ID: 1153382223

View in Genome Browser
Species Human (GRCh38)
Location 18:4453890-4453912
Sequence GGCGGCAAGCAGTGGGACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153382223 Original CRISPR GGCGGCAAGCAGTGGGACGC TGG (reversed) Intronic
900402845 1:2479670-2479692 GGCTGCCAGCAGGGGGACGCTGG + Intronic
901022564 1:6262479-6262501 GGCCACCAGCAGTGGGAGGCTGG + Intergenic
901465143 1:9416665-9416687 GGCGGAAAGCAGTGAGACGCAGG + Intergenic
905546476 1:38804221-38804243 GGCCGCGAGCAGCGGGGCGCGGG - Intergenic
905862026 1:41358237-41358259 GGCAGCAAGCACTGGGAAGCAGG + Intergenic
917263566 1:173195817-173195839 GGTGGGCAGCAGTGGGACGTGGG + Intronic
918432466 1:184476275-184476297 GGCGGGGGGCAGTGGGACGTGGG + Intronic
1068015973 10:51516539-51516561 GGCAGAAAGCAGTGGGTCCCTGG - Intronic
1071358065 10:84818190-84818212 GGTGGCATGGAGTGGGATGCAGG + Intergenic
1072122992 10:92420290-92420312 GGCGGCCAGCAGAGGGCCGCCGG + Intergenic
1072727593 10:97824085-97824107 GGCGGCCAGCGGTTGGACACAGG + Intergenic
1073150459 10:101307813-101307835 GGAGGCAAGAGGTGGGAGGCTGG + Intergenic
1074753317 10:116607445-116607467 GGAGGAAAGCAGAGGGCCGCGGG + Intronic
1075400726 10:122159667-122159689 GGTGGCGAGCAGAGGGAGGCTGG - Intronic
1075886035 10:125900091-125900113 GGCAGCAAGCAGAGGAAGGCAGG + Intronic
1077200984 11:1307457-1307479 GGCAGGGAGCAGTGGGAGGCAGG - Intronic
1080071974 11:28100171-28100193 GGCGGGAAGTGGTGGGAGGCAGG + Intronic
1083259656 11:61516214-61516236 GGCGGCAAGCGGTGGGCCGAGGG - Intronic
1083778080 11:64903813-64903835 GACAGCAGGCAGTGGGAAGCGGG + Intronic
1083902392 11:65649957-65649979 GGAGGCGGGCAGTGGGACCCTGG + Exonic
1084099149 11:66934034-66934056 GGAGGAAGGCAGTGGGAAGCCGG - Intronic
1084961338 11:72718319-72718341 GGGTGCAAGCAGTGAGAGGCTGG - Intronic
1085277701 11:75310526-75310548 GGCACCAGGCAGTGGGACACAGG + Intronic
1088755714 11:112883538-112883560 AGCGGCAGGAAGTGGGACACGGG + Intergenic
1089356618 11:117858133-117858155 GATGGGAAGCAGGGGGACGCTGG - Intronic
1089401482 11:118166876-118166898 GGCGCCAAGTAGTGGGTGGCCGG - Exonic
1089788188 11:120923091-120923113 GGTGGCAAACAGTGGGACACAGG + Intronic
1090326121 11:125887780-125887802 GGCCGGAAGCGGAGGGACGCGGG + Intronic
1091807314 12:3365902-3365924 GCCGGCGGGCAGGGGGACGCTGG - Intergenic
1106713264 13:32360799-32360821 GGTGGAAAGCAGTTGGACTCTGG + Intronic
1106871293 13:34024881-34024903 GGCGGAAAGTGGTGGGAGGCGGG + Intergenic
1108597158 13:51959531-51959553 GGGGGCAAGCATTGGTAGGCTGG - Intronic
1111913599 13:94338403-94338425 GGAGGCAAGCAGAGGGAGCCAGG - Intronic
1114547740 14:23514617-23514639 GGTGCCAAGCAGTAGGACCCAGG - Intergenic
1117754899 14:58964737-58964759 GGCGACAAGCAGAGGGAGGAGGG - Intergenic
1122719201 14:103712741-103712763 TGTGTCAAGCAGCGGGACGCTGG + Intronic
1122862258 14:104587916-104587938 GGAGTCAAGCAGAGGGAGGCGGG + Intronic
1202872040 14_GL000225v1_random:173870-173892 GGCAGCAAGCAGAGGAAGGCAGG - Intergenic
1126110859 15:45173941-45173963 GGTGGCAAGCAGCAGGATGCAGG + Intronic
1129002636 15:72346981-72347003 GGAGGCAAGCAGTGGGACCCAGG + Intronic
1132574568 16:658577-658599 GGCGGCAATCAGCAGGAAGCGGG - Exonic
1135314959 16:21436749-21436771 GGCGGCAAGGGATGGGGCGCAGG - Intronic
1135367885 16:21869017-21869039 GGCGGCAAGGGATGGGGCGCAGG - Intronic
1135443932 16:22502132-22502154 GGCGGCAAGGGATGGGGCGCAGG + Intronic
1136192810 16:28628048-28628070 GGCGGCAAGGGATGGGGCGCAGG + Intergenic
1136311629 16:29415410-29415432 GGCGGCAAGGGATGGGGCGCAGG - Intergenic
1136325072 16:29517205-29517227 GGCGGCAAGGGATGGGGCGCAGG - Intergenic
1136439757 16:30257189-30257211 GGCGGCAAGGGATGGGGCGCAGG - Intergenic
1138373160 16:56543323-56543345 AGAGGCAAGCAGTGGGAGGGAGG - Intergenic
1139859155 16:70006453-70006475 GGCGGCAAGGGATGGGGCGCAGG - Intergenic
1139886259 16:70209486-70209508 GGCGGCAAGGGATGGGGCGCAGG - Intergenic
1141734576 16:85843745-85843767 GGAGGCCAGCACTGGGGCGCTGG - Intergenic
1142753084 17:1999927-1999949 GGGGGCAGGCAGTGGGGCCCTGG + Intronic
1142860058 17:2755828-2755850 CGCGGGAAGCAGCGGGGCGCGGG + Intergenic
1144033439 17:11342339-11342361 GGTGGCAGGCAGAGGGAGGCAGG + Intronic
1146890187 17:36501788-36501810 GAGGGCAGGCAGTGGGACACGGG - Intronic
1151598414 17:75091627-75091649 GGAGGGAAGCAGTGGGGTGCTGG + Intronic
1153382223 18:4453890-4453912 GGCGGCAAGCAGTGGGACGCTGG - Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1160671343 19:365302-365324 GGGGCCAAGCAGTGGGGCCCTGG + Intronic
1161162437 19:2768753-2768775 GGCGCCACGCAGTGGCAGGCGGG + Intronic
1163155590 19:15438479-15438501 AGCGCCAAGCAGGGGGACACTGG - Intronic
1163666579 19:18606511-18606533 GGGGGGAAGGAGTGGGGCGCCGG + Intronic
1165060515 19:33202846-33202868 AGCGGCCTGCAGTGGGAAGCTGG + Exonic
1167019031 19:46860947-46860969 GGCGGCAACCAGGGGGAGGGCGG - Intergenic
1168258922 19:55181968-55181990 GACGGGAGGCAGTGGGACGAGGG - Intronic
927716480 2:25356326-25356348 GGAGGCAGGAAGTGGGATGCAGG + Intergenic
935676379 2:105598083-105598105 GGAGGCAGGCAGAGGGAGGCAGG - Intergenic
935743567 2:106172210-106172232 GGTGACAAGCAGTGGGGGGCGGG + Intronic
939958042 2:148542995-148543017 GGAGGCAGGCAGTGGTACGAGGG - Intergenic
945470639 2:210224855-210224877 AGCGGCCTGCAGTGGGACCCGGG - Intronic
948163381 2:235843271-235843293 GGCAGCAAGCAGTGAGACCCAGG - Intronic
948893052 2:240916379-240916401 GGGGGCGAGCAGGGGGGCGCAGG - Intergenic
1170697030 20:18668493-18668515 GGAGCCAAGCAGTGGGACGGTGG + Intronic
1173894679 20:46541793-46541815 GGCGGGTAGCAGTGGGCAGCGGG + Exonic
1175583888 20:60122109-60122131 GGTTGCAGGCAGTGGGACTCAGG - Intergenic
1180138570 21:45876945-45876967 CGGGGCAAGCAGTGGCACACAGG + Intronic
1180286054 22:10745622-10745644 GGCAGCAAGCAGAGGAAGGCAGG + Intergenic
1180597452 22:16988035-16988057 GGCGGCACACAGTGAGACACCGG + Exonic
1184498796 22:44859744-44859766 GGCGGCAGCCAGTGACACGCAGG - Exonic
1184685861 22:46096054-46096076 GGTGGCAGGCAGGGGGACCCAGG + Intronic
950124132 3:10501247-10501269 GGCGGGAGGCAGGGGGAAGCGGG - Intronic
950679273 3:14573800-14573822 GCCGGCAAGCTCTGGGGCGCTGG + Intergenic
954287624 3:49630043-49630065 GCCGGAAAGCAGTGGGATGCAGG - Intronic
968434017 4:575862-575884 GGCGCCGAGCAGTGAGAGGCCGG + Intergenic
969393368 4:6905673-6905695 GGCGGCAAGCAGCAGCACTCAGG - Intergenic
970441451 4:16083797-16083819 CGCGGCCGGCAGTGGGAGGCGGG - Intronic
970562199 4:17293236-17293258 GGAGGCAAGAAGAGGGATGCTGG - Intergenic
976147587 4:82057247-82057269 GGCGGAAAGCAGCTTGACGCTGG + Intergenic
986074963 5:4326920-4326942 GGCAGCAAGCAGAGGGCAGCAGG - Intergenic
997890511 5:137672281-137672303 GGAGGCAGGCTGTGGGAGGCAGG - Intronic
999179251 5:149657312-149657334 GGAGGCTAGCGGTGGGAGGCAGG - Intergenic
999476497 5:151904312-151904334 AGCAGAAAGCAGTGGGACTCAGG - Intronic
1003552349 6:7109523-7109545 GGCGGGGAGCTGGGGGACGCGGG + Intronic
1004000516 6:11592931-11592953 AGTGGGAAGCAGTGGGAGGCAGG + Intergenic
1004021004 6:11775450-11775472 GGCAGTAAGCAGTGGGACTGAGG + Intronic
1004235811 6:13873649-13873671 GGCGGGAGGCAGAGGGACGTCGG + Intergenic
1007224445 6:40303046-40303068 GGCGGCAAGGAGAGGGCTGCTGG - Intergenic
1012399972 6:98834946-98834968 GGCGGCATGCAGCAGGGCGCGGG + Exonic
1013322571 6:109009375-109009397 GGCTGCAAGCAGTGCGGCGGGGG - Intronic
1013479813 6:110543906-110543928 GTGGGCAAGCACTGGGACCCAGG + Intergenic
1017672426 6:156779322-156779344 GGCGGCCAGCAGGCGGCCGCGGG + Exonic
1019514333 7:1433123-1433145 GGCTGGCAGCAGTGGGACCCTGG - Intronic
1019738682 7:2662446-2662468 GGCGGCCAGCACTGGGTGGCGGG - Exonic
1023842931 7:44106939-44106961 GGAGGCAGGGAGTGGGAGGCAGG + Intronic
1024394411 7:48849199-48849221 GGGGGCAAGCATTGGGACAGTGG - Intergenic
1024400852 7:48923442-48923464 GGGGGCAAGCATTGGGACAGTGG + Intergenic
1026788051 7:73314077-73314099 GGCGGGAAGGGGTGGGAGGCGGG - Intronic
1031088433 7:117324697-117324719 GGCGGCAGGCAGCGGGGCGGGGG + Intergenic
1034951101 7:155297698-155297720 GGCCGCAACCAATGGGAGGCCGG - Intergenic
1049328025 8:142034186-142034208 TCCGACAAGCAGTGGGACCCCGG - Intergenic
1055500514 9:76898175-76898197 GGGGGCAAGAAGTGGGAAGGAGG + Intronic
1057263169 9:93597552-93597574 GGGGGCAGGCAGTGGGACATTGG + Intronic
1057716721 9:97501729-97501751 GGCGGCGGGCAGATGGACGCGGG - Exonic
1060280810 9:122214256-122214278 CGCTGCAAGCAGTGGGCGGCGGG - Intronic
1061582549 9:131546461-131546483 GGCTGGAAGCAGTGGGGCGGTGG + Intergenic
1061682321 9:132249152-132249174 GCCGGCTGGCAGTGGGACTCTGG + Intergenic
1062162539 9:135088103-135088125 GGCGGCCGGCGGCGGGACGCTGG + Exonic
1062578858 9:137221058-137221080 GGCGGGAAGCAGGGGGCAGCCGG + Exonic
1199710226 X:150463779-150463801 GGTGGCAAGCAGCAGGAGGCAGG + Intronic
1200068838 X:153517978-153518000 GGCGGCAGGTAGGGGGACACGGG + Intronic
1202628541 Y:56884895-56884917 GGCAGCAAGCAGAGGAAGGCAGG - Intergenic