ID: 1153384832

View in Genome Browser
Species Human (GRCh38)
Location 18:4480326-4480348
Sequence CAGGAGGATCACGAGGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153384824_1153384832 -1 Left 1153384824 18:4480304-4480326 CCAGCACTTTGGGAGGCCGAGGC No data
Right 1153384832 18:4480326-4480348 CAGGAGGATCACGAGGCAGGGGG No data
1153384822_1153384832 0 Left 1153384822 18:4480303-4480325 CCCAGCACTTTGGGAGGCCGAGG No data
Right 1153384832 18:4480326-4480348 CAGGAGGATCACGAGGCAGGGGG No data
1153384817_1153384832 27 Left 1153384817 18:4480276-4480298 CCAGCTGTGGTGGTTCATGCCTG No data
Right 1153384832 18:4480326-4480348 CAGGAGGATCACGAGGCAGGGGG No data
1153384820_1153384832 8 Left 1153384820 18:4480295-4480317 CCTGTAATCCCAGCACTTTGGGA No data
Right 1153384832 18:4480326-4480348 CAGGAGGATCACGAGGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153384832 Original CRISPR CAGGAGGATCACGAGGCAGG GGG Intergenic