ID: 1153380855

View in Genome Browser
Species Human (GRCh38)
Location 18:4437963-4437985
Sequence TGTCCACTTAATATAGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153380855 Original CRISPR TGTCCACTTAATATAGTTGG AGG Intronic
907329339 1:53661023-53661045 TGTCCCCTTAACAAGGTTGGAGG + Intronic
909400801 1:75227567-75227589 TTTCCACTTACTGTAGTTAGAGG + Intronic
912346943 1:108972494-108972516 GGTACATTTATTATAGTTGGTGG - Intronic
913318784 1:117574505-117574527 TGTCCCCTTCACAAAGTTGGAGG - Intergenic
915074277 1:153296056-153296078 TGTCAAATAAATATAGTTTGGGG - Intergenic
915925576 1:160016519-160016541 TGACCACTTAATATAGTTAATGG + Intergenic
917899667 1:179529845-179529867 TGTCAAATAAATATATTTGGGGG + Intronic
919316258 1:195973895-195973917 CATCCAATTAATATTGTTGGAGG + Intergenic
923138020 1:231135329-231135351 TGGCTACTTAATATTTTTGGGGG - Intergenic
924333177 1:242960990-242961012 TTTCCATTTAATATTGTTTGTGG + Intergenic
1064686158 10:17864324-17864346 TGTCCATTTAATATAGTTTTAGG - Intronic
1068266260 10:54654172-54654194 TGTCCACTGGATGTGGTTGGTGG - Intronic
1068602961 10:58974907-58974929 TGTCAAATAAATATATTTGGGGG - Intergenic
1071841639 10:89477775-89477797 TGTACATATAATATTGTTGGTGG - Intronic
1073739395 10:106389481-106389503 TGTTCTCTTAAGAAAGTTGGGGG - Intergenic
1076073728 10:127514778-127514800 TGCCTACTTCATAGAGTTGGTGG + Intergenic
1078770098 11:14341280-14341302 TGCCCACATAATGTAGTTTGAGG - Intronic
1079822699 11:25150945-25150967 TGGCCACTTATTATTTTTGGGGG + Intergenic
1080979156 11:37379333-37379355 TTTCATCTTAAGATAGTTGGTGG + Intergenic
1080986001 11:37466591-37466613 TGTACAATTTATATAGTTGTAGG - Intergenic
1086239804 11:84675888-84675910 TGTCCACTTAAATCAGTAGGAGG + Intronic
1086735055 11:90295964-90295986 TGTACACTTAAAATGGTTGTTGG + Intergenic
1089859832 11:121579278-121579300 TGTCATCTCAAAATAGTTGGAGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1093083097 12:14836521-14836543 TGTCCATTTAATATATTCTGCGG + Intronic
1098391379 12:69973128-69973150 TGAACACTTAATATATGTGGGGG - Intergenic
1098447384 12:70580313-70580335 TCTCCAATTAATATGGTTAGAGG - Intronic
1107552798 13:41492904-41492926 TGTTCAGTTCATACAGTTGGTGG + Intergenic
1111839693 13:93434424-93434446 TGTCCCCACAATATAATTGGGGG - Intronic
1112048289 13:95619782-95619804 TGTCCACTTAATAACATTTGGGG - Intronic
1116812510 14:49553058-49553080 TGTCAAATAAATATATTTGGGGG - Intergenic
1119400241 14:74358081-74358103 GGTCCACTTATTATAATTGGCGG + Exonic
1120454128 14:84710059-84710081 TGTACAATTATTATAGTGGGAGG - Intergenic
1121125212 14:91401942-91401964 TGTCCATTTGACATTGTTGGTGG - Intronic
1124882568 15:33656007-33656029 TGTCCACTTAATATAATCAGTGG + Intronic
1125161896 15:36653820-36653842 TGTTCACTTTATATGGTAGGAGG + Intronic
1126281399 15:46955418-46955440 TGTCCATTTTATATAGTTAATGG - Intergenic
1140243272 16:73224376-73224398 TGTACACATAAAATAGTTGGAGG + Intergenic
1140807254 16:78544382-78544404 TGTCTACTTAATAAGGTTGTAGG - Intronic
1140839887 16:78828739-78828761 TGCCCACTTTATAGGGTTGGAGG - Intronic
1144071929 17:11681957-11681979 TGTCCACCACATATAGTTGTGGG + Intronic
1144481410 17:15632548-15632570 TGTACACTTAATCCAGTTGCTGG - Exonic
1144916891 17:18731174-18731196 TGTACACTTAATCCAGTTGCTGG + Exonic
1153380844 18:4437791-4437813 TGTCCACTTAATACAGTTGGAGG + Intronic
1153380855 18:4437963-4437985 TGTCCACTTAATATAGTTGGAGG + Intronic
1153889081 18:9495851-9495873 TGTCCAATAAATATATTTTGAGG - Intronic
1155477826 18:26252481-26252503 TTTCCACTTAATATTTTTGGAGG - Intronic
1159137426 18:64352565-64352587 TGTACACTTAAAATAGTTTGTGG + Intergenic
1159636397 18:70810022-70810044 TGTACACTTAAAATACTGGGAGG + Intergenic
1165667949 19:37649912-37649934 TGGCCACTACATATTGTTGGGGG + Intronic
926510109 2:13765601-13765623 TGTACACTTAAAATTGGTGGTGG + Intergenic
929241950 2:39662932-39662954 TGTCTACTTCATACATTTGGAGG - Intergenic
929810556 2:45186045-45186067 TATCCACTTAAGACAGTAGGAGG + Intergenic
930555046 2:52885033-52885055 CTTCCACTTAATATTCTTGGAGG - Intergenic
936991229 2:118368695-118368717 TGTCCAGTTAATAAAGTTAAAGG + Intergenic
937504386 2:122520136-122520158 TGTCCTCTTAATACACATGGGGG - Intergenic
944832872 2:203550163-203550185 TGTCCACTTTTTATGGTTTGAGG + Intergenic
944849608 2:203705126-203705148 TGTGCAATTACTCTAGTTGGGGG - Intergenic
1170724433 20:18913903-18913925 TTTCCCCCTAATAAAGTTGGGGG + Intergenic
1172399960 20:34641383-34641405 TGTCCCCTTAATATGATTAGAGG - Intronic
1177548321 21:22588600-22588622 TGTCCAAATAAAAAAGTTGGAGG - Intergenic
1177620010 21:23577029-23577051 TCTCCACTTAACGTAGTTGTTGG + Intergenic
1182600095 22:31455698-31455720 TGTCCTTTTAATATTGTTGAAGG - Intronic
949615459 3:5749006-5749028 TGTCCCATTAATATAGATGAAGG + Intergenic
951142639 3:19183068-19183090 TGTACAGTTAATATATTTAGTGG + Intronic
952581378 3:34837521-34837543 TGTCAAATAAATATATTTGGGGG - Intergenic
955801880 3:62695322-62695344 TGTCAAATAAATATATTTGGGGG - Intronic
955850910 3:63218772-63218794 TGTCCTGTTAATATAATTTGGGG - Intergenic
959003831 3:100996519-100996541 TATACACTTAATATGGGTGGGGG - Intergenic
959343122 3:105156939-105156961 TGTCAAATAAATATATTTGGGGG - Intergenic
959798593 3:110462949-110462971 TGGCCACTCAATTTAGTGGGAGG - Intergenic
961586988 3:127938576-127938598 TTTCCATTTAATATAATTGTTGG - Intronic
961986821 3:131143288-131143310 GGTCCACTTTAGATAGTTTGAGG + Intronic
962233723 3:133690230-133690252 TGACAACTTTATATAGTTTGTGG - Intergenic
963212790 3:142712440-142712462 GGACCACTTTAAATAGTTGGAGG - Exonic
966984788 3:185169234-185169256 AGTCCACTTAAAATATTTAGTGG + Intergenic
970221814 4:13819404-13819426 GCTCCACTTAATAAAGATGGAGG + Intergenic
974204057 4:58675957-58675979 TGTCAAATAAATATATTTGGGGG + Intergenic
974934517 4:68396873-68396895 TGTCCAATTAATATTGCTTGAGG - Intergenic
975066442 4:70070772-70070794 TGAGCACTTAATATAGATGTAGG - Intergenic
975206229 4:71646718-71646740 TGTCCAATAAATATATTTTGGGG + Intergenic
977289083 4:95143873-95143895 TTTCCACATTATATAGTTGCTGG + Intronic
979608628 4:122666778-122666800 TGTCCACTCAATATATTTCCAGG + Intergenic
979986120 4:127317851-127317873 TTTTCAATAAATATAGTTGGAGG - Intergenic
982179278 4:152734627-152734649 TGTGCACTTTATAGAGTTGTGGG - Intronic
988197702 5:28027150-28027172 TGTACACTTATTATAGGTGCAGG + Intergenic
990041144 5:51379980-51380002 TGTCCACATCATATAATTTGGGG - Intergenic
991986480 5:72292224-72292246 TGGCCAATGAATATAGTTGCTGG + Intronic
994492679 5:100467055-100467077 AGACCATTTAATATAATTGGAGG - Intergenic
995958072 5:117804212-117804234 TGTGCACTTAATAAATTTTGCGG - Intergenic
998930807 5:147179846-147179868 TATCCATTTCCTATAGTTGGGGG - Intergenic
1001282483 5:170396938-170396960 TGTCAAATAAATATAGTTTGGGG + Intronic
1004993138 6:21161572-21161594 TATCCACTTAATATATTTATAGG + Intronic
1012469884 6:99559536-99559558 TTTTCAGTTATTATAGTTGGAGG - Intronic
1014808097 6:125854282-125854304 TGTCCACTGAAAATATTTTGAGG + Intronic
1019077488 6:169399612-169399634 TGACAACTTAAGATAGTGGGGGG + Intergenic
1019851631 7:3564582-3564604 TGTATACTTAATAAATTTGGGGG + Intronic
1020701976 7:11496203-11496225 TGTCTACTTCATAGAGTTGTTGG - Intronic
1027351085 7:77312236-77312258 TGTTTACTTAATATAGTGTGTGG - Intronic
1029361988 7:100094446-100094468 TTTCCACTTAAAATTCTTGGAGG - Intronic
1037669089 8:20998937-20998959 TGTCAACTTAATCAAGTTGAAGG + Intergenic
1038236137 8:25758271-25758293 TGCTCACTGAATATAGTTGTAGG + Intergenic
1041136271 8:54762486-54762508 TGTACATTTAATATAGATAGGGG + Intergenic
1042399983 8:68333405-68333427 TGTCCACTTTAAATAATTGAAGG + Intronic
1042440783 8:68823436-68823458 TGTACACTTGATAGAGTGGGTGG + Intergenic
1043032336 8:75152189-75152211 TGTCCACTTTAAAGAGTTTGTGG + Intergenic
1043648300 8:82552510-82552532 TATACAATTAATATAGTTGTAGG + Intergenic
1047522509 8:125606063-125606085 TGTCCAAGAAATATATTTGGAGG + Intergenic
1047863043 8:128989906-128989928 TTTCCACTTAATTCACTTGGGGG + Intergenic
1049138567 8:140929508-140929530 TGTCCCCCTAATAAACTTGGAGG + Intronic
1052647760 9:31258910-31258932 TGTGCATTTAATATAGTTTGAGG - Intergenic
1056283666 9:85066644-85066666 TGTCCAAAAAATATAGTTTGGGG - Intergenic
1058169386 9:101661693-101661715 TGTCCACATAATATAGTATGTGG - Intronic
1059969989 9:119657269-119657291 TGTCCTTTTAATATATTAGGTGG + Intergenic
1060897661 9:127228088-127228110 TTTCCACTTAATATAGTGTAAGG + Intronic
1186749303 X:12605382-12605404 TGTGCTTTTAATATATTTGGAGG - Intronic
1195670233 X:107463577-107463599 TTTACAGTTAATATAGTGGGGGG - Intergenic
1202391617 Y:24376378-24376400 TTTCCATTTAATATTGTTTGTGG - Intergenic
1202479168 Y:25293739-25293761 TTTCCATTTAATATTGTTTGTGG + Intergenic