ID: 1153405395

View in Genome Browser
Species Human (GRCh38)
Location 18:4733054-4733076
Sequence CAGTCTTAGGGGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153405395_1153405404 -3 Left 1153405395 18:4733054-4733076 CCCTTCTCCTTCCCCTAAGACTG No data
Right 1153405404 18:4733074-4733096 CTGAAGGGGCTAGAGCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153405395 Original CRISPR CAGTCTTAGGGGAAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr