ID: 1153408224

View in Genome Browser
Species Human (GRCh38)
Location 18:4764479-4764501
Sequence TGGTGCAAACAGTAGGACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153408218_1153408224 15 Left 1153408218 18:4764441-4764463 CCTCTTATTACATGCGTTATGTA No data
Right 1153408224 18:4764479-4764501 TGGTGCAAACAGTAGGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153408224 Original CRISPR TGGTGCAAACAGTAGGACTG GGG Intergenic
No off target data available for this crispr