ID: 1153410095

View in Genome Browser
Species Human (GRCh38)
Location 18:4783168-4783190
Sequence CTGAGTTATCCCATCTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153410090_1153410095 2 Left 1153410090 18:4783143-4783165 CCCTCTTCCCCTACAATCTAAGC No data
Right 1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG No data
1153410086_1153410095 26 Left 1153410086 18:4783119-4783141 CCACCTACCTGGAACAGGATTAA No data
Right 1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG No data
1153410094_1153410095 -7 Left 1153410094 18:4783152-4783174 CCTACAATCTAAGCTGCTGAGTT No data
Right 1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG No data
1153410093_1153410095 -6 Left 1153410093 18:4783151-4783173 CCCTACAATCTAAGCTGCTGAGT No data
Right 1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG No data
1153410085_1153410095 27 Left 1153410085 18:4783118-4783140 CCCACCTACCTGGAACAGGATTA No data
Right 1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG No data
1153410089_1153410095 3 Left 1153410089 18:4783142-4783164 CCCCTCTTCCCCTACAATCTAAG No data
Right 1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG No data
1153410092_1153410095 -5 Left 1153410092 18:4783150-4783172 CCCCTACAATCTAAGCTGCTGAG No data
Right 1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG No data
1153410091_1153410095 1 Left 1153410091 18:4783144-4783166 CCTCTTCCCCTACAATCTAAGCT No data
Right 1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG No data
1153410088_1153410095 19 Left 1153410088 18:4783126-4783148 CCTGGAACAGGATTAACCCCTCT No data
Right 1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG No data
1153410087_1153410095 23 Left 1153410087 18:4783122-4783144 CCTACCTGGAACAGGATTAACCC No data
Right 1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG No data
1153410084_1153410095 28 Left 1153410084 18:4783117-4783139 CCCCACCTACCTGGAACAGGATT No data
Right 1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153410095 Original CRISPR CTGAGTTATCCCATCTCTCT AGG Intergenic
No off target data available for this crispr