ID: 1153380844

View in Genome Browser
Species Human (GRCh38)
Location 18:4437791-4437813
Sequence TGTCCACTTAATACAGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153380842_1153380844 13 Left 1153380842 18:4437755-4437777 CCTGGCATTTCTACTTGCTTCTT 0: 1
1: 0
2: 3
3: 35
4: 395
Right 1153380844 18:4437791-4437813 TGTCCACTTAATACAGTTGGAGG 0: 1
1: 1
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153380844 Original CRISPR TGTCCACTTAATACAGTTGG AGG Intronic
901503033 1:9665581-9665603 TGTCCAATTAATACTGCTTGAGG + Intronic
905545314 1:38793189-38793211 TGTCCTCCTAATACAGTTATTGG - Intergenic
906419325 1:45651021-45651043 TGTACATTTAATCCAATTGGTGG + Intronic
907329339 1:53661023-53661045 TGTCCCCTTAACAAGGTTGGAGG + Intronic
908090580 1:60681506-60681528 TGTGGACTTGGTACAGTTGGTGG - Intergenic
913002578 1:114596068-114596090 TGTCAACTAAATACAGTGTGTGG + Intronic
913318784 1:117574505-117574527 TGTCCCCTTCACAAAGTTGGAGG - Intergenic
915521155 1:156444986-156445008 TGTCCACTGAAGACAGCAGGAGG + Intergenic
915925576 1:160016519-160016541 TGACCACTTAATATAGTTAATGG + Intergenic
918932998 1:190881209-190881231 TCTCCAGCTTATACAGTTGGAGG - Intergenic
918963532 1:191309853-191309875 TGTTCACTTACTACAGTTTCAGG - Intergenic
920053053 1:203174996-203175018 TTTCCACTTCCTACAGTTCGGGG + Intronic
922482980 1:225951818-225951840 AGTGCACTTATTACAATTGGTGG - Intergenic
1064686158 10:17864324-17864346 TGTCCATTTAATATAGTTTTAGG - Intronic
1069666069 10:70159953-70159975 TATCCATTTCAGACAGTTGGTGG - Intronic
1073739395 10:106389481-106389503 TGTTCTCTTAAGAAAGTTGGGGG - Intergenic
1076073728 10:127514778-127514800 TGCCTACTTCATAGAGTTGGTGG + Intergenic
1079712354 11:23701572-23701594 TGTCCATTAATTACATTTGGTGG - Intergenic
1086239804 11:84675888-84675910 TGTCCACTTAAATCAGTAGGAGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1099173331 12:79391690-79391712 TGTCTACTCAAAACTGTTGGGGG - Intronic
1107552798 13:41492904-41492926 TGTTCAGTTCATACAGTTGGTGG + Intergenic
1111097713 13:83536159-83536181 TGTATATTTACTACAGTTGGGGG + Intergenic
1112048289 13:95619782-95619804 TGTCCACTTAATAACATTTGGGG - Intronic
1112701281 13:102011858-102011880 TCTCCACTTAATTCAGATGCTGG - Intronic
1118492655 14:66276674-66276696 TGCTCACTTAAGGCAGTTGGCGG - Intergenic
1119400241 14:74358081-74358103 GGTCCACTTATTATAATTGGCGG + Exonic
1123428467 15:20193083-20193105 TTTCCAGTAAATACAGTAGGTGG - Intergenic
1124882568 15:33656007-33656029 TGTCCACTTAATATAATCAGTGG + Intronic
1131735094 15:95323606-95323628 GGTCCCTTTAAGACAGTTGGGGG + Intergenic
1132026254 15:98406650-98406672 TGTCCATGTAATCCAGTTGAGGG - Intergenic
1136855851 16:33656679-33656701 TTTCCAGTAAATACAGTAGGTGG + Intergenic
1140243272 16:73224376-73224398 TGTACACATAAAATAGTTGGAGG + Intergenic
1140807254 16:78544382-78544404 TGTCTACTTAATAAGGTTGTAGG - Intronic
1140839887 16:78828739-78828761 TGCCCACTTTATAGGGTTGGAGG - Intronic
1203117436 16_KI270728v1_random:1505158-1505180 TTTCCAGTAAATACAGTAGGTGG + Intergenic
1142988532 17:3712998-3713020 TTTGCACTTAGAACAGTTGGTGG - Intergenic
1144481410 17:15632548-15632570 TGTACACTTAATCCAGTTGCTGG - Exonic
1144916891 17:18731174-18731196 TGTACACTTAATCCAGTTGCTGG + Exonic
1153380844 18:4437791-4437813 TGTCCACTTAATACAGTTGGAGG + Intronic
1153380855 18:4437963-4437985 TGTCCACTTAATATAGTTGGAGG + Intronic
1155052283 18:22158895-22158917 TTTCCAGTGAATACACTTGGAGG + Intergenic
1155477826 18:26252481-26252503 TTTCCACTTAATATTTTTGGAGG - Intronic
1159137426 18:64352565-64352587 TGTACACTTAAAATAGTTTGTGG + Intergenic
1162920536 19:13899554-13899576 TGTCCTCTGACTACAGCTGGAGG + Intronic
929241950 2:39662932-39662954 TGTCTACTTCATACATTTGGAGG - Intergenic
929810556 2:45186045-45186067 TATCCACTTAAGACAGTAGGAGG + Intergenic
930771041 2:55130991-55131013 TGTACACTGAAGACAGATGGGGG - Intergenic
932054204 2:68428337-68428359 TGACCACTTCATACCTTTGGAGG - Intergenic
933161964 2:79035412-79035434 TGTCCATTTAGTACTTTTGGTGG + Intergenic
936481304 2:112887557-112887579 TGCCCATTTAAAACATTTGGGGG + Intergenic
936991229 2:118368695-118368717 TGTCCAGTTAATAAAGTTAAAGG + Intergenic
937504386 2:122520136-122520158 TGTCCTCTTAATACACATGGGGG - Intergenic
942045786 2:172098569-172098591 TTTCCACTTCATACTCTTGGTGG - Intergenic
1170724433 20:18913903-18913925 TTTCCCCCTAATAAAGTTGGGGG + Intergenic
1172198574 20:33109170-33109192 TGGCCACCTCATACAGTTTGTGG + Intronic
1177548321 21:22588600-22588622 TGTCCAAATAAAAAAGTTGGAGG - Intergenic
1181868074 22:25874937-25874959 TGTGCACTTAATACAGTACATGG + Intronic
949103390 3:173966-173988 TTTTCTCTTAAGACAGTTGGTGG + Intergenic
951541077 3:23782717-23782739 TTTCTACTAAATACAGTTAGAGG - Intergenic
955171345 3:56568243-56568265 TGTCAAATTAATACATTTTGGGG + Intronic
956505336 3:69932000-69932022 TGTCCAGTTAAGACAGTAGTTGG + Intronic
957109719 3:75938125-75938147 TTTCCCCTAAATACACTTGGCGG - Intronic
959897996 3:111627197-111627219 TGTCCATAGAATACAGCTGGTGG - Intronic
960502533 3:118454898-118454920 TGTCCACAGAATACAGATGAGGG + Intergenic
964969543 3:162542474-162542496 TGTACACCTCATACACTTGGAGG + Intergenic
966298690 3:178454306-178454328 TGTCCAATTATTTCAGGTGGAGG - Intronic
967725167 3:192855447-192855469 TGTACACTTAATACAGTATAGGG + Intronic
967840292 3:193999768-193999790 TGTGAACTGAATACAGTTGCAGG - Intergenic
970221814 4:13819404-13819426 GCTCCACTTAATAAAGATGGAGG + Intergenic
971626490 4:28926933-28926955 TATCCACTTAATACAGTATTTGG + Intergenic
972792833 4:42389403-42389425 TGTCCACATAAGACAGCTTGTGG + Intergenic
974802082 4:66830401-66830423 TTGTCACTTAATACTGTTGGTGG - Intergenic
980967369 4:139535583-139535605 AAGCCACTGAATACAGTTGGGGG - Intronic
982179278 4:152734627-152734649 TGTGCACTTTATAGAGTTGTGGG - Intronic
983451938 4:167922746-167922768 TGTCAACTTGATTCAGTTGAAGG - Intergenic
983713354 4:170747662-170747684 GCTCTACTTATTACAGTTGGTGG + Intergenic
985967748 5:3350701-3350723 TTTCCACTAAATGCAGTTAGTGG + Intergenic
986636412 5:9826583-9826605 TTTCCACTTAATACAGGTTAGGG + Intergenic
991045994 5:62223431-62223453 TTTCCAGTAAATACAGTAGGTGG - Intergenic
992317421 5:75571407-75571429 TGTCCACTAAATACTGGGGGAGG - Intronic
995479339 5:112579480-112579502 TATCCACTGATTTCAGTTGGAGG - Intergenic
995958072 5:117804212-117804234 TGTGCACTTAATAAATTTTGCGG - Intergenic
999246676 5:150158710-150158732 TGTACACTTAGTACACTTCGAGG - Intergenic
1004511457 6:16287279-16287301 AATCTACTTAATACAGGTGGTGG + Intronic
1013641222 6:112084016-112084038 TGTCCACCTAACACATTAGGGGG - Intronic
1016684967 6:146870853-146870875 TGACCACTGATGACAGTTGGAGG - Intergenic
1019851631 7:3564582-3564604 TGTATACTTAATAAATTTGGGGG + Intronic
1020701976 7:11496203-11496225 TGTCTACTTCATAGAGTTGTTGG - Intronic
1037669089 8:20998937-20998959 TGTCAACTTAATCAAGTTGAAGG + Intergenic
1040490566 8:47917754-47917776 TATCCACTAAATACATTTGAGGG + Intronic
1042440783 8:68823436-68823458 TGTACACTTGATAGAGTGGGTGG + Intergenic
1043032336 8:75152189-75152211 TGTCCACTTTAAAGAGTTTGTGG + Intergenic
1045966613 8:108032382-108032404 TGTCACCTTAATACAGTTTCTGG + Intronic
1047030065 8:120867032-120867054 TGTCCACTTAATACCTATTGTGG - Intergenic
1047863043 8:128989906-128989928 TTTCCACTTAATTCACTTGGGGG + Intergenic
1049138567 8:140929508-140929530 TGTCCCCCTAATAAACTTGGAGG + Intronic
1049823547 8:144652296-144652318 TGAACACTTAACACTGTTGGTGG + Intergenic
1052647760 9:31258910-31258932 TGTGCATTTAATATAGTTTGAGG - Intergenic
1054784472 9:69197842-69197864 TGTCCACATAACACAGTGGCAGG - Intronic
1054999457 9:71432283-71432305 TACCCATTGAATACAGTTGGGGG - Intronic
1057506256 9:95636006-95636028 TTTTCATTTAATACATTTGGGGG + Intergenic
1058169386 9:101661693-101661715 TGTCCACATAATATAGTATGTGG - Intronic
1059666072 9:116447850-116447872 GGACCACTTACTCCAGTTGGGGG - Intronic
1061835675 9:133327970-133327992 TGTCAAACTAAAACAGTTGGAGG - Intergenic