:137802996-137803018 GTCCTTTCCCACTTTTTAATGGG + Intergenic
1198938635 X:141928235-141928257 TTCCATTACCACTTGTTTCAAGG + Intergenic
1199186228 X:144919024-144919046 TTTGTTTCCCACTTTTTTAAAGG + Intergenic
1199397372 X:147354922-147354944 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1199442847 X:147888229-147888251 TTCCTTTAGCATTTCTTGTAGGG + Intergenic
1199499094 X:148489647-148489669 TGCCTTTTCCACTTCTTCAAAGG + Intergenic
1199816380 X:151401256-151401278 TCCCAGTACCACTTATTGAAGGG + Intronic
1200317670 X:155150648-155150670 TCCCTAGACCACTTTTTGATGGG + Intergenic
1200405468 Y:2806384-2806406 GTCCTTTGCCACTTTTTGATGGG + Intergenic
1200514736 Y:4130604-4130626 TCCCTATCCCACTTTTTGATAGG - Intergenic
1200522097 Y:4222095-4222117 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1200722626 Y:6625128-6625150 TTCCTTTAACAATTTTTGTAGGG - Intergenic
1201056390 Y:9996361-9996383 TCTCTTTTCCACTTTTTAAAGGG + Intergenic
1201069986 Y:10138596-10138618 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1201253404 Y:12083822-12083844 ATCCTTTGCCACTTTTTGATGGG - Intergenic
1201425545 Y:13846747-13846769 TCCTTTGACCACTTTTTGATGGG + Intergenic
1201464737 Y:14268086-14268108 TTCTTTGACCACGTTTTGATGGG + Intergenic
1201529071 Y:14971968-14971990 TCCTTTGCCCACTTTTTGAATGG + Intergenic
1201560834 Y:15314754-15314776 TTCTTTGCCCACTTTTTGATGGG - Intergenic
1201640471 Y:16171615-16171637 TTCCATTACCAATTATTGAATGG + Intergenic
1201662343 Y:16413710-16413732 TTCCATTACCAATTATTGAATGG - Intergenic
1202024509 Y:20506397-20506419 TCCTTTGACCACTTTTTGATGGG - Intergenic
1202065802 Y:20938621-20938643 TCCTTTTCCCACTTTTTGATGGG + Intergenic
1202087772 Y:21156662-21156684 TTCTTTGCCCACTTTTTGATGGG + Intergenic
1202108956 Y:21402065-21402087 TCCTTTGACCACTTTTTGATGGG - Intergenic
1202173469 Y:22075574-22075596 ATCCTTTACCACTTTTTGTTGGG + Intronic
1202217891 Y:22510809-22510831 ATCCTTTACCACTTTTTGTTGGG - Intronic
1202276056 Y:23120533-23120555 TTCCTTAACCATTTCTTGTAAGG - Intergenic
1202289972 Y:23300158-23300180 TTCCTTAACCATTTCTTGTAAGG + Intergenic
1202325294 Y:23685250-23685272 ATCCTTTACCACTTTTTGTTGGG + Intergenic
1202429049 Y:24754253-24754275 TTCCTTAACCATTTCTTGTAAGG - Intergenic
1202441742 Y:24915836-24915858 TTCCTTAACCATTTCTTGTAAGG + Intergenic
1202545477 Y:25984804-25984826 ATCCTTTACCACTTTTTGTTGGG - Intergenic