ID: 1153401874

View in Genome Browser
Species Human (GRCh38)
Location 18:4690801-4690823
Sequence CAGAATTAGGAGAAGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153401866_1153401874 26 Left 1153401866 18:4690752-4690774 CCAGGAACTAGTGCTCAGCTGGC 0: 41
1: 33
2: 18
3: 24
4: 174
Right 1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG No data
1153401870_1153401874 -9 Left 1153401870 18:4690787-4690809 CCTCACTCGGGCACCAGAATTAG No data
Right 1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG No data
1153401869_1153401874 -8 Left 1153401869 18:4690786-4690808 CCCTCACTCGGGCACCAGAATTA No data
Right 1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153401874 Original CRISPR CAGAATTAGGAGAAGGAAAA AGG Intergenic
No off target data available for this crispr