ID: 1153388106

View in Genome Browser
Species Human (GRCh38)
Location 18:4522575-4522597
Sequence CTTTTTTAGTAGAGTGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153388101_1153388106 22 Left 1153388101 18:4522530-4522552 CCGTGTAATATAGCAATAGGAAC No data
Right 1153388106 18:4522575-4522597 CTTTTTTAGTAGAGTGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153388106 Original CRISPR CTTTTTTAGTAGAGTGATGA GGG Intergenic
No off target data available for this crispr